Starting /dee2/code/volunteer_pipeline.sh SRR7169089 current disk space = 3056350302208 free memory = 1575250692 SRR7169089 SRAfilesize 3d14b0d5af566db63fa45927b5dc178c SRR7169089.sra SRR7169089.sra file validated SRR7169089 is paired end SRR7169089 is conventional basespace SRR7169089 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169089_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.979 34.0 33.0 34.0 33.0 34.0 2 33.3545 34.0 33.0 34.0 33.0 34.0 3 33.369 34.0 34.0 34.0 33.0 34.0 4 33.4285 34.0 34.0 34.0 33.0 34.0 5 33.44125 34.0 34.0 34.0 33.0 34.0 6 36.7675 38.0 37.0 38.0 35.0 38.0 7 37.2275 38.0 38.0 38.0 36.0 38.0 8 37.33225 38.0 38.0 38.0 37.0 38.0 9 37.329 38.0 38.0 38.0 37.0 38.0 10-14 37.3771 38.0 38.0 38.0 37.0 38.0 15-19 37.30045 38.0 38.0 38.0 36.8 38.0 20-24 37.28920000000001 38.0 38.0 38.0 36.8 38.0 25-29 37.1956 38.0 38.0 38.0 36.4 38.0 30-34 37.13315 38.0 38.0 38.0 36.2 38.0 35-39 37.03045 38.0 38.0 38.0 35.8 38.0 40-44 36.64695 38.0 38.0 38.0 34.2 38.0 45-49 36.4798 38.0 37.6 38.0 33.8 38.0 50-54 36.40065 38.0 37.2 38.0 34.0 38.0 55-59 36.28920000000001 38.0 37.0 38.0 33.2 38.0 60-64 36.14875000000001 38.0 37.0 38.0 32.8 38.0 65-69 36.04109999999999 38.0 37.0 38.0 33.0 38.0 70-74 35.8831 38.0 37.0 38.0 31.4 38.0 75-79 35.62565 38.0 36.4 38.0 30.2 38.0 80-84 35.5386 38.0 36.2 38.0 29.2 38.0 85-89 35.378750000000004 38.0 36.0 38.0 29.0 38.0 90-94 35.120349999999995 38.0 36.0 38.0 28.8 38.0 95-99 35.016149999999996 38.0 35.6 38.0 28.4 38.0 100-104 34.79615 38.0 35.2 38.0 27.4 38.0 105-109 34.591049999999996 38.0 35.0 38.0 26.2 38.0 110-114 34.144600000000004 38.0 34.2 38.0 23.6 38.0 115-119 33.857000000000006 38.0 34.0 38.0 22.6 38.0 120-124 33.47135 38.0 34.0 38.0 17.4 38.0 125-129 33.129999999999995 37.8 33.4 38.0 15.0 38.0 130-134 32.711 37.2 32.6 38.0 15.0 38.0 135-139 32.0392 36.4 31.4 38.0 14.6 38.0 140-144 31.476549999999996 36.0 31.0 38.0 14.0 38.0 145-149 30.42575 36.0 29.8 38.0 6.4 38.0 150-151 25.973875 33.5 14.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 1.0 11 1.0 12 4.0 13 2.0 14 4.0 15 1.0 16 5.0 17 4.0 18 10.0 19 9.0 20 22.0 21 14.0 22 8.0 23 19.0 24 19.0 25 34.0 26 34.0 27 45.0 28 46.0 29 62.0 30 68.0 31 98.0 32 117.0 33 197.0 34 291.0 35 542.0 36 1149.0 37 1192.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.08711066092682 14.585971131932135 9.31881488984553 32.008103317295515 2 24.15 15.024999999999999 30.4 30.425 3 20.0 18.675 25.6 35.725 4 22.475 24.925 24.15 28.449999999999996 5 24.3 30.275000000000002 23.599999999999998 21.825 6 21.8 33.2 23.625 21.375 7 14.299999999999999 28.9 38.824999999999996 17.974999999999998 8 17.875 27.55 30.125 24.45 9 17.525 26.150000000000002 33.625 22.7 10-14 19.74 31.235000000000003 26.419999999999998 22.605 15-19 19.695 29.235 27.944999999999997 23.125 20-24 20.71 28.804999999999996 27.79 22.695 25-29 20.49 28.994999999999997 26.845000000000002 23.669999999999998 30-34 19.62 29.415000000000003 27.11 23.855 35-39 20.105 29.845 26.685 23.365 40-44 19.825 29.595 27.075 23.505000000000003 45-49 20.445 28.78 27.229999999999997 23.544999999999998 50-54 20.255000000000003 28.825 27.1 23.82 55-59 20.34 29.195 27.029999999999998 23.435 60-64 20.32 29.044999999999998 27.01 23.625 65-69 20.4 28.71 27.029999999999998 23.86 70-74 20.835 29.25 26.240000000000002 23.674999999999997 75-79 20.66 28.849999999999998 26.855 23.635 80-84 20.915 29.304999999999996 26.505000000000003 23.275000000000002 85-89 20.355 29.07 26.52 24.055 90-94 20.77 28.705000000000002 26.384999999999998 24.14 95-99 20.68 28.410000000000004 27.48 23.43 100-104 20.54 28.970000000000002 26.810000000000002 23.68 105-109 20.65 27.900000000000002 27.62 23.830000000000002 110-114 21.025 28.349999999999998 26.96 23.665 115-119 20.849999999999998 28.12 27.389999999999997 23.64 120-124 20.885 28.144999999999996 27.015 23.955000000000002 125-129 20.895 28.54 26.58 23.985 130-134 20.880000000000003 27.67 27.79 23.66 135-139 20.580000000000002 28.125 27.944999999999997 23.35 140-144 21.485000000000003 27.705000000000002 26.810000000000002 24.0 145-149 21.275 27.689999999999998 27.52 23.515 150-151 21.0375 28.000000000000004 26.6 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 1.0 20 1.5 21 2.0 22 2.5 23 4.5 24 4.5 25 4.5 26 7.0 27 9.5 28 9.0 29 12.5 30 21.5 31 28.5 32 36.0 33 43.0 34 60.0 35 77.5 36 93.0 37 111.0 38 121.5 39 143.5 40 175.5 41 202.0 42 209.0 43 234.5 44 270.0 45 258.0 46 257.5 47 259.5 48 232.0 49 191.0 50 172.0 51 153.5 52 124.5 53 113.0 54 83.5 55 62.0 56 50.5 57 38.0 58 29.0 59 20.5 60 14.0 61 10.0 62 11.0 63 7.0 64 3.5 65 5.5 66 4.5 67 4.0 68 4.5 69 2.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49647532729104 98.8 2 0.4531722054380665 0.8999999999999999 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025176233635448138 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCAACAATCTCGTATGC 9 0.22499999999999998 TruSeq Adapter, Index 2 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.6 0.0 0.0 0.0 0.0 128-129 0.6625000000000001 0.0 0.0 0.0 0.0 130-131 0.7375 0.0 0.0 0.0 0.0 132-133 0.85 0.0 0.0 0.0 0.0 134-135 1.0125 0.0 0.0 0.0 0.0 136-137 1.275 0.0 0.0 0.0 0.0 138-139 1.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATGA 10 0.006577216 146.82278 1 GAGTAAT 10 0.006832588 144.9875 6 TGAGTAA 10 0.006832588 144.9875 5 TTTAAAA 10 0.006832588 144.9875 7 TTTTTTT 70 9.357257E-4 41.425 2 >>END_MODULE SRR7169089 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169089_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.635 33.0 33.0 34.0 32.0 34.0 2 32.60325 33.0 33.0 34.0 32.0 34.0 3 32.716 34.0 33.0 34.0 32.0 34.0 4 32.6085 34.0 33.0 34.0 32.0 34.0 5 32.61175 34.0 33.0 34.0 32.0 34.0 6 36.6975 38.0 38.0 38.0 36.0 38.0 7 36.749 38.0 38.0 38.0 36.0 38.0 8 36.677 38.0 38.0 38.0 36.0 38.0 9 36.702 38.0 38.0 38.0 36.0 38.0 10-14 36.7182 38.0 38.0 38.0 36.0 38.0 15-19 36.657 38.0 38.0 38.0 35.8 38.0 20-24 36.6179 38.0 38.0 38.0 36.0 38.0 25-29 36.6449 38.0 38.0 38.0 36.0 38.0 30-34 36.6031 38.0 38.0 38.0 36.0 38.0 35-39 36.5638 38.0 38.0 38.0 36.0 38.0 40-44 36.5021 38.0 38.0 38.0 35.4 38.0 45-49 36.38215 38.0 38.0 38.0 34.8 38.0 50-54 36.3939 38.0 38.0 38.0 35.0 38.0 55-59 36.40405 38.0 38.0 38.0 35.0 38.0 60-64 36.35045 38.0 38.0 38.0 34.6 38.0 65-69 36.1909 38.0 38.0 38.0 34.2 38.0 70-74 36.073750000000004 38.0 38.0 38.0 34.0 38.0 75-79 36.04105 38.0 38.0 38.0 34.0 38.0 80-84 36.0118 38.0 38.0 38.0 34.0 38.0 85-89 36.00565 38.0 38.0 38.0 33.8 38.0 90-94 35.8725 38.0 38.0 38.0 33.6 38.0 95-99 35.636700000000005 38.0 38.0 38.0 31.8 38.0 100-104 35.5034 38.0 37.8 38.0 31.2 38.0 105-109 35.5136 38.0 38.0 38.0 31.4 38.0 110-114 35.328700000000005 38.0 37.2 38.0 29.8 38.0 115-119 35.12065 38.0 37.0 38.0 28.6 38.0 120-124 34.86965 38.0 36.6 38.0 27.6 38.0 125-129 34.6592 38.0 36.0 38.0 27.0 38.0 130-134 34.39135 38.0 36.0 38.0 24.6 38.0 135-139 34.0013 38.0 35.0 38.0 21.8 38.0 140-144 33.6617 38.0 35.0 38.0 19.0 38.0 145-149 32.8168 38.0 34.8 38.0 11.4 38.0 150-151 29.199375 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 16.0 4 5.0 5 2.0 6 4.0 7 5.0 8 4.0 9 2.0 10 2.0 11 4.0 12 5.0 13 3.0 14 6.0 15 5.0 16 4.0 17 11.0 18 9.0 19 2.0 20 6.0 21 14.0 22 10.0 23 16.0 24 16.0 25 17.0 26 19.0 27 29.0 28 32.0 29 48.0 30 56.0 31 70.0 32 86.0 33 107.0 34 119.0 35 192.0 36 437.0 37 2617.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.375 24.4 12.625 23.599999999999998 2 27.975 26.8 26.75 18.475 3 22.375 28.749999999999996 29.625 19.25 4 24.375 31.525 23.775 20.325 5 24.8 36.449999999999996 21.4 17.349999999999998 6 21.475 37.8 22.775000000000002 17.95 7 21.425 22.35 36.55 19.675 8 21.925 26.174999999999997 26.424999999999997 25.474999999999998 9 21.75 26.55 29.599999999999998 22.1 10-14 23.565 28.955 25.77 21.709999999999997 15-19 23.7 27.76 27.400000000000002 21.14 20-24 23.465 28.305000000000003 26.805 21.425 25-29 23.74 28.115000000000002 26.86 21.285 30-34 23.61 27.425 27.345000000000002 21.62 35-39 23.89 27.685 27.555000000000003 20.87 40-44 23.625 27.72 26.665 21.990000000000002 45-49 23.87 27.27 27.279999999999998 21.58 50-54 23.35 27.584999999999997 27.810000000000002 21.255 55-59 23.419999999999998 27.975 27.200000000000003 21.404999999999998 60-64 23.830000000000002 27.939999999999998 26.779999999999998 21.45 65-69 24.168003207698476 28.002205292702488 26.623897353648758 21.20589414595028 70-74 24.042126379137414 27.673019057171516 26.990972918756267 21.293881644934803 75-79 23.21186907924415 27.45225803217884 27.998596561575862 21.337276327001153 80-84 23.76 28.560000000000002 26.495 21.185000000000002 85-89 23.775 27.495000000000005 27.505000000000003 21.224999999999998 90-94 23.515 27.445000000000004 27.62 21.42 95-99 23.255 27.43 27.855 21.46 100-104 24.5 27.355 27.46 20.685000000000002 105-109 23.425 27.26 27.76 21.555 110-114 23.56 28.03 27.744999999999997 20.665 115-119 24.575 27.555000000000003 27.38 20.49 120-124 23.84 27.634999999999998 27.77 20.755000000000003 125-129 24.16 27.51 27.560000000000002 20.77 130-134 23.605 27.26 27.785 21.349999999999998 135-139 23.537353735373536 27.767776777677767 27.567756775677566 21.127112711271128 140-144 23.902927195396547 27.425569176882664 27.435576682511886 21.23592694520891 145-149 24.333417022344968 27.737886015566154 27.11021842832036 20.818478533768516 150-151 23.371550963840242 27.11351896182437 28.738818193272014 20.776111881063375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.5 22 2.0 23 1.0 24 0.5 25 0.5 26 2.0 27 2.5 28 3.5 29 6.5 30 9.0 31 10.5 32 12.0 33 19.0 34 30.5 35 45.0 36 65.5 37 83.0 38 102.5 39 138.5 40 171.0 41 203.0 42 234.0 43 271.0 44 303.0 45 313.0 46 300.0 47 277.5 48 255.0 49 225.5 50 193.5 51 146.5 52 123.0 53 109.5 54 83.0 55 68.0 56 52.0 57 33.0 58 23.5 59 18.5 60 14.5 61 10.0 62 8.5 63 7.5 64 3.5 65 1.5 66 3.5 67 4.0 68 2.0 69 1.0 70 0.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.24 70-74 0.3 75-79 0.245 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.075 145-149 0.42500000000000004 150-151 0.7875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.37678975131876413 0.75 3 0.0 0.0 4 0.0 0.0 5 0.025119316754584273 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.3375 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.4125 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.575 0.0 0.0 0.0 0.0 128-129 0.6375 0.0 0.0 0.0 0.0 130-131 0.7125 0.0 0.0 0.0 0.0 132-133 0.8374999999999999 0.0 0.0 0.0 0.0 134-135 0.9874999999999999 0.0 0.0 0.0 0.0 136-137 1.2375 0.0 0.0 0.0 0.0 138-139 1.3875000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTCTC 10 0.006830828 145.0 6 CAATTCT 10 0.006830828 145.0 5 AAGAAGT 10 0.006830828 145.0 145 GAGATAT 10 0.006830828 145.0 2 >>END_MODULE Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806526 spots for SRR7169089.sra Written 806526 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra Read 806511 spots for SRR7169089.sra Written 806511 spots for SRR7169089.sra SRR ids: ['SRR7169089.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mj0bn1mn SRR7169089.sra spots: 16130235 blocks: [[1, 806511], [806512, 1613022], [1613023, 2419533], [2419534, 3226044], [3226045, 4032555], [4032556, 4839066], [4839067, 5645577], [5645578, 6452088], [6452089, 7258599], [7258600, 8065110], [8065111, 8871621], [8871622, 9678132], [9678133, 10484643], [10484644, 11291154], [11291155, 12097665], [12097666, 12904176], [12904177, 13710687], [13710688, 14517198], [14517199, 15323709], [15323710, 16130235]] SRR7169089 file size 5444306 SRR7169089 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169089 SRR7169089_1.fastq SRR7169089_2.fastq Input file: SRR7169089_1.fastq Paired file: SRR7169089_2.fastq trimmed: SRR7169089-trimmed-pair1.fastq, SRR7169089-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:59:35 2025 >> started Mon Feb 10 20:59:54 2025 >> done (18.422s) 16130235 read pairs processed; of these: 32743 ( 0.20%) short read pairs filtered out after trimming by size control 54837 ( 0.34%) empty read pairs filtered out after trimming by size control 16042655 (99.46%) read pairs available; of these: 8113995 (50.58%) trimmed read pairs available after processing 7928660 (49.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 6 0.00% 21 10 0.00% 22 5 0.00% 23 2 0.00% 24 6 0.00% 25 7 0.00% 26 10 0.00% 27 14 0.00% 28 13 0.00% 29 11 0.00% 30 19 0.00% 31 9 0.00% 32 12 0.00% 33 13 0.00% 34 13 0.00% 35 9 0.00% 36 18 0.00% 37 18 0.00% 38 26 0.00% 39 26 0.00% 40 23 0.00% 41 32 0.00% 42 36 0.00% 43 33 0.00% 44 36 0.00% 45 35 0.00% 46 38 0.00% 47 43 0.00% 48 49 0.00% 49 57 0.00% 50 63 0.00% 51 58 0.00% 52 75 0.00% 53 65 0.00% 54 82 0.00% 55 94 0.00% 56 96 0.00% 57 94 0.00% 58 86 0.00% 59 133 0.00% 60 143 0.00% 61 154 0.00% 62 169 0.00% 63 156 0.00% 64 202 0.00% 65 162 0.00% 66 216 0.00% 67 244 0.00% 68 244 0.00% 69 262 0.00% 70 296 0.00% 71 367 0.00% 72 393 0.00% 73 381 0.00% 74 444 0.00% 75 511 0.00% 76 532 0.00% 77 589 0.00% 78 697 0.00% 79 785 0.00% 80 835 0.01% 81 961 0.01% 82 1131 0.01% 83 1367 0.01% 84 2633 0.02% 85 3207 0.02% 86 3229 0.02% 87 3345 0.02% 88 3375 0.02% 89 3365 0.02% 90 3491 0.02% 91 3599 0.02% 92 3765 0.02% 93 3947 0.02% 94 4260 0.03% 95 4422 0.03% 96 4781 0.03% 97 5138 0.03% 98 5617 0.04% 99 5728 0.04% 100 6026 0.04% 101 6471 0.04% 102 6756 0.04% 103 6933 0.04% 104 7703 0.05% 105 8112 0.05% 106 8630 0.05% 107 9096 0.06% 108 9896 0.06% 109 10158 0.06% 110 11243 0.07% 111 11618 0.07% 112 12389 0.08% 113 13127 0.08% 114 13708 0.09% 115 14646 0.09% 116 15772 0.10% 117 16450 0.10% 118 17553 0.11% 119 18507 0.12% 120 19695 0.12% 121 20722 0.13% 122 22272 0.14% 123 23720 0.15% 124 24944 0.16% 125 27053 0.17% 126 28875 0.18% 127 30725 0.19% 128 32761 0.20% 129 34803 0.22% 130 37501 0.23% 131 40678 0.25% 132 43949 0.27% 133 47193 0.29% 134 50989 0.32% 135 55372 0.35% 136 60459 0.38% 137 66993 0.42% 138 74969 0.47% 139 83460 0.52% 140 91659 0.57% 141 100893 0.63% 142 115359 0.72% 143 132864 0.83% 144 157575 0.98% 145 194002 1.21% 146 250375 1.56% 147 346856 2.16% 148 541029 3.37% 149 1043006 6.50% 150 4011828 25.01% 151 7928660 49.42% 16042655 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=37 prefix-density=0.27 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=223.47 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=17.6 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=5.19 fanout-score-rank=21 prefix-density=0.35 prefix-fanout=3.9 sequence=CAGTTTGTTGACTGGTGCCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=142.68 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=13.1 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169089 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:00:42 Started mapping on | Feb 10 21:00:42 Finished on | Feb 10 21:02:28 Mapping speed, Million of reads per hour | 544.84 Number of input reads | 16042655 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14846814 Uniquely mapped reads % | 92.55% Average mapped length | 295.78 Number of splices: Total | 13291158 Number of splices: Annotated (sjdb) | 13078330 Number of splices: GT/AG | 13101023 Number of splices: GC/AG | 153123 Number of splices: AT/AC | 10387 Number of splices: Non-canonical | 26625 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305370 % of reads mapped to multiple loci | 1.90% Number of reads mapped to too many loci | 34699 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.28% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 918375 918375 918375 N_multimapping 305370 305370 305370 N_noFeature 266716 14661043 330345 N_ambiguous 183377 759 60743 UnstrandedReadsAssigned:14396721 PositiveStrandReadsAssigned:185012 NegativeStrandReadsAssigned:14455726 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169089 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169089-trimmed-pair1.fastq SRR7169089-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,042,655 reads, 14,386,013 reads pseudoaligned [quant] estimated average fragment length: 266.377 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR7169089.ke.tsv 34699 SRR7169089.se.tsv 87100 total ==> SRR7169089.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.62 337 10.7118 Potri.005G024800.1.v4.1 1035 769.623 38 2.75059 Potri.004G059700.1.v4.1 961 695.65 2 0.160162 Potri.007G009000.2.v4.1 1416 1150.62 0 0 Potri.003G141000.2.v4.1 2943 2677.62 253.037 5.26447 Potri.016G087400.1.v4.1 270 61.2304 1392 1266.46 Potri.015G069301.1.v4.1 564 302.791 0 0 Potri.010G195200.1.v4.1 1773 1507.62 5 0.184755 Potri.012G127500.1.v4.1 977 711.63 5995 469.304 ==> SRR7169089.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 923 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 326 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169089 completed mapping pipeline successfully