Starting /dee2/code/volunteer_pipeline.sh SRR7169090 current disk space = 3056062636032 free memory = 1118350160 SRR7169090 SRAfilesize 0da938ed98f37b44cc7dd67c339070d7 SRR7169090.sra SRR7169090.sra file validated SRR7169090 is paired end SRR7169090 is conventional basespace SRR7169090 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169090_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12525 34.0 33.0 34.0 33.0 34.0 2 33.50575 34.0 34.0 34.0 33.0 34.0 3 33.488 34.0 34.0 34.0 33.0 34.0 4 33.5535 34.0 34.0 34.0 33.0 34.0 5 33.543 34.0 34.0 34.0 33.0 34.0 6 37.22025 38.0 38.0 38.0 36.0 38.0 7 37.43875 38.0 38.0 38.0 37.0 38.0 8 37.50325 38.0 38.0 38.0 37.0 38.0 9 37.54225 38.0 38.0 38.0 38.0 38.0 10-14 37.54445 38.0 38.0 38.0 38.0 38.0 15-19 37.4926 38.0 38.0 38.0 37.8 38.0 20-24 37.4225 38.0 38.0 38.0 37.4 38.0 25-29 37.41735 38.0 38.0 38.0 37.2 38.0 30-34 37.38725 38.0 38.0 38.0 37.0 38.0 35-39 37.274649999999994 38.0 38.0 38.0 36.8 38.0 40-44 37.039699999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.881899999999995 38.0 38.0 38.0 35.4 38.0 50-54 36.7838 38.0 38.0 38.0 34.8 38.0 55-59 36.69155 38.0 38.0 38.0 34.6 38.0 60-64 36.60905 38.0 38.0 38.0 34.4 38.0 65-69 36.52034999999999 38.0 38.0 38.0 34.0 38.0 70-74 36.5053 38.0 38.0 38.0 34.0 38.0 75-79 36.33095 38.0 37.6 38.0 33.8 38.0 80-84 36.21810000000001 38.0 37.2 38.0 33.2 38.0 85-89 36.003750000000004 38.0 37.0 38.0 32.8 38.0 90-94 35.7987 38.0 37.0 38.0 30.8 38.0 95-99 35.6842 38.0 36.6 38.0 31.0 38.0 100-104 35.43775 38.0 36.2 38.0 30.2 38.0 105-109 35.16885 38.0 36.0 38.0 28.4 38.0 110-114 34.831 38.0 35.4 38.0 27.4 38.0 115-119 34.580600000000004 38.0 35.0 38.0 26.4 38.0 120-124 34.231399999999994 38.0 34.6 38.0 23.2 38.0 125-129 33.971199999999996 38.0 34.0 38.0 23.0 38.0 130-134 33.405899999999995 38.0 34.0 38.0 18.6 38.0 135-139 32.7574 37.8 33.2 38.0 14.8 38.0 140-144 31.8927 36.2 31.2 38.0 14.0 38.0 145-149 30.9317 36.0 31.0 38.0 8.8 38.0 150-151 26.474625 34.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 3.0 11 0.0 12 4.0 13 1.0 14 1.0 15 3.0 16 2.0 17 6.0 18 5.0 19 6.0 20 7.0 21 6.0 22 14.0 23 20.0 24 18.0 25 16.0 26 27.0 27 45.0 28 46.0 29 47.0 30 64.0 31 70.0 32 94.0 33 155.0 34 231.0 35 414.0 36 1052.0 37 1642.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.157095876549455 13.837591702504426 8.62635972678978 34.37895269415634 2 23.925 13.925 31.924999999999997 30.225 3 19.7 18.075 26.450000000000003 35.775 4 22.325 23.925 25.2 28.549999999999997 5 23.925 29.65 24.275 22.15 6 20.4 33.875 24.275 21.45 7 15.425 28.9 38.925 16.75 8 17.4 27.950000000000003 31.55 23.1 9 17.45 25.25 35.449999999999996 21.85 10-14 19.55 29.635 27.750000000000004 23.064999999999998 15-19 19.15 28.74 28.48 23.630000000000003 20-24 19.375 28.705000000000002 27.83 24.09 25-29 19.465 28.765 27.775 23.995 30-34 19.705000000000002 28.29 27.700000000000003 24.305 35-39 19.77 29.4 26.97 23.86 40-44 19.950000000000003 28.384999999999998 27.515 24.15 45-49 19.935 29.13 27.134999999999998 23.799999999999997 50-54 19.759999999999998 28.155 28.02 24.065 55-59 19.564999999999998 28.58 27.744999999999997 24.11 60-64 19.34 28.754999999999995 27.725 24.18 65-69 19.41 28.98 27.82 23.79 70-74 20.580000000000002 28.084999999999997 27.544999999999998 23.79 75-79 19.89 28.465 27.48 24.165 80-84 20.905 28.325 27.250000000000004 23.52 85-89 20.495 28.54 27.150000000000002 23.815 90-94 19.79 28.715000000000003 27.800000000000004 23.695 95-99 20.200000000000003 27.82 27.415 24.565 100-104 20.23 28.505000000000003 27.6 23.665 105-109 20.635 27.98 27.37 24.015 110-114 19.895 28.005000000000003 27.650000000000002 24.45 115-119 20.445 28.105000000000004 27.525 23.925 120-124 20.65 27.935 27.27 24.145 125-129 20.7 28.305000000000003 27.744999999999997 23.25 130-134 21.035 28.54 27.195000000000004 23.23 135-139 21.02 27.785 27.21 23.985 140-144 20.955 27.42 27.755000000000003 23.87 145-149 20.69 27.884999999999998 27.3 24.125 150-151 21.1375 27.3375 28.349999999999998 23.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 3.0 24 3.5 25 2.5 26 7.0 27 9.5 28 8.5 29 14.5 30 17.5 31 21.5 32 37.0 33 51.5 34 56.0 35 66.5 36 81.0 37 101.5 38 138.0 39 166.5 40 178.0 41 204.5 42 244.0 43 252.0 44 252.0 45 265.0 46 271.0 47 246.5 48 222.5 49 210.5 50 177.0 51 141.5 52 116.5 53 102.0 54 88.0 55 63.5 56 38.5 57 32.5 58 31.0 59 20.5 60 15.0 61 13.0 62 11.0 63 5.5 64 0.5 65 0.5 66 0.5 67 1.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3704356585243 98.65 2 0.579199194157643 1.15 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.02518257365902795 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.5375 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.825 0.0 0.0 0.0 0.0 122-123 0.95 0.0 0.0 0.0 0.0 124-125 1.0750000000000002 0.0 0.0 0.025 0.0 126-127 1.2000000000000002 0.0 0.0 0.025 0.0 128-129 1.3375 0.0 0.0 0.025 0.0 130-131 1.4375 0.0 0.0 0.025 0.0 132-133 1.5750000000000002 0.0 0.0 0.025 0.0 134-135 1.7000000000000002 0.0 0.0 0.025 0.0 136-137 1.85 0.0 0.0 0.025 0.0 138-139 2.0999999999999996 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169090 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169090_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90725 33.0 33.0 34.0 32.0 34.0 2 33.06125 34.0 33.0 34.0 32.0 34.0 3 33.02425 34.0 33.0 34.0 32.0 34.0 4 32.9985 34.0 33.0 34.0 33.0 34.0 5 32.993 34.0 33.0 34.0 33.0 34.0 6 37.10875 38.0 38.0 38.0 37.0 38.0 7 37.12 38.0 38.0 38.0 37.0 38.0 8 37.12425 38.0 38.0 38.0 37.0 38.0 9 37.10325 38.0 38.0 38.0 37.0 38.0 10-14 37.03745 38.0 38.0 38.0 37.0 38.0 15-19 37.0572 38.0 38.0 38.0 37.0 38.0 20-24 36.9804 38.0 38.0 38.0 37.0 38.0 25-29 37.02805 38.0 38.0 38.0 37.0 38.0 30-34 36.990249999999996 38.0 38.0 38.0 37.0 38.0 35-39 36.94535 38.0 38.0 38.0 37.0 38.0 40-44 36.962 38.0 38.0 38.0 37.0 38.0 45-49 36.9226 38.0 38.0 38.0 36.8 38.0 50-54 36.8895 38.0 38.0 38.0 36.8 38.0 55-59 36.877449999999996 38.0 38.0 38.0 36.6 38.0 60-64 36.8562 38.0 38.0 38.0 36.2 38.0 65-69 36.7475 38.0 38.0 38.0 36.0 38.0 70-74 36.6626 38.0 38.0 38.0 36.0 38.0 75-79 36.6303 38.0 38.0 38.0 36.0 38.0 80-84 36.628750000000004 38.0 38.0 38.0 35.8 38.0 85-89 36.58545 38.0 38.0 38.0 35.6 38.0 90-94 36.44610000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.36765 38.0 38.0 38.0 34.8 38.0 100-104 36.18485 38.0 38.0 38.0 34.0 38.0 105-109 36.02735 38.0 38.0 38.0 33.8 38.0 110-114 35.96465 38.0 38.0 38.0 33.8 38.0 115-119 35.75775 38.0 38.0 38.0 33.2 38.0 120-124 35.6132 38.0 37.8 38.0 31.8 38.0 125-129 35.33555 38.0 37.2 38.0 30.6 38.0 130-134 35.22775 38.0 36.8 38.0 31.0 38.0 135-139 34.8733 38.0 36.2 38.0 29.4 38.0 140-144 34.2241 38.0 35.8 38.0 24.0 38.0 145-149 33.58675 38.0 35.0 38.0 18.6 38.0 150-151 30.26725 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 9.0 4 5.0 5 0.0 6 3.0 7 1.0 8 3.0 9 1.0 10 2.0 11 1.0 12 1.0 13 2.0 14 5.0 15 6.0 16 4.0 17 4.0 18 9.0 19 4.0 20 13.0 21 5.0 22 14.0 23 6.0 24 9.0 25 13.0 26 27.0 27 25.0 28 28.0 29 34.0 30 36.0 31 50.0 32 57.0 33 75.0 34 102.0 35 159.0 36 413.0 37 2864.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.95 23.400000000000002 13.950000000000001 24.7 2 29.125 26.775 26.950000000000003 17.150000000000002 3 21.525 27.775 31.0 19.7 4 23.025000000000002 34.0 23.775 19.2 5 25.474999999999998 34.575 21.7 18.25 6 22.175 37.05 22.900000000000002 17.875 7 20.724999999999998 22.55 37.325 19.400000000000002 8 23.225 26.474999999999998 26.650000000000002 23.65 9 22.05 25.324999999999996 30.3 22.325 10-14 24.185000000000002 29.09 25.919999999999998 20.805 15-19 23.9 28.015 27.01 21.075 20-24 23.945 28.634999999999998 26.284999999999997 21.135 25-29 23.745 28.59 26.77 20.895 30-34 24.044999999999998 28.67 26.445 20.84 35-39 24.055 27.82 27.37 20.755000000000003 40-44 23.830000000000002 28.285 27.485 20.4 45-49 24.095 27.85 27.400000000000002 20.655 50-54 23.51 28.315 27.24 20.935000000000002 55-59 23.49 28.155 27.52 20.835 60-64 23.48 28.465 27.400000000000002 20.655 65-69 23.84912087361619 28.20217402194059 27.365626408856386 20.583078695586835 70-74 23.724988716714307 27.842134296173715 26.974574996238903 21.458301990873075 75-79 24.098557692307693 27.689302884615387 27.393830128205128 20.818309294871796 80-84 23.765 27.855 27.605 20.775 85-89 24.099999999999998 27.644999999999996 27.779999999999998 20.474999999999998 90-94 24.025 27.67 27.55 20.755000000000003 95-99 24.08 28.17 27.229999999999997 20.52 100-104 24.59 27.589999999999996 27.33 20.49 105-109 23.97 27.98 27.589999999999996 20.46 110-114 23.905 28.305000000000003 27.395000000000003 20.395 115-119 24.34 27.77 27.744999999999997 20.145 120-124 24.085 27.939999999999998 27.665 20.31 125-129 24.075 27.955000000000002 27.405 20.565 130-134 24.39 27.1 27.705000000000002 20.805 135-139 24.20662729001902 27.45520072079287 27.885674241665832 20.452497747522276 140-144 23.51169561289027 27.507278385704247 28.149784158217045 20.831241843188437 145-149 24.71898785221029 27.330006552749637 27.753414990674933 20.19759060436514 150-151 24.535691724573596 27.201516108654456 27.45420088439672 20.808591282375236 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 1.0 25 3.0 26 4.0 27 4.0 28 4.5 29 6.5 30 6.5 31 12.5 32 20.5 33 25.0 34 35.5 35 46.0 36 58.5 37 82.0 38 110.0 39 152.5 40 197.5 41 237.5 42 267.0 43 283.0 44 294.0 45 284.0 46 277.0 47 262.0 48 236.0 49 211.5 50 174.0 51 147.5 52 128.0 53 104.0 54 82.5 55 64.5 56 46.0 57 29.5 58 24.5 59 22.0 60 16.0 61 10.0 62 7.0 63 5.5 64 4.5 65 2.0 66 1.0 67 1.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.185 70-74 0.295 75-79 0.16 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.11 140-144 0.38999999999999996 145-149 0.8049999999999999 150-151 1.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.5375 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.85 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.1124999999999998 0.0 0.0 0.0 0.0 126-127 1.2625000000000002 0.0 0.0 0.0 0.0 128-129 1.4125 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.625 0.0 0.0 0.0 0.0 134-135 1.75 0.0 0.0 0.0 0.0 136-137 1.9125 0.0 0.0 0.0 0.0 138-139 2.1500000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701463 spots for SRR7169090.sra Written 701463 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra Read 701448 spots for SRR7169090.sra Written 701448 spots for SRR7169090.sra SRR ids: ['SRR7169090.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_810mc513 SRR7169090.sra spots: 14028975 blocks: [[1, 701448], [701449, 1402896], [1402897, 2104344], [2104345, 2805792], [2805793, 3507240], [3507241, 4208688], [4208689, 4910136], [4910137, 5611584], [5611585, 6313032], [6313033, 7014480], [7014481, 7715928], [7715929, 8417376], [8417377, 9118824], [9118825, 9820272], [9820273, 10521720], [10521721, 11223168], [11223169, 11924616], [11924617, 12626064], [12626065, 13327512], [13327513, 14028975]] SRR7169090 file size 4732258 SRR7169090 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169090 SRR7169090_1.fastq SRR7169090_2.fastq Input file: SRR7169090_1.fastq Paired file: SRR7169090_2.fastq trimmed: SRR7169090-trimmed-pair1.fastq, SRR7169090-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:29:58 2025 >> started Mon Feb 10 20:30:13 2025 >> done (14.284s) 14028975 read pairs processed; of these: 17810 ( 0.13%) short read pairs filtered out after trimming by size control 13582 ( 0.10%) empty read pairs filtered out after trimming by size control 13997583 (99.78%) read pairs available; of these: 7626386 (54.48%) trimmed read pairs available after processing 6371197 (45.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 10 0.00% 20 9 0.00% 21 7 0.00% 22 5 0.00% 23 5 0.00% 24 7 0.00% 25 5 0.00% 26 6 0.00% 27 9 0.00% 28 11 0.00% 29 8 0.00% 30 6 0.00% 31 5 0.00% 32 6 0.00% 33 12 0.00% 34 12 0.00% 35 16 0.00% 36 14 0.00% 37 26 0.00% 38 10 0.00% 39 12 0.00% 40 14 0.00% 41 19 0.00% 42 16 0.00% 43 23 0.00% 44 16 0.00% 45 34 0.00% 46 41 0.00% 47 29 0.00% 48 36 0.00% 49 38 0.00% 50 30 0.00% 51 48 0.00% 52 51 0.00% 53 55 0.00% 54 51 0.00% 55 78 0.00% 56 70 0.00% 57 70 0.00% 58 76 0.00% 59 86 0.00% 60 94 0.00% 61 90 0.00% 62 120 0.00% 63 108 0.00% 64 132 0.00% 65 132 0.00% 66 164 0.00% 67 185 0.00% 68 205 0.00% 69 224 0.00% 70 257 0.00% 71 275 0.00% 72 293 0.00% 73 326 0.00% 74 396 0.00% 75 386 0.00% 76 463 0.00% 77 545 0.00% 78 566 0.00% 79 619 0.00% 80 713 0.01% 81 864 0.01% 82 992 0.01% 83 1180 0.01% 84 1869 0.01% 85 2371 0.02% 86 2408 0.02% 87 2684 0.02% 88 2898 0.02% 89 3003 0.02% 90 3089 0.02% 91 3128 0.02% 92 3342 0.02% 93 3458 0.02% 94 3738 0.03% 95 4019 0.03% 96 4290 0.03% 97 4644 0.03% 98 4845 0.03% 99 5044 0.04% 100 5558 0.04% 101 5783 0.04% 102 6211 0.04% 103 6724 0.05% 104 7061 0.05% 105 7719 0.06% 106 8323 0.06% 107 8804 0.06% 108 9377 0.07% 109 9920 0.07% 110 10153 0.07% 111 10892 0.08% 112 11332 0.08% 113 12349 0.09% 114 13106 0.09% 115 13846 0.10% 116 14840 0.11% 117 15730 0.11% 118 16483 0.12% 119 17128 0.12% 120 18086 0.13% 121 19155 0.14% 122 20427 0.15% 123 21939 0.16% 124 22998 0.16% 125 24780 0.18% 126 26339 0.19% 127 28383 0.20% 128 30055 0.21% 129 32588 0.23% 130 34453 0.25% 131 36849 0.26% 132 40047 0.29% 133 43430 0.31% 134 47077 0.34% 135 51556 0.37% 136 56865 0.41% 137 62676 0.45% 138 70571 0.50% 139 79919 0.57% 140 87429 0.62% 141 98747 0.71% 142 114128 0.82% 143 131053 0.94% 144 158634 1.13% 145 195132 1.39% 146 252501 1.80% 147 354388 2.53% 148 550125 3.93% 149 1011058 7.22% 150 3628408 25.92% 151 6371197 45.52% 13997583 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=36 prefix-density=0.18 prefix-fanout=2.4 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=246.43 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=18.0 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=6.80 fanout-score-rank=22 prefix-density=0.31 prefix-fanout=3.9 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.07 sequence-density-rank=30 fanout-score=64.27 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=13.5 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCGCACAATCCAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGGCGAGGGTATGGAGGAAGGAGAGTTCTCAGAGGCTCGTGAGGATCTTGCTGCCCTGGAGAAGGATTATGAGGAGGTTG SRR7169090 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:31:00 Started mapping on | Feb 10 20:31:00 Finished on | Feb 10 20:33:22 Mapping speed, Million of reads per hour | 354.87 Number of input reads | 13997583 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12717693 Uniquely mapped reads % | 90.86% Average mapped length | 295.35 Number of splices: Total | 11146344 Number of splices: Annotated (sjdb) | 10939940 Number of splices: GT/AG | 10973395 Number of splices: GC/AG | 136485 Number of splices: AT/AC | 9450 Number of splices: Non-canonical | 27014 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 239517 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 37447 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.09% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1057344 1057344 1057344 N_multimapping 239517 239517 239517 N_noFeature 312155 12547370 380044 N_ambiguous 164137 1180 61044 UnstrandedReadsAssigned:12241401 PositiveStrandReadsAssigned:169143 NegativeStrandReadsAssigned:12276605 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169090 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169090-trimmed-pair1.fastq SRR7169090-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,997,583 reads, 12,260,147 reads pseudoaligned [quant] estimated average fragment length: 259.403 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR7169090.ke.tsv 34699 SRR7169090.se.tsv 87100 total ==> SRR7169090.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.6 419 18.5187 Potri.005G024800.1.v4.1 1035 776.597 120 12.017 Potri.004G059700.1.v4.1 961 702.614 9 0.996176 Potri.007G009000.2.v4.1 1416 1157.6 0 0 Potri.003G141000.2.v4.1 2943 2684.6 231 6.6918 Potri.016G087400.1.v4.1 270 64.9226 903 1081.69 Potri.015G069301.1.v4.1 564 309.265 0 0 Potri.010G195200.1.v4.1 1773 1514.6 125 6.41834 Potri.012G127500.1.v4.1 977 718.608 7765 840.348 ==> SRR7169090.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2580 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 259 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 21 SRR7169090 completed mapping pipeline successfully