Starting /dee2/code/volunteer_pipeline.sh SRR7169091 current disk space = 3056265199616 free memory = 1527550812 SRR7169091 SRAfilesize 31020a2500d1ef3d32cf1ccde7fb7577 SRR7169091.sra SRR7169091.sra file validated SRR7169091 is paired end SRR7169091 is conventional basespace SRR7169091 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169091_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.852 34.0 33.0 34.0 33.0 34.0 2 33.34225 34.0 33.0 34.0 33.0 34.0 3 33.29375 34.0 33.0 34.0 33.0 34.0 4 33.34275 34.0 33.0 34.0 33.0 34.0 5 33.3505 34.0 33.0 34.0 33.0 34.0 6 36.851 38.0 37.0 38.0 35.0 38.0 7 37.21775 38.0 38.0 38.0 36.0 38.0 8 37.38625 38.0 38.0 38.0 37.0 38.0 9 37.44625 38.0 38.0 38.0 37.0 38.0 10-14 37.4062 38.0 38.0 38.0 37.0 38.0 15-19 37.36545 38.0 38.0 38.0 37.0 38.0 20-24 37.36880000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.2983 38.0 38.0 38.0 36.8 38.0 30-34 37.20955 38.0 38.0 38.0 36.6 38.0 35-39 37.111000000000004 38.0 38.0 38.0 36.2 38.0 40-44 36.88095 38.0 38.0 38.0 35.4 38.0 45-49 36.66289999999999 38.0 38.0 38.0 34.2 38.0 50-54 36.590799999999994 38.0 38.0 38.0 34.0 38.0 55-59 36.493849999999995 38.0 37.6 38.0 34.0 38.0 60-64 36.42925 38.0 37.4 38.0 34.0 38.0 65-69 36.35015 38.0 37.2 38.0 33.8 38.0 70-74 36.312 38.0 37.0 38.0 33.8 38.0 75-79 36.199250000000006 38.0 37.0 38.0 33.0 38.0 80-84 36.0259 38.0 37.0 38.0 33.0 38.0 85-89 35.81325 38.0 37.0 38.0 31.4 38.0 90-94 35.611450000000005 38.0 36.2 38.0 30.0 38.0 95-99 35.51345 38.0 36.0 38.0 29.2 38.0 100-104 35.27235 38.0 36.0 38.0 29.0 38.0 105-109 35.118199999999995 38.0 35.6 38.0 28.6 38.0 110-114 34.9539 38.0 35.0 38.0 27.6 38.0 115-119 34.56845 38.0 34.8 38.0 26.6 38.0 120-124 34.248149999999995 38.0 34.4 38.0 24.0 38.0 125-129 33.898700000000005 38.0 34.0 38.0 22.6 38.0 130-134 33.4 38.0 34.0 38.0 19.0 38.0 135-139 32.865449999999996 38.0 33.2 38.0 15.0 38.0 140-144 32.1751 36.4 32.4 38.0 14.0 38.0 145-149 31.289349999999995 36.0 31.8 38.0 9.0 38.0 150-151 27.029625 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 1.0 15 2.0 16 3.0 17 5.0 18 4.0 19 4.0 20 4.0 21 12.0 22 18.0 23 12.0 24 24.0 25 26.0 26 32.0 27 38.0 28 48.0 29 38.0 30 60.0 31 71.0 32 104.0 33 174.0 34 266.0 35 501.0 36 1006.0 37 1541.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.26175349428208 12.909783989834816 8.437102922490471 36.39135959339263 2 23.150000000000002 13.675 33.925 29.25 3 19.875 18.025 25.75 36.35 4 22.650000000000002 25.324999999999996 23.150000000000002 28.875 5 23.025000000000002 30.95 24.15 21.875 6 21.099999999999998 33.225 23.549999999999997 22.125 7 14.825 29.225 38.4 17.549999999999997 8 17.825 26.924999999999997 30.325000000000003 24.925 9 17.125 25.775 33.25 23.849999999999998 10-14 20.09 29.509999999999998 27.48 22.919999999999998 15-19 19.830000000000002 28.43 27.37 24.37 20-24 20.145 27.794999999999998 28.53 23.53 25-29 19.66 28.884999999999998 27.445000000000004 24.01 30-34 20.235 28.54 27.51 23.715 35-39 20.294999999999998 28.355000000000004 27.395000000000003 23.955000000000002 40-44 20.29 28.505000000000003 27.68 23.525 45-49 20.080000000000002 28.189999999999998 27.534999999999997 24.195 50-54 20.11 28.26 27.955000000000002 23.674999999999997 55-59 20.435 28.785 27.54 23.24 60-64 19.945 28.565 27.860000000000003 23.630000000000003 65-69 20.175 28.215 27.55 24.060000000000002 70-74 20.215 28.299999999999997 27.439999999999998 24.044999999999998 75-79 20.06 28.610000000000003 27.389999999999997 23.94 80-84 20.19 28.465 27.315 24.03 85-89 21.029999999999998 28.410000000000004 26.655 23.905 90-94 20.45 27.825 27.339999999999996 24.385 95-99 20.505000000000003 28.43 27.045 24.02 100-104 21.22 27.834999999999997 27.36 23.585 105-109 20.849999999999998 27.650000000000002 27.85 23.65 110-114 20.355 27.639999999999997 28.16 23.845 115-119 20.525 28.52 27.334999999999997 23.62 120-124 20.645 27.694999999999997 27.77 23.89 125-129 20.515 27.27 28.115000000000002 24.099999999999998 130-134 19.916991699169916 28.15781578157816 27.41774177417742 24.507450745074507 135-139 20.937093709370938 28.092809280928094 27.597759775977597 23.37233723372337 140-144 21.12 27.67 27.36 23.849999999999998 145-149 20.705000000000002 27.834999999999997 27.735 23.724999999999998 150-151 20.674999999999997 27.6125 28.175 23.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.5 23 1.0 24 3.0 25 5.5 26 5.0 27 6.5 28 7.0 29 8.5 30 12.0 31 19.5 32 26.0 33 28.5 34 42.0 35 61.5 36 86.0 37 115.0 38 131.5 39 134.5 40 171.0 41 207.5 42 232.5 43 268.0 44 274.5 45 269.5 46 268.0 47 264.0 48 250.0 49 228.0 50 194.0 51 155.0 52 115.5 53 97.0 54 86.5 55 55.5 56 38.5 57 33.0 58 26.0 59 18.0 60 12.5 61 8.5 62 5.5 63 5.0 64 4.0 65 4.0 66 3.5 67 2.0 68 2.5 69 3.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.01 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.65 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.7124999999999999 0.0 0.0 0.0 0.0 130-131 0.7875000000000001 0.0 0.0 0.0 0.0 132-133 0.9375 0.0 0.0 0.0 0.0 134-135 1.05 0.0 0.0 0.0 0.0 136-137 1.2000000000000002 0.0 0.0 0.0 0.0 138-139 1.3250000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169091 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169091_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6065 33.0 33.0 34.0 32.0 34.0 2 32.7825 33.0 33.0 34.0 32.0 34.0 3 32.75975 33.0 33.0 34.0 32.0 34.0 4 32.7345 34.0 33.0 34.0 32.0 34.0 5 32.73075 34.0 33.0 34.0 32.0 34.0 6 36.95875 38.0 38.0 38.0 36.0 38.0 7 36.94575 38.0 38.0 38.0 36.0 38.0 8 37.01875 38.0 38.0 38.0 37.0 38.0 9 36.98425 38.0 38.0 38.0 37.0 38.0 10-14 36.95695 38.0 38.0 38.0 36.6 38.0 15-19 36.910000000000004 38.0 38.0 38.0 36.0 38.0 20-24 36.8198 38.0 38.0 38.0 36.0 38.0 25-29 36.825750000000006 38.0 38.0 38.0 36.0 38.0 30-34 36.842349999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.75359999999999 38.0 38.0 38.0 35.8 38.0 40-44 36.6856 38.0 38.0 38.0 35.6 38.0 45-49 36.68770000000001 38.0 38.0 38.0 35.8 38.0 50-54 36.7288 38.0 38.0 38.0 35.8 38.0 55-59 36.6862 38.0 38.0 38.0 35.8 38.0 60-64 36.6036 38.0 38.0 38.0 35.4 38.0 65-69 36.6339 38.0 38.0 38.0 35.4 38.0 70-74 36.502250000000004 38.0 38.0 38.0 34.8 38.0 75-79 36.40335 38.0 38.0 38.0 34.4 38.0 80-84 36.3673 38.0 38.0 38.0 34.0 38.0 85-89 36.35095 38.0 38.0 38.0 34.0 38.0 90-94 36.266 38.0 38.0 38.0 34.0 38.0 95-99 36.039049999999996 38.0 38.0 38.0 33.2 38.0 100-104 35.992399999999996 38.0 38.0 38.0 33.4 38.0 105-109 35.773050000000005 38.0 37.4 38.0 32.2 38.0 110-114 35.6361 38.0 37.0 38.0 31.6 38.0 115-119 35.440000000000005 38.0 37.0 38.0 30.2 38.0 120-124 35.36695 38.0 37.0 38.0 31.0 38.0 125-129 35.0583 38.0 36.0 38.0 28.2 38.0 130-134 34.854699999999994 38.0 36.0 38.0 27.6 38.0 135-139 34.622 38.0 35.6 38.0 27.8 38.0 140-144 34.03075 38.0 35.0 38.0 22.6 38.0 145-149 33.3132 38.0 35.0 38.0 15.6 38.0 150-151 29.595 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 1.0 5 3.0 6 2.0 7 0.0 8 3.0 9 2.0 10 1.0 11 2.0 12 4.0 13 1.0 14 3.0 15 6.0 16 4.0 17 3.0 18 8.0 19 4.0 20 5.0 21 9.0 22 10.0 23 25.0 24 16.0 25 13.0 26 24.0 27 36.0 28 41.0 29 39.0 30 51.0 31 49.0 32 71.0 33 86.0 34 146.0 35 231.0 36 478.0 37 2606.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.867933966983486 23.936968484242122 13.131565782891446 27.063531765882942 2 27.838919459729865 27.43871935967984 26.663331665832917 18.05902951475738 3 20.375469336670836 27.859824780976222 31.038798498122656 20.72590738423029 4 23.925 33.050000000000004 23.925 19.1 5 25.674999999999997 34.9 21.05 18.375 6 21.0 37.05 23.625 18.325 7 20.45 22.775000000000002 36.725 20.05 8 21.45 26.25 27.450000000000003 24.85 9 22.375 24.775 29.4 23.45 10-14 23.335 29.085 26.215 21.365000000000002 15-19 23.355 28.07 27.375 21.2 20-24 23.200000000000003 28.349999999999998 26.915 21.535 25-29 23.419999999999998 28.21 26.845000000000002 21.525 30-34 23.615 28.299999999999997 27.105 20.979999999999997 35-39 22.884999999999998 28.025 28.01 21.08 40-44 23.365 28.01 27.229999999999997 21.395 45-49 23.35 27.495000000000005 27.944999999999997 21.21 50-54 23.849999999999998 28.51 26.834999999999997 20.805 55-59 23.535 28.34 27.07 21.055 60-64 23.555 28.215 27.67 20.560000000000002 65-69 23.599999999999998 27.994999999999997 27.13 21.275 70-74 23.794999999999998 27.839999999999996 27.700000000000003 20.665 75-79 23.566496547583306 27.579305513859705 27.64935454818373 21.204843390373263 80-84 23.27 27.400000000000002 27.884999999999998 21.445 85-89 23.755000000000003 28.299999999999997 27.32 20.625 90-94 23.765 27.22 28.01 21.005 95-99 23.810000000000002 27.634999999999998 27.79 20.765 100-104 23.995 27.01 28.549999999999997 20.445 105-109 23.78 27.639999999999997 27.555000000000003 21.025 110-114 23.62 27.49 27.72 21.17 115-119 24.175 27.55 27.405 20.87 120-124 23.46 28.165000000000003 27.505000000000003 20.87 125-129 23.855 27.735 27.47 20.94 130-134 24.285 27.975 27.52 20.22 135-139 24.4 28.199999999999996 27.13 20.27 140-144 24.02 27.944999999999997 27.425 20.61 145-149 24.415571385572388 27.65626567673322 27.224841978529145 20.703320959165243 150-151 24.230237526706045 27.13334171170039 27.56063843156969 21.07578233002388 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 2.0 25 2.0 26 3.5 27 4.0 28 2.5 29 6.0 30 9.0 31 7.5 32 8.5 33 18.0 34 29.5 35 48.5 36 72.0 37 86.5 38 113.5 39 150.0 40 201.0 41 247.0 42 262.0 43 280.0 44 294.0 45 299.0 46 302.0 47 278.5 48 238.0 49 210.0 50 175.5 51 145.5 52 120.5 53 94.5 54 78.5 55 55.5 56 38.0 57 31.5 58 25.5 59 14.0 60 9.0 61 8.5 62 6.0 63 6.5 64 5.5 65 2.0 66 2.0 67 2.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.125 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.06999999999999999 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.33 150-151 0.5375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.65 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.7375 0.0 0.0 0.0 0.0 130-131 0.8 0.0 0.0 0.0 0.0 132-133 0.9375 0.0 0.0 0.0 0.0 134-135 1.05 0.0 0.0 0.0 0.0 136-137 1.2000000000000002 0.0 0.0 0.0 0.0 138-139 1.3250000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra Read 840797 spots for SRR7169091.sra Written 840797 spots for SRR7169091.sra Read 840781 spots for SRR7169091.sra Written 840781 spots for SRR7169091.sra SRR ids: ['SRR7169091.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ehs_5z3l SRR7169091.sra spots: 16815636 blocks: [[1, 840781], [840782, 1681562], [1681563, 2522343], [2522344, 3363124], [3363125, 4203905], [4203906, 5044686], [5044687, 5885467], [5885468, 6726248], [6726249, 7567029], [7567030, 8407810], [8407811, 9248591], [9248592, 10089372], [10089373, 10930153], [10930154, 11770934], [11770935, 12611715], [12611716, 13452496], [13452497, 14293277], [14293278, 15134058], [15134059, 15974839], [15974840, 16815636]] SRR7169091 file size 5676566 SRR7169091 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169091 SRR7169091_1.fastq SRR7169091_2.fastq Input file: SRR7169091_1.fastq Paired file: SRR7169091_2.fastq trimmed: SRR7169091-trimmed-pair1.fastq, SRR7169091-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:51:59 2025 >> started Mon Feb 10 20:52:25 2025 >> done (25.163s) 16815636 read pairs processed; of these: 21220 ( 0.13%) short read pairs filtered out after trimming by size control 23741 ( 0.14%) empty read pairs filtered out after trimming by size control 16770675 (99.73%) read pairs available; of these: 7680811 (45.80%) trimmed read pairs available after processing 9089864 (54.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 6 0.00% 21 7 0.00% 22 2 0.00% 23 2 0.00% 24 3 0.00% 25 4 0.00% 26 8 0.00% 27 9 0.00% 28 7 0.00% 29 8 0.00% 30 12 0.00% 31 11 0.00% 32 11 0.00% 33 8 0.00% 34 9 0.00% 35 13 0.00% 36 15 0.00% 37 12 0.00% 38 19 0.00% 39 17 0.00% 40 15 0.00% 41 18 0.00% 42 19 0.00% 43 16 0.00% 44 28 0.00% 45 27 0.00% 46 26 0.00% 47 27 0.00% 48 41 0.00% 49 30 0.00% 50 44 0.00% 51 45 0.00% 52 48 0.00% 53 51 0.00% 54 53 0.00% 55 53 0.00% 56 52 0.00% 57 66 0.00% 58 65 0.00% 59 83 0.00% 60 81 0.00% 61 102 0.00% 62 116 0.00% 63 112 0.00% 64 126 0.00% 65 133 0.00% 66 157 0.00% 67 161 0.00% 68 171 0.00% 69 229 0.00% 70 247 0.00% 71 266 0.00% 72 304 0.00% 73 280 0.00% 74 308 0.00% 75 443 0.00% 76 461 0.00% 77 469 0.00% 78 506 0.00% 79 601 0.00% 80 680 0.00% 81 766 0.00% 82 905 0.01% 83 1090 0.01% 84 2063 0.01% 85 2561 0.02% 86 2532 0.02% 87 2675 0.02% 88 2754 0.02% 89 2791 0.02% 90 2889 0.02% 91 3140 0.02% 92 3187 0.02% 93 3455 0.02% 94 3466 0.02% 95 3848 0.02% 96 3907 0.02% 97 4253 0.03% 98 4543 0.03% 99 4805 0.03% 100 5121 0.03% 101 5494 0.03% 102 5765 0.03% 103 6159 0.04% 104 6524 0.04% 105 7123 0.04% 106 7576 0.05% 107 8014 0.05% 108 8375 0.05% 109 8973 0.05% 110 9694 0.06% 111 10006 0.06% 112 10684 0.06% 113 11403 0.07% 114 11974 0.07% 115 12835 0.08% 116 13693 0.08% 117 14769 0.09% 118 15574 0.09% 119 16341 0.10% 120 17413 0.10% 121 18304 0.11% 122 19595 0.12% 123 21021 0.13% 124 22145 0.13% 125 23821 0.14% 126 25963 0.15% 127 27805 0.17% 128 29233 0.17% 129 31453 0.19% 130 33886 0.20% 131 36150 0.22% 132 38948 0.23% 133 43044 0.26% 134 45895 0.27% 135 49119 0.29% 136 54431 0.32% 137 60433 0.36% 138 67920 0.40% 139 75197 0.45% 140 83281 0.50% 141 93078 0.56% 142 108426 0.65% 143 119442 0.71% 144 141269 0.84% 145 171651 1.02% 146 216823 1.29% 147 300636 1.79% 148 465608 2.78% 149 940452 5.61% 150 4039690 24.09% 151 9089864 54.20% 16770675 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=37 prefix-density=0.22 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=63.09 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=11.8 sequence=CACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.24 fanout-score-rank=24 prefix-density=0.32 prefix-fanout=3.8 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCAT criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=49.68 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=11.4 sequence=TGTTGGTGGTGGGACTGGAGCTGTCGTTAACACCATCGTCTCTAAATACCCTTCAATTAAGGGCATTAACTTTGATCTGCCCCACGTCATTGAGGATGCCCCATCTTATCCCGGTGTGGAGCATGTTGGTGGGGACATGTTTGTTAG SRR7169091 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:53:12 Started mapping on | Feb 10 20:53:12 Finished on | Feb 10 20:55:04 Mapping speed, Million of reads per hour | 539.06 Number of input reads | 16770675 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15855456 Uniquely mapped reads % | 94.54% Average mapped length | 296.62 Number of splices: Total | 15168579 Number of splices: Annotated (sjdb) | 14920299 Number of splices: GT/AG | 14954725 Number of splices: GC/AG | 171942 Number of splices: AT/AC | 11475 Number of splices: Non-canonical | 30437 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 303338 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 82212 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.06% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 631604 631604 631604 N_multimapping 303338 303338 303338 N_noFeature 309146 15662490 384684 N_ambiguous 183828 1666 65309 UnstrandedReadsAssigned:15362482 PositiveStrandReadsAssigned:191300 NegativeStrandReadsAssigned:15405463 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169091 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169091-trimmed-pair1.fastq SRR7169091-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,770,675 reads, 15,341,733 reads pseudoaligned [quant] estimated average fragment length: 272.021 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR7169091.ke.tsv 34699 SRR7169091.se.tsv 87100 total ==> SRR7169091.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.98 303 10.377 Potri.005G024800.1.v4.1 1035 763.979 28 2.19276 Potri.004G059700.1.v4.1 961 689.985 1 0.0867113 Potri.007G009000.2.v4.1 1416 1144.98 0 0 Potri.003G141000.2.v4.1 2943 2671.98 245.03 5.48658 Potri.016G087400.1.v4.1 270 60.4363 1397 1382.97 Potri.015G069301.1.v4.1 564 297.89 0 0 Potri.010G195200.1.v4.1 1773 1501.98 4 0.159335 Potri.012G127500.1.v4.1 977 705.979 4183 354.496 ==> SRR7169091.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1494 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 245 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169091 completed mapping pipeline successfully