Starting /dee2/code/volunteer_pipeline.sh SRR7169092 current disk space = 3056240549888 free memory = 1531959164 SRR7169092 SRAfilesize 3263943531a9c280aadb75e8ee58c39f SRR7169092.sra SRR7169092.sra file validated SRR7169092 is paired end SRR7169092 is conventional basespace SRR7169092 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169092_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95175 34.0 33.0 34.0 33.0 34.0 2 33.309 34.0 33.0 34.0 33.0 34.0 3 33.36775 34.0 34.0 34.0 33.0 34.0 4 33.45825 34.0 34.0 34.0 33.0 34.0 5 33.49475 34.0 34.0 34.0 33.0 34.0 6 37.02775 38.0 37.0 38.0 36.0 38.0 7 37.3335 38.0 38.0 38.0 37.0 38.0 8 37.45575 38.0 38.0 38.0 37.0 38.0 9 37.505 38.0 38.0 38.0 37.0 38.0 10-14 37.5157 38.0 38.0 38.0 37.8 38.0 15-19 37.4769 38.0 38.0 38.0 37.0 38.0 20-24 37.4533 38.0 38.0 38.0 37.0 38.0 25-29 37.361749999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.375600000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.23375 38.0 38.0 38.0 36.6 38.0 40-44 36.951499999999996 38.0 38.0 38.0 35.8 38.0 45-49 36.8179 38.0 38.0 38.0 35.0 38.0 50-54 36.72070000000001 38.0 38.0 38.0 34.4 38.0 55-59 36.673199999999994 38.0 38.0 38.0 34.2 38.0 60-64 36.48595 38.0 38.0 38.0 34.0 38.0 65-69 36.40065 38.0 37.6 38.0 33.8 38.0 70-74 36.32435 38.0 37.0 38.0 33.8 38.0 75-79 36.209450000000004 38.0 37.0 38.0 33.0 38.0 80-84 36.0981 38.0 37.0 38.0 33.2 38.0 85-89 35.892450000000004 38.0 36.8 38.0 31.8 38.0 90-94 35.69095 38.0 36.6 38.0 30.8 38.0 95-99 35.58895 38.0 36.4 38.0 30.2 38.0 100-104 35.36595 38.0 36.0 38.0 29.0 38.0 105-109 35.22925 38.0 36.0 38.0 28.8 38.0 110-114 34.7405 38.0 35.2 38.0 26.8 38.0 115-119 34.47165 38.0 35.0 38.0 25.0 38.0 120-124 34.1478 38.0 34.2 38.0 23.4 38.0 125-129 33.8027 38.0 34.0 38.0 22.6 38.0 130-134 33.476299999999995 38.0 34.0 38.0 17.8 38.0 135-139 32.74635 37.8 33.0 38.0 14.8 38.0 140-144 32.24305 37.4 33.0 38.0 14.2 38.0 145-149 31.24445 36.0 31.4 38.0 9.0 38.0 150-151 27.316000000000003 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 2.0 11 1.0 12 0.0 13 2.0 14 1.0 15 4.0 16 2.0 17 1.0 18 5.0 19 8.0 20 8.0 21 5.0 22 16.0 23 14.0 24 17.0 25 24.0 26 35.0 27 37.0 28 34.0 29 41.0 30 78.0 31 84.0 32 113.0 33 180.0 34 251.0 35 426.0 36 945.0 37 1665.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.52727734077645 14.184217203755392 8.500380614057345 34.78812484141081 2 24.625 13.925 31.574999999999996 29.875 3 19.375 17.925 26.424999999999997 36.275 4 21.85 24.925 24.375 28.849999999999998 5 23.25 30.85 24.375 21.525 6 20.175 34.35 23.775 21.7 7 15.575 27.500000000000004 39.324999999999996 17.599999999999998 8 17.375 29.15 31.15 22.325 9 17.7 26.0 34.275 22.025 10-14 19.86 30.385 27.52 22.235 15-19 20.0 28.975 27.655 23.369999999999997 20-24 19.295 29.825000000000003 27.515 23.365 25-29 20.044999999999998 28.875 27.235 23.845 30-34 19.495 29.270000000000003 27.455000000000002 23.78 35-39 20.355 29.365000000000002 27.095000000000002 23.185 40-44 19.965 29.64 26.985 23.41 45-49 20.46 29.235 26.924999999999997 23.380000000000003 50-54 20.06 28.665000000000003 27.855 23.419999999999998 55-59 20.044999999999998 29.160000000000004 27.36 23.435 60-64 20.24 28.02 27.455000000000002 24.285 65-69 19.869999999999997 28.79 27.18 24.16 70-74 20.3 28.975 27.265 23.46 75-79 19.939999999999998 28.34 27.450000000000003 24.27 80-84 20.044999999999998 28.134999999999998 27.77 24.05 85-89 20.685000000000002 28.555000000000003 27.005000000000003 23.755000000000003 90-94 20.105 28.49 27.715 23.69 95-99 20.36 27.595 27.779999999999998 24.265 100-104 20.595 28.34 27.165 23.9 105-109 20.82 28.205000000000002 27.54 23.435 110-114 20.655 27.875 27.21 24.26 115-119 20.674999999999997 28.105000000000004 27.200000000000003 24.02 120-124 21.23 28.444999999999997 27.025 23.3 125-129 20.325 28.549999999999997 27.450000000000003 23.674999999999997 130-134 20.44 28.095 27.255000000000003 24.21 135-139 20.815 28.415000000000003 27.389999999999997 23.380000000000003 140-144 20.75 27.74 27.325 24.185000000000002 145-149 20.93 28.139999999999997 27.01 23.919999999999998 150-151 20.837500000000002 28.6875 26.187500000000004 24.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.5 20 1.5 21 1.0 22 1.5 23 1.0 24 0.5 25 5.5 26 9.5 27 7.5 28 10.0 29 15.0 30 22.0 31 30.5 32 42.0 33 42.0 34 48.0 35 68.0 36 80.5 37 105.0 38 134.0 39 166.5 40 207.0 41 225.0 42 233.5 43 245.5 44 252.0 45 251.0 46 250.5 47 244.0 48 221.0 49 211.5 50 179.0 51 145.0 52 124.0 53 99.0 54 87.0 55 65.5 56 40.5 57 29.5 58 27.0 59 19.5 60 12.5 61 9.0 62 6.5 63 3.0 64 2.0 65 4.0 66 4.5 67 3.0 68 2.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.11249999999999999 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5375000000000001 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 1.0 0.0 0.0 0.0 0.0 130-131 1.0875 0.0 0.0 0.0 0.0 132-133 1.1375 0.0 0.0 0.0 0.0 134-135 1.2875 0.0 0.0 0.0 0.0 136-137 1.625 0.0 0.0 0.0 0.0 138-139 1.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGCGG 10 0.006830828 145.0 7 ATTCCCA 10 0.006830828 145.0 6 >>END_MODULE SRR7169092 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169092_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.706 33.0 33.0 34.0 32.0 34.0 2 32.80575 33.0 33.0 34.0 32.0 34.0 3 32.909 34.0 33.0 34.0 32.0 34.0 4 32.73325 34.0 33.0 34.0 32.0 34.0 5 32.74425 34.0 33.0 34.0 32.0 34.0 6 36.88375 38.0 38.0 38.0 36.0 38.0 7 36.90775 38.0 38.0 38.0 36.0 38.0 8 36.9195 38.0 38.0 38.0 36.0 38.0 9 37.00125 38.0 38.0 38.0 37.0 38.0 10-14 36.9571 38.0 38.0 38.0 36.8 38.0 15-19 36.92475 38.0 38.0 38.0 36.4 38.0 20-24 36.9076 38.0 38.0 38.0 36.6 38.0 25-29 36.94445 38.0 38.0 38.0 37.0 38.0 30-34 36.932900000000004 38.0 38.0 38.0 36.8 38.0 35-39 36.906600000000005 38.0 38.0 38.0 36.4 38.0 40-44 36.812599999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.77354999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.7294 38.0 38.0 38.0 36.0 38.0 55-59 36.76695 38.0 38.0 38.0 36.0 38.0 60-64 36.73950000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.580549999999995 38.0 38.0 38.0 35.8 38.0 70-74 36.4385 38.0 38.0 38.0 35.2 38.0 75-79 36.45705 38.0 38.0 38.0 35.0 38.0 80-84 36.4346 38.0 38.0 38.0 34.4 38.0 85-89 36.3748 38.0 38.0 38.0 34.4 38.0 90-94 36.306799999999996 38.0 38.0 38.0 34.2 38.0 95-99 36.1148 38.0 38.0 38.0 34.0 38.0 100-104 35.9616 38.0 38.0 38.0 33.6 38.0 105-109 35.879949999999994 38.0 38.0 38.0 33.0 38.0 110-114 35.670550000000006 38.0 37.6 38.0 31.8 38.0 115-119 35.58575 38.0 37.0 38.0 31.0 38.0 120-124 35.32495 38.0 37.0 38.0 30.6 38.0 125-129 35.19085 38.0 36.6 38.0 30.0 38.0 130-134 34.796499999999995 38.0 36.0 38.0 27.8 38.0 135-139 34.40735 38.0 35.8 38.0 24.8 38.0 140-144 34.08715 38.0 35.0 38.0 23.2 38.0 145-149 33.31705 38.0 35.0 38.0 15.6 38.0 150-151 29.656999999999996 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 3.0 4 2.0 5 4.0 6 3.0 7 2.0 8 1.0 9 2.0 10 4.0 11 3.0 12 1.0 13 5.0 14 1.0 15 4.0 16 2.0 17 5.0 18 4.0 19 10.0 20 10.0 21 5.0 22 8.0 23 14.0 24 21.0 25 23.0 26 15.0 27 28.0 28 22.0 29 40.0 30 48.0 31 55.0 32 83.0 33 94.0 34 137.0 35 196.0 36 449.0 37 2682.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.074999999999996 24.15 12.775 24.0 2 29.375 27.800000000000004 27.075 15.75 3 20.875 29.099999999999998 30.099999999999998 19.925 4 23.425 34.375 23.075000000000003 19.125 5 24.45 35.125 23.0 17.424999999999997 6 22.400000000000002 35.9 23.05 18.65 7 21.05 22.975 36.05 19.925 8 21.55 26.974999999999998 27.150000000000002 24.325 9 22.925 25.25 29.925 21.9 10-14 23.445 29.099999999999998 25.91 21.545 15-19 23.815 28.1 27.205000000000002 20.880000000000003 20-24 23.56 28.54 27.060000000000002 20.84 25-29 23.810000000000002 28.79 26.68 20.72 30-34 24.044999999999998 27.700000000000003 27.26 20.995 35-39 23.705000000000002 27.700000000000003 26.884999999999998 21.709999999999997 40-44 23.575 27.915 27.185 21.325 45-49 23.505000000000003 27.82 27.155 21.52 50-54 24.435000000000002 27.534999999999997 27.05 20.979999999999997 55-59 23.465 27.73 27.334999999999997 21.47 60-64 23.845 27.63 26.740000000000002 21.785 65-69 23.8243256793342 27.764965406597813 27.494234432969016 20.916474481098966 70-74 23.861356340288925 27.51304173354735 27.62841091492777 20.997191011235955 75-79 23.973735652348253 27.752994837351512 27.151521227006164 21.12174828329407 80-84 23.798569785467823 27.909186377956697 27.119067860179026 21.17317597639646 85-89 23.61 27.634999999999998 27.675 21.08 90-94 23.5 27.93 27.72 20.849999999999998 95-99 24.095 27.32 27.744999999999997 20.84 100-104 23.47 27.505000000000003 27.839999999999996 21.185000000000002 105-109 24.385 27.845 27.465 20.305 110-114 23.985 27.384999999999998 27.435 21.195 115-119 24.365000000000002 27.305 27.785 20.544999999999998 120-124 24.075 27.415 27.860000000000003 20.65 125-129 24.33 27.43 27.1 21.14 130-134 23.74 28.475 27.529999999999998 20.255000000000003 135-139 24.20605151287822 27.45686421605401 27.551887971993 20.78519629907477 140-144 24.618387468094692 27.646263950753212 27.441069015564786 20.29427956558731 145-149 24.62326702833032 28.631705846895724 26.732971669680534 20.01205545509343 150-151 24.36625047294741 26.76251734140497 27.74624795056123 21.12498423508639 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 2.0 26 1.5 27 1.0 28 2.5 29 4.0 30 7.0 31 10.0 32 13.0 33 21.0 34 31.5 35 44.0 36 57.0 37 82.5 38 119.5 39 145.5 40 184.0 41 219.5 42 252.0 43 284.5 44 287.5 45 294.0 46 291.0 47 281.0 48 258.5 49 219.5 50 194.0 51 151.0 52 119.0 53 105.5 54 83.5 55 58.5 56 38.5 57 33.5 58 29.0 59 20.5 60 13.0 61 9.5 62 7.5 63 4.0 64 2.0 65 2.0 66 2.5 67 1.5 68 0.5 69 1.5 70 1.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.27 70-74 0.32 75-79 0.245 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.025 140-144 0.095 145-149 0.45999999999999996 150-151 0.8875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34508816120908 98.6 2 0.6045340050377833 1.2 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.025188916876574305 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.5375 0.0 0.0 0.0 0.0 124-125 0.6625000000000001 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.9 0.0 0.0 0.0 0.0 130-131 0.9875 0.0 0.0 0.0 0.0 132-133 1.0625 0.0 0.0 0.0 0.0 134-135 1.2125 0.0 0.0 0.0 0.0 136-137 1.55 0.0 0.0 0.0 0.0 138-139 1.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808036 spots for SRR7169092.sra Written 808036 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra Read 808019 spots for SRR7169092.sra Written 808019 spots for SRR7169092.sra SRR ids: ['SRR7169092.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ftyv1840 SRR7169092.sra spots: 16160397 blocks: [[1, 808019], [808020, 1616038], [1616039, 2424057], [2424058, 3232076], [3232077, 4040095], [4040096, 4848114], [4848115, 5656133], [5656134, 6464152], [6464153, 7272171], [7272172, 8080190], [8080191, 8888209], [8888210, 9696228], [9696229, 10504247], [10504248, 11312266], [11312267, 12120285], [12120286, 12928304], [12928305, 13736323], [13736324, 14544342], [14544343, 15352361], [15352362, 16160397]] SRR7169092 file size 5454527 SRR7169092 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169092 SRR7169092_1.fastq SRR7169092_2.fastq Input file: SRR7169092_1.fastq Paired file: SRR7169092_2.fastq trimmed: SRR7169092-trimmed-pair1.fastq, SRR7169092-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:51:16 2025 >> started Mon Feb 10 20:51:35 2025 >> done (19.088s) 16160397 read pairs processed; of these: 22038 ( 0.14%) short read pairs filtered out after trimming by size control 21390 ( 0.13%) empty read pairs filtered out after trimming by size control 16116969 (99.73%) read pairs available; of these: 7453634 (46.25%) trimmed read pairs available after processing 8663335 (53.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 11 0.00% 20 3 0.00% 21 11 0.00% 22 8 0.00% 23 6 0.00% 24 8 0.00% 25 8 0.00% 26 8 0.00% 27 10 0.00% 28 3 0.00% 29 7 0.00% 30 17 0.00% 31 11 0.00% 32 14 0.00% 33 13 0.00% 34 13 0.00% 35 9 0.00% 36 11 0.00% 37 7 0.00% 38 19 0.00% 39 19 0.00% 40 27 0.00% 41 14 0.00% 42 22 0.00% 43 25 0.00% 44 24 0.00% 45 36 0.00% 46 40 0.00% 47 28 0.00% 48 35 0.00% 49 48 0.00% 50 55 0.00% 51 47 0.00% 52 57 0.00% 53 44 0.00% 54 65 0.00% 55 67 0.00% 56 62 0.00% 57 88 0.00% 58 88 0.00% 59 102 0.00% 60 105 0.00% 61 124 0.00% 62 116 0.00% 63 141 0.00% 64 145 0.00% 65 180 0.00% 66 197 0.00% 67 171 0.00% 68 220 0.00% 69 237 0.00% 70 302 0.00% 71 306 0.00% 72 340 0.00% 73 371 0.00% 74 397 0.00% 75 463 0.00% 76 552 0.00% 77 546 0.00% 78 615 0.00% 79 695 0.00% 80 779 0.00% 81 852 0.01% 82 1075 0.01% 83 1231 0.01% 84 2198 0.01% 85 2853 0.02% 86 2861 0.02% 87 3062 0.02% 88 3335 0.02% 89 3342 0.02% 90 3206 0.02% 91 3387 0.02% 92 3685 0.02% 93 3854 0.02% 94 4093 0.03% 95 4510 0.03% 96 4742 0.03% 97 4977 0.03% 98 5356 0.03% 99 5788 0.04% 100 5937 0.04% 101 6223 0.04% 102 6842 0.04% 103 7312 0.05% 104 7832 0.05% 105 8517 0.05% 106 9105 0.06% 107 9861 0.06% 108 10394 0.06% 109 10639 0.07% 110 11422 0.07% 111 12005 0.07% 112 12794 0.08% 113 14151 0.09% 114 14688 0.09% 115 15449 0.10% 116 16213 0.10% 117 17282 0.11% 118 18498 0.11% 119 19076 0.12% 120 20235 0.13% 121 21409 0.13% 122 22774 0.14% 123 24316 0.15% 124 26081 0.16% 125 27498 0.17% 126 29226 0.18% 127 30990 0.19% 128 32916 0.20% 129 34932 0.22% 130 37447 0.23% 131 39968 0.25% 132 42842 0.27% 133 46010 0.29% 134 48973 0.30% 135 52908 0.33% 136 57659 0.36% 137 62502 0.39% 138 69487 0.43% 139 75850 0.47% 140 83436 0.52% 141 91135 0.57% 142 101871 0.63% 143 115853 0.72% 144 133672 0.83% 145 161654 1.00% 146 205036 1.27% 147 281312 1.75% 148 436294 2.71% 149 862867 5.35% 150 3869636 24.01% 151 8663335 53.75% 16116969 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=36 prefix-density=0.29 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=10 fanout-score=79.63 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=15.5 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=41 prefix-density=0.21 prefix-fanout=2.4 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.14 sequence-density-rank=15 fanout-score=50.49 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=13.2 sequence=TGTTGGTGGTGG SRR7169092 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:52:26 Started mapping on | Feb 10 20:52:26 Finished on | Feb 10 20:54:48 Mapping speed, Million of reads per hour | 408.60 Number of input reads | 16116969 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14971939 Uniquely mapped reads % | 92.90% Average mapped length | 296.09 Number of splices: Total | 13246588 Number of splices: Annotated (sjdb) | 13025548 Number of splices: GT/AG | 13061591 Number of splices: GC/AG | 147625 Number of splices: AT/AC | 10764 Number of splices: Non-canonical | 26608 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280586 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 23866 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.18% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 884726 884726 884726 N_multimapping 280586 280586 280586 N_noFeature 290302 14772891 370596 N_ambiguous 183035 1031 63482 UnstrandedReadsAssigned:14498602 PositiveStrandReadsAssigned:198017 NegativeStrandReadsAssigned:14537861 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169092 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169092-trimmed-pair1.fastq SRR7169092-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,116,969 reads, 14,480,841 reads pseudoaligned [quant] estimated average fragment length: 255.192 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,012 rounds 52401 SRR7169092.ke.tsv 34699 SRR7169092.se.tsv 87100 total ==> SRR7169092.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.81 252 7.99927 Potri.005G024800.1.v4.1 1035 780.808 56 4.01555 Potri.004G059700.1.v4.1 961 706.821 6 0.475272 Potri.007G009000.2.v4.1 1416 1161.81 0 0 Potri.003G141000.2.v4.1 2943 2688.81 244 5.08079 Potri.016G087400.1.v4.1 270 65.4607 1518.1 1298.44 Potri.015G069301.1.v4.1 564 313.142 0 0 Potri.010G195200.1.v4.1 1773 1518.81 14 0.516091 Potri.012G127500.1.v4.1 977 722.821 4867 376.991 ==> SRR7169092.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1411 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 221 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 18 Potri.001G452600.v4.1 2 SRR7169092 completed mapping pipeline successfully