Starting /dee2/code/volunteer_pipeline.sh SRR7169093 current disk space = 3056190291968 free memory = 1212649572 SRR7169093 SRAfilesize f13746a1b31663adcea65f5d90f83919 SRR7169093.sra SRR7169093.sra file validated SRR7169093 is paired end SRR7169093 is conventional basespace SRR7169093 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169093_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6655 34.0 33.0 34.0 32.0 34.0 2 33.29025 34.0 33.0 34.0 33.0 34.0 3 33.28625 34.0 34.0 34.0 33.0 34.0 4 33.44475 34.0 33.0 34.0 33.0 34.0 5 33.41975 34.0 33.0 34.0 33.0 34.0 6 37.051 38.0 37.0 38.0 36.0 38.0 7 37.293 38.0 38.0 38.0 36.0 38.0 8 37.487 38.0 38.0 38.0 37.0 38.0 9 37.42275 38.0 38.0 38.0 37.0 38.0 10-14 37.11415 38.0 38.0 38.0 36.0 38.0 15-19 37.12935 38.0 38.0 38.0 36.2 38.0 20-24 37.356950000000005 38.0 38.0 38.0 36.8 38.0 25-29 37.153299999999994 38.0 38.0 38.0 36.4 38.0 30-34 37.238350000000004 38.0 38.0 38.0 36.8 38.0 35-39 37.22745 38.0 38.0 38.0 36.2 38.0 40-44 37.069100000000006 38.0 38.0 38.0 35.8 38.0 45-49 36.78945 38.0 38.0 38.0 34.8 38.0 50-54 36.7308 38.0 38.0 38.0 34.4 38.0 55-59 36.316449999999996 38.0 37.2 38.0 33.6 38.0 60-64 36.5264 38.0 38.0 38.0 34.0 38.0 65-69 36.345400000000005 38.0 37.4 38.0 33.2 38.0 70-74 36.205349999999996 38.0 37.2 38.0 32.8 38.0 75-79 36.2019 38.0 37.0 38.0 33.4 38.0 80-84 36.24615 38.0 37.0 38.0 33.2 38.0 85-89 35.9326 38.0 37.0 38.0 31.6 38.0 90-94 35.6492 38.0 36.6 38.0 30.2 38.0 95-99 35.72605 38.0 36.8 38.0 31.4 38.0 100-104 35.2861 38.0 36.0 38.0 28.6 38.0 105-109 34.51285 38.0 35.0 38.0 24.0 38.0 110-114 34.94575 38.0 35.6 38.0 27.4 38.0 115-119 35.100849999999994 38.0 35.8 38.0 28.4 38.0 120-124 34.75285 38.0 35.0 38.0 27.0 38.0 125-129 34.0719 38.0 34.2 38.0 23.6 38.0 130-134 34.35799999999999 38.0 34.8 38.0 25.8 38.0 135-139 33.84545000000001 38.0 34.0 38.0 23.2 38.0 140-144 32.821000000000005 37.6 33.2 38.0 15.6 38.0 145-149 32.203 37.0 33.0 38.0 13.8 38.0 150-151 28.324125000000002 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 3.0 13 6.0 14 0.0 15 2.0 16 4.0 17 6.0 18 4.0 19 5.0 20 6.0 21 5.0 22 10.0 23 18.0 24 12.0 25 17.0 26 32.0 27 41.0 28 37.0 29 39.0 30 67.0 31 98.0 32 105.0 33 153.0 34 216.0 35 414.0 36 925.0 37 1774.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.64893889030938 13.577090258245972 9.89516747634876 33.878803375095885 2 23.3 12.775 33.45 30.475 3 18.75 17.025000000000002 27.175 37.05 4 22.75 23.425 24.125 29.7 5 23.1 28.975 24.25 23.674999999999997 6 20.974999999999998 33.35 24.525 21.15 7 15.2 29.725 38.3 16.775000000000002 8 17.825 26.525 30.975 24.675 9 17.575 24.95 34.325 23.150000000000002 10-14 19.6 30.185000000000002 27.51 22.705000000000002 15-19 19.71 28.360000000000003 27.500000000000004 24.43 20-24 19.625 28.305000000000003 28.48 23.59 25-29 19.775000000000002 28.595 27.810000000000002 23.82 30-34 19.595000000000002 28.51 27.76 24.135 35-39 19.919999999999998 29.635 26.540000000000003 23.905 40-44 19.96 28.050000000000004 27.810000000000002 24.18 45-49 20.39 28.79 27.365000000000002 23.455000000000002 50-54 20.055 28.845 27.185 23.915 55-59 20.544999999999998 28.475 26.815 24.165 60-64 20.655 29.13 26.87 23.345 65-69 20.150000000000002 28.720000000000002 27.42 23.71 70-74 20.324064812962593 28.460692138427685 27.185437087417487 24.02980596119224 75-79 20.356017800890044 27.84639231961598 27.321366068303416 24.476223811190557 80-84 20.282028202820282 28.24282428242824 27.35273527352735 24.122412241224122 85-89 20.96 28.060000000000002 27.04 23.94 90-94 20.292029202920293 28.047804780478046 27.69276927692769 23.96739673967397 95-99 20.855 27.485 27.3 24.36 100-104 20.65 27.71 27.529999999999998 24.11 105-109 20.885 27.744999999999997 27.275 24.095 110-114 20.82208220822082 27.762776277627765 27.702770277027707 23.712371237123712 115-119 20.367036703670365 27.38773877387739 27.85778577857786 24.387438743874387 120-124 21.41321198179727 27.584137620643094 27.65414812221833 23.3485022753413 125-129 20.914182836567313 27.425485097019404 27.230446089217843 24.42988597719544 130-134 20.265 28.22 27.625 23.89 135-139 20.544999999999998 27.965 27.365000000000002 24.125 140-144 21.04 27.29 27.800000000000004 23.87 145-149 20.856042802140106 28.21641082054103 26.721336066803342 24.206210310515523 150-151 21.002625328166022 26.940867608451057 28.078509813726715 23.97799724965621 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.5 22 1.0 23 0.0 24 0.0 25 1.5 26 3.0 27 5.0 28 11.5 29 15.5 30 17.0 31 25.5 32 37.0 33 42.5 34 49.0 35 59.5 36 75.5 37 98.0 38 114.0 39 141.5 40 170.0 41 190.0 42 227.0 43 256.0 44 284.0 45 300.5 46 271.5 47 250.0 48 235.5 49 225.0 50 201.0 51 147.5 52 112.5 53 102.0 54 91.0 55 63.5 56 39.5 57 29.0 58 24.5 59 15.5 60 9.0 61 12.0 62 12.0 63 6.5 64 6.0 65 5.0 66 2.0 67 2.5 68 3.5 69 2.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.02 75-79 0.005 80-84 0.01 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.01 120-124 0.015 125-129 0.02 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0125 0.0 0.0 0.0 84-85 0.025 0.025 0.0 0.0 0.0 86-87 0.037500000000000006 0.025 0.0 0.0 0.0 88-89 0.05 0.025 0.0 0.0 0.0 90-91 0.05 0.025 0.0 0.0 0.0 92-93 0.05 0.025 0.0 0.0 0.0 94-95 0.05 0.025 0.0 0.0 0.0 96-97 0.0625 0.025 0.0 0.0 0.0 98-99 0.075 0.025 0.0 0.0 0.0 100-101 0.075 0.025 0.0 0.0 0.0 102-103 0.0875 0.025 0.0 0.0 0.0 104-105 0.125 0.025 0.0 0.0 0.0 106-107 0.15 0.025 0.0 0.0 0.0 108-109 0.15 0.025 0.0 0.0 0.0 110-111 0.15 0.025 0.0 0.0 0.0 112-113 0.15 0.025 0.0 0.0 0.0 114-115 0.2125 0.025 0.0 0.0 0.0 116-117 0.2875 0.025 0.0 0.0 0.0 118-119 0.4 0.025 0.0 0.0 0.0 120-121 0.4875 0.025 0.0 0.0 0.0 122-123 0.5125 0.025 0.0 0.0 0.0 124-125 0.575 0.025 0.0 0.0 0.0 126-127 0.575 0.025 0.0 0.0 0.0 128-129 0.6375 0.025 0.0 0.0 0.0 130-131 0.75 0.025 0.0 0.0 0.0 132-133 0.8374999999999999 0.025 0.0 0.0 0.0 134-135 0.9125 0.025 0.0 0.0 0.0 136-137 1.05 0.025 0.0 0.0 0.0 138-139 1.2000000000000002 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGACT 10 0.006577216 146.82278 1 TCATCAA 30 0.0017979635 72.49375 8 >>END_MODULE SRR7169093 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169093_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79325 33.0 33.0 34.0 32.0 34.0 2 33.0295 34.0 33.0 34.0 32.0 34.0 3 32.953 34.0 33.0 34.0 32.0 34.0 4 32.88325 34.0 33.0 34.0 32.0 34.0 5 32.936 34.0 33.0 34.0 32.0 34.0 6 37.08025 38.0 38.0 38.0 36.0 38.0 7 37.034 38.0 38.0 38.0 36.0 38.0 8 36.9905 38.0 38.0 38.0 37.0 38.0 9 36.703 38.0 38.0 38.0 35.0 38.0 10-14 36.87065 38.0 38.0 38.0 36.0 38.0 15-19 36.9277 38.0 38.0 38.0 36.0 38.0 20-24 36.8355 38.0 38.0 38.0 36.0 38.0 25-29 36.995400000000004 38.0 38.0 38.0 36.4 38.0 30-34 36.994350000000004 38.0 38.0 38.0 36.8 38.0 35-39 36.59805 38.0 38.0 38.0 35.0 38.0 40-44 36.67375 38.0 38.0 38.0 35.2 38.0 45-49 36.8284 38.0 38.0 38.0 35.8 38.0 50-54 36.8966 38.0 38.0 38.0 36.2 38.0 55-59 36.71925 38.0 38.0 38.0 35.4 38.0 60-64 36.78394999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.6717 38.0 38.0 38.0 35.2 38.0 70-74 36.34405 38.0 38.0 38.0 34.0 38.0 75-79 36.50555000000001 38.0 38.0 38.0 34.6 38.0 80-84 36.46505 38.0 38.0 38.0 34.4 38.0 85-89 36.219 38.0 38.0 38.0 33.4 38.0 90-94 36.23635 38.0 38.0 38.0 33.6 38.0 95-99 36.23025 38.0 38.0 38.0 33.8 38.0 100-104 36.174800000000005 38.0 38.0 38.0 33.8 38.0 105-109 35.83255 38.0 37.6 38.0 32.2 38.0 110-114 35.4828 38.0 37.0 38.0 29.4 38.0 115-119 35.32615 38.0 36.6 38.0 29.4 38.0 120-124 35.456599999999995 38.0 36.8 38.0 30.6 38.0 125-129 35.407849999999996 38.0 36.6 38.0 30.6 38.0 130-134 34.6219 38.0 35.4 38.0 26.4 38.0 135-139 33.94625 38.0 35.0 38.0 21.2 38.0 140-144 34.210350000000005 38.0 35.0 38.0 24.6 38.0 145-149 33.9198 38.0 35.0 38.0 23.4 38.0 150-151 30.481875000000002 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 2.0 5 2.0 6 3.0 7 0.0 8 2.0 9 0.0 10 2.0 11 3.0 12 0.0 13 1.0 14 2.0 15 6.0 16 5.0 17 3.0 18 2.0 19 13.0 20 6.0 21 7.0 22 14.0 23 16.0 24 15.0 25 22.0 26 17.0 27 32.0 28 37.0 29 42.0 30 49.0 31 60.0 32 77.0 33 100.0 34 167.0 35 229.0 36 509.0 37 2546.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.9457422758101 23.009294147199196 15.247425270032656 25.79753830695805 2 29.25 24.9 27.35 18.5 3 19.900000000000002 30.049999999999997 30.025000000000002 20.025000000000002 4 23.45 34.075 23.75 18.725 5 25.624999999999996 34.1 21.85 18.425 6 21.125 38.550000000000004 23.125 17.2 7 21.325 23.7 36.825 18.15 8 22.175 26.924999999999997 27.025 23.875 9 23.075000000000003 26.0 28.599999999999998 22.325 10-14 23.022302230223023 28.947894789478944 26.4976497649765 21.532153215321532 15-19 23.17231723172317 28.57285728572857 26.56265626562656 21.69216921692169 20-24 23.91358703805571 28.199229884482673 26.989048357253587 20.89813472020803 25-29 23.291987596278886 28.39351805541662 27.253175952785835 21.061318395518654 30-34 23.251975592677805 28.64859457837351 26.998099429828947 21.101330399119735 35-39 23.203121092382332 28.519981993697797 27.194518081328468 21.082378832591406 40-44 23.754252551530918 28.281969181508902 26.94616770062037 21.017610566339805 45-49 23.38818586505277 27.669684389536336 27.33456709848447 21.60756264692642 50-54 23.82953181272509 27.74609843937575 27.74109643857543 20.68327330932373 55-59 23.905 27.295 27.474999999999998 21.325 60-64 23.196959087726317 27.943383014904473 27.793338001400418 21.066319895968793 65-69 24.247274182254678 27.443232969890968 27.52325697709313 20.786235870761228 70-74 24.28985797159432 27.15543108621724 27.620524104820966 20.934186837367474 75-79 23.960990247561888 27.861965491372843 27.67691922980745 20.500125031257816 80-84 24.110849882447102 27.60242108949027 27.727477364814167 20.559251663248464 85-89 24.3974397439744 27.30773077307731 27.53775377537754 20.757075707570756 90-94 23.67210163048915 27.888366509952984 27.71331399419826 20.726217865359608 95-99 23.94577559901956 27.67745485468461 27.507378320244108 20.86939122605172 100-104 24.277427742774275 27.197719771977198 27.19271927192719 21.332133213321335 105-109 23.84192096048024 27.478739369684842 27.40370185092546 21.275637818909455 110-114 24.167083541770886 28.054027013506754 27.523761880940473 20.25512756378189 115-119 24.219687875150058 27.726090436174474 27.410964385754298 20.64325730292117 120-124 23.905976494123532 27.826956739184794 27.771942985746435 20.49512378094524 125-129 23.225806451612904 27.651912978244564 28.11202800700175 21.010252563140785 130-134 24.361797977775552 27.845630193212536 27.014716187806588 20.777855641205324 135-139 24.05823202761519 27.760268147481113 27.06488568712792 21.116614137775777 140-144 24.259555733440063 27.47148288973384 27.096257754652793 21.1727036221733 145-149 24.0706459198479 27.748036223545302 27.20768499524691 20.973632861359885 150-151 24.665248404455014 27.43085971718183 27.831310224002003 20.07258165436116 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 3.0 26 3.0 27 2.5 28 5.0 29 4.0 30 6.0 31 8.5 32 11.0 33 16.5 34 27.0 35 39.0 36 66.0 37 94.5 38 125.0 39 157.0 40 195.5 41 235.0 42 242.5 43 268.0 44 299.0 45 305.0 46 298.5 47 271.5 48 252.0 49 228.5 50 193.5 51 174.5 52 128.5 53 83.0 54 63.0 55 52.0 56 39.0 57 25.0 58 20.5 59 12.5 60 9.0 61 8.0 62 6.5 63 4.5 64 3.0 65 2.5 66 2.0 67 1.0 68 0.5 69 1.0 70 1.0 71 1.0 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.01 20-24 0.015 25-29 0.03 30-34 0.03 35-39 0.034999999999999996 40-44 0.06 45-49 0.034999999999999996 50-54 0.04 55-59 0.0 60-64 0.03 65-69 0.03 70-74 0.02 75-79 0.025 80-84 0.045 85-89 0.01 90-94 0.03 95-99 0.045 100-104 0.01 105-109 0.05 110-114 0.05 115-119 0.04 120-124 0.025 125-129 0.025 130-134 0.11 135-139 0.055 140-144 0.06 145-149 0.065 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.2125 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.575 0.0 0.0 0.0 0.0 128-129 0.6625 0.0 0.0 0.0 0.0 130-131 0.7749999999999999 0.0 0.0 0.0 0.0 132-133 0.8374999999999999 0.0 0.0 0.0 0.0 134-135 0.9125 0.0 0.0 0.0 0.0 136-137 1.0625 0.0 0.0 0.0 0.0 138-139 1.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra Read 892758 spots for SRR7169093.sra Written 892758 spots for SRR7169093.sra Read 892751 spots for SRR7169093.sra Written 892751 spots for SRR7169093.sra SRR ids: ['SRR7169093.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2u59vnjb SRR7169093.sra spots: 17855027 blocks: [[1, 892751], [892752, 1785502], [1785503, 2678253], [2678254, 3571004], [3571005, 4463755], [4463756, 5356506], [5356507, 6249257], [6249258, 7142008], [7142009, 8034759], [8034760, 8927510], [8927511, 9820261], [9820262, 10713012], [10713013, 11605763], [11605764, 12498514], [12498515, 13391265], [13391266, 14284016], [14284017, 15176767], [15176768, 16069518], [16069519, 16962269], [16962270, 17855027]] SRR7169093 file size 6028782 SRR7169093 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169093 SRR7169093_1.fastq SRR7169093_2.fastq Input file: SRR7169093_1.fastq Paired file: SRR7169093_2.fastq trimmed: SRR7169093-trimmed-pair1.fastq, SRR7169093-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:19:51 2025 >> started Mon Feb 10 20:20:10 2025 >> done (19.367s) 17855027 read pairs processed; of these: 16622 ( 0.09%) short read pairs filtered out after trimming by size control 9684 ( 0.05%) empty read pairs filtered out after trimming by size control 17828721 (99.85%) read pairs available; of these: 8534751 (47.87%) trimmed read pairs available after processing 9293970 (52.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 1 0.00% 20 5 0.00% 21 3 0.00% 22 4 0.00% 23 4 0.00% 24 3 0.00% 25 4 0.00% 26 5 0.00% 27 6 0.00% 28 6 0.00% 29 8 0.00% 30 11 0.00% 31 5 0.00% 32 5 0.00% 33 4 0.00% 34 9 0.00% 35 5 0.00% 36 9 0.00% 37 8 0.00% 38 13 0.00% 39 7 0.00% 40 8 0.00% 41 17 0.00% 42 19 0.00% 43 25 0.00% 44 25 0.00% 45 23 0.00% 46 14 0.00% 47 27 0.00% 48 36 0.00% 49 28 0.00% 50 36 0.00% 51 32 0.00% 52 28 0.00% 53 25 0.00% 54 28 0.00% 55 34 0.00% 56 49 0.00% 57 53 0.00% 58 83 0.00% 59 74 0.00% 60 83 0.00% 61 71 0.00% 62 96 0.00% 63 129 0.00% 64 152 0.00% 65 139 0.00% 66 211 0.00% 67 200 0.00% 68 175 0.00% 69 208 0.00% 70 204 0.00% 71 274 0.00% 72 312 0.00% 73 282 0.00% 74 303 0.00% 75 369 0.00% 76 357 0.00% 77 484 0.00% 78 458 0.00% 79 531 0.00% 80 609 0.00% 81 730 0.00% 82 860 0.00% 83 973 0.01% 84 1737 0.01% 85 2196 0.01% 86 2355 0.01% 87 2474 0.01% 88 2607 0.01% 89 2512 0.01% 90 2682 0.02% 91 2848 0.02% 92 2998 0.02% 93 3074 0.02% 94 3243 0.02% 95 3527 0.02% 96 3620 0.02% 97 3923 0.02% 98 4188 0.02% 99 4395 0.02% 100 4915 0.03% 101 4954 0.03% 102 5409 0.03% 103 5791 0.03% 104 6170 0.03% 105 6699 0.04% 106 7158 0.04% 107 7776 0.04% 108 8093 0.05% 109 8731 0.05% 110 9229 0.05% 111 9793 0.05% 112 10394 0.06% 113 10897 0.06% 114 11704 0.07% 115 12542 0.07% 116 13206 0.07% 117 14251 0.08% 118 15309 0.09% 119 16097 0.09% 120 17221 0.10% 121 17988 0.10% 122 19388 0.11% 123 20710 0.12% 124 22416 0.13% 125 23849 0.13% 126 25744 0.14% 127 27826 0.16% 128 29692 0.17% 129 31519 0.18% 130 33942 0.19% 131 37038 0.21% 132 40075 0.22% 133 43404 0.24% 134 47921 0.27% 135 52027 0.29% 136 57389 0.32% 137 63492 0.36% 138 70709 0.40% 139 78891 0.44% 140 87871 0.49% 141 100811 0.57% 142 118258 0.66% 143 133498 0.75% 144 162271 0.91% 145 202839 1.14% 146 260887 1.46% 147 359807 2.02% 148 551988 3.10% 149 1087431 6.10% 150 4461345 25.02% 151 9293970 52.13% 17828721 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=39 prefix-density=0.23 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=17 fanout-score=103.30 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=15.8 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=38 prefix-density=0.20 prefix-fanout=2.3 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=27 fanout-score=199.91 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=22.8 sequence=GAAGAAGAAGAAA SRR7169093 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:20:57 Started mapping on | Feb 10 20:20:57 Finished on | Feb 10 20:22:53 Mapping speed, Million of reads per hour | 553.31 Number of input reads | 17828721 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16803886 Uniquely mapped reads % | 94.25% Average mapped length | 296.71 Number of splices: Total | 15931753 Number of splices: Annotated (sjdb) | 15680168 Number of splices: GT/AG | 15709177 Number of splices: GC/AG | 179773 Number of splices: AT/AC | 12427 Number of splices: Non-canonical | 30376 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.02% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 308874 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 74635 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.48% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 733434 733434 733434 N_multimapping 308874 308874 308874 N_noFeature 293428 16600776 375823 N_ambiguous 194010 1056 72521 UnstrandedReadsAssigned:16316448 PositiveStrandReadsAssigned:202054 NegativeStrandReadsAssigned:16355542 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169093 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169093-trimmed-pair1.fastq SRR7169093-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,828,721 reads, 16,278,440 reads pseudoaligned [quant] estimated average fragment length: 270.501 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52401 SRR7169093.ke.tsv 34699 SRR7169093.se.tsv 87100 total ==> SRR7169093.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.5 379 11.4436 Potri.005G024800.1.v4.1 1035 765.499 40 2.75869 Potri.004G059700.1.v4.1 961 691.499 5 0.381739 Potri.007G009000.2.v4.1 1416 1146.5 0 0 Potri.003G141000.2.v4.1 2943 2673.5 283 5.58849 Potri.016G087400.1.v4.1 270 59.4578 1707.53 1516.17 Potri.015G069301.1.v4.1 564 299.392 0 0 Potri.010G195200.1.v4.1 1773 1503.5 53.8941 1.89246 Potri.012G127500.1.v4.1 977 707.499 6270 467.874 ==> SRR7169093.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1448 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 275 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169093 completed mapping pipeline successfully