Starting /dee2/code/volunteer_pipeline.sh SRR7169094 current disk space = 3056930103296 free memory = 1519343356 SRR7169094 SRAfilesize d2abb87323c0ee57177167bfed9d862a SRR7169094.sra SRR7169094.sra file validated SRR7169094 is paired end SRR7169094 is conventional basespace SRR7169094 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169094_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01525 34.0 33.0 34.0 33.0 34.0 2 33.47475 34.0 34.0 34.0 33.0 34.0 3 33.51175 34.0 34.0 34.0 33.0 34.0 4 33.51025 34.0 34.0 34.0 33.0 34.0 5 33.5425 34.0 34.0 34.0 33.0 34.0 6 37.2245 38.0 38.0 38.0 36.0 38.0 7 37.48275 38.0 38.0 38.0 37.0 38.0 8 37.481 38.0 38.0 38.0 37.0 38.0 9 37.56225 38.0 38.0 38.0 38.0 38.0 10-14 37.50205 38.0 38.0 38.0 37.8 38.0 15-19 37.4431 38.0 38.0 38.0 37.2 38.0 20-24 37.47645 38.0 38.0 38.0 37.4 38.0 25-29 37.4089 38.0 38.0 38.0 37.0 38.0 30-34 37.3317 38.0 38.0 38.0 37.0 38.0 35-39 37.25285000000001 38.0 38.0 38.0 36.8 38.0 40-44 36.90935 38.0 38.0 38.0 35.8 38.0 45-49 36.6557 38.0 38.0 38.0 34.6 38.0 50-54 36.61645 38.0 38.0 38.0 34.4 38.0 55-59 36.48785 38.0 38.0 38.0 34.0 38.0 60-64 36.399350000000005 38.0 38.0 38.0 33.8 38.0 65-69 36.26625 38.0 37.6 38.0 33.4 38.0 70-74 36.29235 38.0 37.8 38.0 33.4 38.0 75-79 36.0292 38.0 37.0 38.0 33.0 38.0 80-84 35.9799 38.0 37.0 38.0 32.8 38.0 85-89 35.8006 38.0 37.0 38.0 31.6 38.0 90-94 35.49925 38.0 36.8 38.0 29.8 38.0 95-99 35.47875 38.0 36.4 38.0 29.8 38.0 100-104 35.033249999999995 38.0 35.8 38.0 28.4 38.0 105-109 34.8389 38.0 36.0 38.0 27.8 38.0 110-114 34.4522 38.0 35.0 38.0 25.6 38.0 115-119 34.32655 38.0 35.0 38.0 24.2 38.0 120-124 34.0274 38.0 34.2 38.0 23.6 38.0 125-129 33.6377 38.0 33.8 38.0 21.0 38.0 130-134 33.06165 38.0 33.8 38.0 15.0 38.0 135-139 32.809000000000005 38.0 33.6 38.0 14.8 38.0 140-144 32.10424999999999 37.0 33.0 38.0 14.0 38.0 145-149 31.2491 36.2 31.4 38.0 8.8 38.0 150-151 27.228749999999998 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 2.0 6 0.0 7 2.0 8 0.0 9 3.0 10 0.0 11 2.0 12 5.0 13 2.0 14 4.0 15 9.0 16 3.0 17 9.0 18 8.0 19 7.0 20 11.0 21 13.0 22 14.0 23 22.0 24 18.0 25 20.0 26 23.0 27 27.0 28 35.0 29 52.0 30 67.0 31 67.0 32 87.0 33 145.0 34 251.0 35 424.0 36 1004.0 37 1663.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.922374429223744 15.499746321664128 9.918822932521563 31.65905631659056 2 25.2 13.450000000000001 30.575000000000003 30.775000000000002 3 19.325 17.825 27.025 35.825 4 21.875 23.7 25.324999999999996 29.099999999999998 5 22.55 28.65 25.900000000000002 22.900000000000002 6 20.9 32.675 25.224999999999998 21.2 7 15.9 29.925 37.225 16.950000000000003 8 16.275000000000002 29.725 31.65 22.35 9 16.725 27.725 33.300000000000004 22.25 10-14 18.945 31.175000000000004 28.139999999999997 21.740000000000002 15-19 19.455 30.175 27.54 22.830000000000002 20-24 19.220000000000002 29.799999999999997 27.55 23.43 25-29 19.595000000000002 30.245 27.505000000000003 22.655 30-34 19.03 29.659999999999997 27.715 23.595 35-39 19.66 29.720000000000002 27.205000000000002 23.415 40-44 19.455 30.15 26.724999999999998 23.669999999999998 45-49 20.119999999999997 29.134999999999998 27.334999999999997 23.41 50-54 19.34 30.049999999999997 27.055 23.555 55-59 19.725 29.315 26.779999999999998 24.18 60-64 20.235 29.459999999999997 26.245 24.060000000000002 65-69 19.68 29.925 26.965 23.43 70-74 19.505 29.765000000000004 27.029999999999998 23.7 75-79 20.095 29.38 26.985 23.54 80-84 19.75 29.89 26.895000000000003 23.465 85-89 20.285 28.71 27.115000000000002 23.89 90-94 20.135 29.799999999999997 26.91 23.155 95-99 19.855 29.235 26.945000000000004 23.965 100-104 20.749712226615287 29.007557179320354 26.460137130273758 23.7825934637906 105-109 20.31 28.999999999999996 27.105 23.585 110-114 20.02705004257877 28.547813454891553 27.440765416019637 23.98437108651004 115-119 20.330000000000002 28.999999999999996 26.435 24.235 120-124 20.394374655923126 28.557129272809167 26.905560282268155 24.14293578899955 125-129 20.59 28.74 27.185 23.485 130-134 21.005 28.134999999999998 27.215 23.645 135-139 20.155 28.389999999999997 27.61 23.845 140-144 20.715 28.095 27.235 23.955000000000002 145-149 20.855 28.189999999999998 26.775 24.18 150-151 21.2625 27.2625 26.8125 24.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.5 17 1.5 18 2.0 19 2.0 20 0.5 21 1.5 22 4.0 23 4.0 24 4.0 25 7.0 26 12.0 27 19.5 28 24.0 29 26.0 30 36.0 31 43.5 32 49.5 33 58.0 34 71.5 35 91.0 36 108.5 37 137.5 38 146.5 39 145.0 40 174.0 41 213.0 42 224.5 43 228.0 44 235.5 45 238.5 46 224.5 47 212.5 48 210.5 49 171.5 50 139.0 51 130.0 52 114.0 53 103.5 54 91.5 55 69.0 56 50.5 57 38.0 58 30.0 59 26.0 60 21.0 61 15.0 62 12.0 63 10.5 64 8.0 65 2.5 66 0.5 67 2.0 68 1.5 69 0.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.095 105-109 0.0 110-114 0.185 115-119 0.0 120-124 0.095 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1672975018925 98.25 2 0.7317688619732526 1.4500000000000002 3 0.10093363613424174 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.7375 0.0 0.0 0.0 0.0 126-127 0.7625 0.0 0.0 0.0 0.0 128-129 0.825 0.0 0.0 0.0 0.0 130-131 1.0 0.0 0.0 0.0 0.0 132-133 1.1375 0.0 0.0 0.0 0.0 134-135 1.2875 0.0 0.0 0.0 0.0 136-137 1.4125 0.0 0.0 0.0 0.0 138-139 1.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATCTG 10 0.006830828 145.0 145 >>END_MODULE SRR7169094 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169094_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87625 33.0 33.0 34.0 32.0 34.0 2 33.04425 34.0 33.0 34.0 32.0 34.0 3 33.0955 34.0 33.0 34.0 33.0 34.0 4 33.0295 34.0 33.0 34.0 33.0 34.0 5 33.08225 34.0 33.0 34.0 33.0 34.0 6 37.13275 38.0 38.0 38.0 37.0 38.0 7 37.18525 38.0 38.0 38.0 37.0 38.0 8 37.0685 38.0 38.0 38.0 37.0 38.0 9 37.08575 38.0 38.0 38.0 37.0 38.0 10-14 37.0937 38.0 38.0 38.0 37.0 38.0 15-19 37.1401 38.0 38.0 38.0 37.2 38.0 20-24 37.10275 38.0 38.0 38.0 37.0 38.0 25-29 37.06570000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.06205 38.0 38.0 38.0 37.0 38.0 35-39 37.07295 38.0 38.0 38.0 37.0 38.0 40-44 37.03085 38.0 38.0 38.0 37.0 38.0 45-49 36.9668 38.0 38.0 38.0 37.0 38.0 50-54 36.80265 38.0 38.0 38.0 36.8 38.0 55-59 36.77315 38.0 38.0 38.0 36.6 38.0 60-64 36.6688 38.0 38.0 38.0 36.4 38.0 65-69 36.5188 38.0 38.0 38.0 36.0 38.0 70-74 36.4206 38.0 38.0 38.0 36.0 38.0 75-79 36.363600000000005 38.0 38.0 38.0 35.8 38.0 80-84 36.41655000000001 38.0 38.0 38.0 35.0 38.0 85-89 36.453900000000004 38.0 38.0 38.0 35.2 38.0 90-94 36.35 38.0 38.0 38.0 35.0 38.0 95-99 36.25054999999999 38.0 38.0 38.0 34.6 38.0 100-104 36.07965 38.0 38.0 38.0 34.0 38.0 105-109 35.933800000000005 38.0 38.0 38.0 34.0 38.0 110-114 35.8108 38.0 38.0 38.0 33.4 38.0 115-119 35.73485000000001 38.0 38.0 38.0 33.0 38.0 120-124 35.59805 38.0 38.0 38.0 32.6 38.0 125-129 35.26635 38.0 37.2 38.0 31.0 38.0 130-134 35.11455 38.0 37.2 38.0 30.2 38.0 135-139 34.55890000000001 38.0 36.0 38.0 27.6 38.0 140-144 34.1234 38.0 35.6 38.0 23.8 38.0 145-149 33.601549999999996 38.0 35.0 38.0 18.6 38.0 150-151 30.457625 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 3.0 4 1.0 5 1.0 6 3.0 7 5.0 8 0.0 9 1.0 10 4.0 11 2.0 12 7.0 13 18.0 14 1.0 15 5.0 16 6.0 17 1.0 18 9.0 19 7.0 20 6.0 21 13.0 22 10.0 23 11.0 24 11.0 25 13.0 26 19.0 27 27.0 28 24.0 29 38.0 30 36.0 31 46.0 32 62.0 33 68.0 34 100.0 35 144.0 36 382.0 37 2902.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.73875910575232 23.1600100477267 13.614669680984678 23.486561165536298 2 28.057014253563388 27.431857964491122 26.65666416604151 17.854463615903978 3 20.740555416562422 30.92319239429572 29.02176632474356 19.314485864398296 4 24.775 32.925 23.35 18.95 5 25.974999999999998 34.675 22.275 17.075000000000003 6 21.825 36.5 23.5 18.175 7 20.825 23.225 35.9 20.05 8 22.7 25.775 25.900000000000002 25.624999999999996 9 23.5 26.25 28.599999999999998 21.65 10-14 24.785 28.285 25.695 21.235 15-19 24.205 28.315 26.950000000000003 20.53 20-24 24.295 28.265 26.76 20.68 25-29 24.07 28.860000000000003 26.36 20.71 30-34 24.404999999999998 28.1 26.795 20.7 35-39 24.455 28.299999999999997 26.369999999999997 20.875 40-44 24.095 28.285 26.55 21.07 45-49 24.55 28.499999999999996 26.825 20.125 50-54 24.13499147527831 27.880854477986162 27.128673152141207 20.855480894594326 55-59 24.767646320020095 28.058276814870638 27.274554132127605 19.899522732981662 60-64 23.590362657813994 27.312509431115135 27.604245259292792 21.492882651778082 65-69 24.331010804806624 27.991517721902454 27.02211451075432 20.655356962536604 70-74 24.435235255470765 27.356345075049276 27.644412998433314 20.56400667104665 75-79 24.056198514175975 26.977308333754486 27.8566735735584 21.109819578511143 80-84 24.284780531952336 27.487555935441698 27.276383930816028 20.951279601789935 85-89 24.3808088419995 27.455413212760615 27.425270032655114 20.738507912584776 90-94 24.04420999748807 27.611152976639037 27.902537050992215 20.442099974880684 95-99 24.18487817131374 27.455413212760615 27.89248932429038 20.467219291635267 100-104 24.171020900321544 27.57234726688103 27.481913183279744 20.774718649517684 105-109 24.47626224566692 27.631248430042703 27.440341622707866 20.45214770158252 110-114 23.9638281838734 27.661391610148208 27.375031399145943 20.999748806832454 115-119 24.19994976136649 28.018085908063302 26.95302687766893 20.82893745290128 120-124 23.592062295905553 27.611152976639037 28.48530519969857 20.311479527756845 125-129 23.22532027128862 27.98291886460688 27.616176839989954 21.175584024114542 130-134 24.281551446945336 27.833601286173632 27.351286173633437 20.533561093247588 135-139 23.758077544426495 27.584814216478193 28.241114701130854 20.415993537964457 140-144 24.31257581884351 27.53740396279822 27.71431459765467 20.435705620703597 145-149 24.608682437566486 27.420090167671347 28.26604528645965 19.70518210830252 150-151 24.784263959390863 26.649746192893403 28.680203045685282 19.885786802030456 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 2.0 21 3.5 22 4.5 23 3.0 24 3.5 25 4.0 26 4.5 27 5.5 28 4.0 29 7.0 30 10.0 31 10.0 32 14.0 33 22.5 34 38.5 35 45.0 36 57.5 37 80.0 38 111.5 39 145.5 40 180.0 41 207.0 42 234.5 43 260.0 44 278.5 45 286.5 46 270.0 47 266.0 48 253.0 49 231.0 50 207.0 51 161.0 52 126.5 53 117.0 54 94.0 55 66.5 56 49.0 57 40.5 58 32.5 59 17.5 60 12.0 61 10.5 62 6.0 63 6.0 64 3.5 65 1.5 66 2.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.025 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.29 55-59 0.475 60-64 0.5950000000000001 65-69 0.97 70-74 1.065 75-79 1.065 80-84 0.555 85-89 0.475 90-94 0.475 95-99 0.475 100-104 0.48 105-109 0.475 110-114 0.475 115-119 0.475 120-124 0.475 125-129 0.475 130-134 0.48 135-139 0.96 140-144 1.08 145-149 1.295 150-151 1.5 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14163090128756 98.175 2 0.7321383489017925 1.4500000000000002 3 0.12623074981065388 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.23750000000000002 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.7125 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.7875000000000001 0.0 0.0 0.0 0.0 128-129 0.875 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.1875 0.0 0.0 0.0 0.0 134-135 1.35 0.0 0.0 0.0 0.0 136-137 1.4875 0.0 0.0 0.0 0.0 138-139 1.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAACT 10 0.006830828 145.0 145 >>END_MODULE Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra Read 635197 spots for SRR7169094.sra Written 635197 spots for SRR7169094.sra SRR ids: ['SRR7169094.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__9gg6gwl SRR7169094.sra spots: 12703940 blocks: [[1, 635197], [635198, 1270394], [1270395, 1905591], [1905592, 2540788], [2540789, 3175985], [3175986, 3811182], [3811183, 4446379], [4446380, 5081576], [5081577, 5716773], [5716774, 6351970], [6351971, 6987167], [6987168, 7622364], [7622365, 8257561], [8257562, 8892758], [8892759, 9527955], [9527956, 10163152], [10163153, 10798349], [10798350, 11433546], [11433547, 12068743], [12068744, 12703940]] SRR7169094 file size 4283248 SRR7169094 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169094 SRR7169094_1.fastq SRR7169094_2.fastq Input file: SRR7169094_1.fastq Paired file: SRR7169094_2.fastq trimmed: SRR7169094-trimmed-pair1.fastq, SRR7169094-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:17:43 2025 >> started Mon Feb 10 21:17:59 2025 >> done (15.227s) 12703940 read pairs processed; of these: 20089 ( 0.16%) short read pairs filtered out after trimming by size control 13660 ( 0.11%) empty read pairs filtered out after trimming by size control 12670191 (99.73%) read pairs available; of these: 6174831 (48.74%) trimmed read pairs available after processing 6495360 (51.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 8 0.00% 20 9 0.00% 21 7 0.00% 22 8 0.00% 23 10 0.00% 24 8 0.00% 25 10 0.00% 26 9 0.00% 27 14 0.00% 28 13 0.00% 29 6 0.00% 30 14 0.00% 31 13 0.00% 32 10 0.00% 33 12 0.00% 34 6 0.00% 35 15 0.00% 36 14 0.00% 37 19 0.00% 38 20 0.00% 39 24 0.00% 40 16 0.00% 41 28 0.00% 42 22 0.00% 43 18 0.00% 44 17 0.00% 45 26 0.00% 46 32 0.00% 47 31 0.00% 48 40 0.00% 49 46 0.00% 50 50 0.00% 51 51 0.00% 52 50 0.00% 53 65 0.00% 54 68 0.00% 55 67 0.00% 56 68 0.00% 57 76 0.00% 58 90 0.00% 59 88 0.00% 60 108 0.00% 61 123 0.00% 62 130 0.00% 63 158 0.00% 64 179 0.00% 65 175 0.00% 66 182 0.00% 67 232 0.00% 68 262 0.00% 69 307 0.00% 70 395 0.00% 71 375 0.00% 72 437 0.00% 73 459 0.00% 74 530 0.00% 75 711 0.01% 76 569 0.00% 77 408 0.00% 78 591 0.00% 79 1043 0.01% 80 1396 0.01% 81 753 0.01% 82 785 0.01% 83 931 0.01% 84 1877 0.01% 85 2540 0.02% 86 2941 0.02% 87 2977 0.02% 88 2801 0.02% 89 2918 0.02% 90 3149 0.02% 91 3036 0.02% 92 3374 0.03% 93 3530 0.03% 94 3658 0.03% 95 3924 0.03% 96 4284 0.03% 97 4860 0.04% 98 5690 0.04% 99 7164 0.06% 100 7730 0.06% 101 5651 0.04% 102 5559 0.04% 103 5836 0.05% 104 6182 0.05% 105 6848 0.05% 106 7430 0.06% 107 7975 0.06% 108 8551 0.07% 109 8830 0.07% 110 9200 0.07% 111 9781 0.08% 112 10301 0.08% 113 11097 0.09% 114 11651 0.09% 115 12114 0.10% 116 13037 0.10% 117 13408 0.11% 118 13949 0.11% 119 14673 0.12% 120 15401 0.12% 121 16141 0.13% 122 17096 0.13% 123 18393 0.15% 124 19595 0.15% 125 20639 0.16% 126 22078 0.17% 127 23314 0.18% 128 25010 0.20% 129 26714 0.21% 130 28241 0.22% 131 30065 0.24% 132 31712 0.25% 133 34184 0.27% 134 37304 0.29% 135 40357 0.32% 136 43799 0.35% 137 47661 0.38% 138 52399 0.41% 139 58719 0.46% 140 63877 0.50% 141 71896 0.57% 142 81465 0.64% 143 93934 0.74% 144 113009 0.89% 145 139571 1.10% 146 175161 1.38% 147 244415 1.93% 148 389220 3.07% 149 750163 5.92% 150 3182326 25.12% 151 6495360 51.26% 12670191 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=16.43 fanout-score-rank=11 prefix-density=0.38 prefix-fanout=6.5 sequence=TGGTGCTGGTGCATCGGCAGCTGCAGCCTTTTGCATGGTTGAGAAGGCCATCAAGACCACCATCAACACAACAAAGATCTTCATTTTCATTGCCTCCATTTTCTTGATCAACAGATATAGAAAGAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=145.74 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=14.8 sequence=TCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAA criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=4.33 fanout-score-rank=29 prefix-density=0.58 prefix-fanout=3.1 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=82.25 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=10.9 sequence=GAAAATGGAGGCAATGAAAATGAAGATCTTTGTTGTGTTGATGGTGGTCTTGATGGCCTTCTCAACCATGCAAAAGGCTGCAGCTGCCGATGCACCAGCACCA SRR7169094 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:18:58 Started mapping on | Feb 10 21:18:59 Finished on | Feb 10 21:21:39 Mapping speed, Million of reads per hour | 285.08 Number of input reads | 12670191 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11268984 Uniquely mapped reads % | 88.94% Average mapped length | 295.84 Number of splices: Total | 9490156 Number of splices: Annotated (sjdb) | 9318351 Number of splices: GT/AG | 9349853 Number of splices: GC/AG | 107929 Number of splices: AT/AC | 8393 Number of splices: Non-canonical | 23981 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 233291 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 20964 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.00% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1186316 1186316 1186316 N_multimapping 233291 233291 233291 N_noFeature 239935 11115830 297659 N_ambiguous 142967 702 47103 UnstrandedReadsAssigned:10886082 PositiveStrandReadsAssigned:152452 NegativeStrandReadsAssigned:10924222 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169094 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169094-trimmed-pair1.fastq SRR7169094-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,670,191 reads, 10,911,999 reads pseudoaligned [quant] estimated average fragment length: 254.121 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,241 rounds 52401 SRR7169094.ke.tsv 34699 SRR7169094.se.tsv 87100 total ==> SRR7169094.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.88 176 6.8488 Potri.005G024800.1.v4.1 1035 781.879 30 2.63511 Potri.004G059700.1.v4.1 961 707.879 3 0.291057 Potri.007G009000.2.v4.1 1416 1162.88 0 0 Potri.003G141000.2.v4.1 2943 2689.88 188 4.8 Potri.016G087400.1.v4.1 270 62.0714 1277 1412.91 Potri.015G069301.1.v4.1 564 313.136 0 0 Potri.010G195200.1.v4.1 1773 1519.88 32 1.44596 Potri.012G127500.1.v4.1 977 723.879 3770 357.678 ==> SRR7169094.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 985 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 214 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7169094 completed mapping pipeline successfully