Starting /dee2/code/volunteer_pipeline.sh SRR7169095 current disk space = 3056356413440 free memory = 1019085712 SRR7169095 SRAfilesize 4aceabc5477060207a52fb9265a06d24 SRR7169095.sra SRR7169095.sra file validated SRR7169095 is paired end SRR7169095 is conventional basespace SRR7169095 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169095_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73425 34.0 33.0 34.0 32.0 34.0 2 33.272 34.0 33.0 34.0 32.0 34.0 3 33.3245 34.0 33.0 34.0 33.0 34.0 4 33.447 34.0 34.0 34.0 33.0 34.0 5 33.4865 34.0 33.0 34.0 33.0 34.0 6 37.05875 38.0 37.0 38.0 36.0 38.0 7 37.40175 38.0 38.0 38.0 37.0 38.0 8 37.471 38.0 38.0 38.0 37.0 38.0 9 37.47575 38.0 38.0 38.0 37.0 38.0 10-14 37.14455 38.0 38.0 38.0 36.2 38.0 15-19 37.114850000000004 38.0 38.0 38.0 36.2 38.0 20-24 37.379749999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.193349999999995 38.0 38.0 38.0 36.4 38.0 30-34 37.238 38.0 38.0 38.0 36.6 38.0 35-39 37.271100000000004 38.0 38.0 38.0 36.8 38.0 40-44 37.038149999999995 38.0 38.0 38.0 35.8 38.0 45-49 36.84740000000001 38.0 38.0 38.0 35.2 38.0 50-54 36.6963 38.0 38.0 38.0 34.2 38.0 55-59 36.284800000000004 38.0 37.2 38.0 33.6 38.0 60-64 36.561699999999995 38.0 37.8 38.0 34.0 38.0 65-69 36.3005 38.0 37.6 38.0 33.4 38.0 70-74 36.22735 38.0 37.2 38.0 33.2 38.0 75-79 36.181349999999995 38.0 37.0 38.0 33.2 38.0 80-84 36.24575 38.0 37.0 38.0 33.4 38.0 85-89 35.9784 38.0 37.0 38.0 32.2 38.0 90-94 35.713049999999996 38.0 36.6 38.0 30.6 38.0 95-99 35.798750000000005 38.0 36.8 38.0 31.8 38.0 100-104 35.2967 38.0 36.0 38.0 29.0 38.0 105-109 34.58285 38.0 35.0 38.0 24.2 38.0 110-114 34.9977 38.0 35.6 38.0 27.6 38.0 115-119 35.0589 38.0 35.8 38.0 28.2 38.0 120-124 34.6706 38.0 35.0 38.0 27.2 38.0 125-129 33.99065 38.0 34.2 38.0 23.4 38.0 130-134 34.202999999999996 38.0 34.8 38.0 24.2 38.0 135-139 33.7682 38.0 34.2 38.0 22.2 38.0 140-144 32.81230000000001 38.0 33.2 38.0 15.6 38.0 145-149 32.34185 37.2 33.0 38.0 13.8 38.0 150-151 28.37075 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 2.0 12 1.0 13 0.0 14 3.0 15 5.0 16 1.0 17 2.0 18 5.0 19 5.0 20 9.0 21 7.0 22 9.0 23 15.0 24 16.0 25 28.0 26 18.0 27 31.0 28 48.0 29 51.0 30 69.0 31 88.0 32 94.0 33 150.0 34 227.0 35 398.0 36 922.0 37 1794.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.203883495145625 13.362289218191108 9.427695452222789 34.006131834440474 2 23.200000000000003 14.625 33.525 28.65 3 19.375 18.925 27.85 33.85 4 24.275 26.125 23.95 25.650000000000002 5 23.625 31.724999999999998 23.05 21.6 6 20.674999999999997 34.825 24.8 19.7 7 14.499999999999998 28.525 38.475 18.5 8 17.075000000000003 27.525 31.55 23.849999999999998 9 17.7 24.474999999999998 33.225 24.6 10-14 19.825 29.78 27.089999999999996 23.305 15-19 20.23 28.32 27.755000000000003 23.695 20-24 19.900000000000002 28.365000000000002 28.43 23.305 25-29 20.380000000000003 28.435 27.625 23.56 30-34 19.71 28.485 27.555000000000003 24.25 35-39 20.055 28.985 27.389999999999997 23.57 40-44 19.895 29.080000000000002 27.365000000000002 23.66 45-49 20.075000000000003 28.21 27.495000000000005 24.22 50-54 20.635 28.849999999999998 27.05 23.465 55-59 20.91 28.075 27.38 23.635 60-64 20.125 28.804999999999996 27.265 23.805 65-69 19.794999999999998 28.449999999999996 27.575 24.18 70-74 20.491147344203263 28.833650095028506 26.96809042712814 23.70711213364009 75-79 20.27702770277028 28.312831283128315 27.277727772777276 24.132413241324134 80-84 19.882982447367105 28.34425163774566 27.859178876831525 23.91358703805571 85-89 20.485 28.865000000000002 27.33 23.32 90-94 20.49909981996399 28.170634126825366 27.090418083616726 24.23984796959392 95-99 20.474999999999998 28.46 27.644999999999996 23.419999999999998 100-104 20.64 28.18 27.3 23.880000000000003 105-109 20.65 27.495000000000005 27.939999999999998 23.915 110-114 20.367036703670365 28.007800780078007 27.992799279927993 23.632363236323634 115-119 21.18817822673401 27.904185627844175 27.319097864679705 23.58853828074211 120-124 20.75122536761028 27.738321496448936 27.508252475742722 24.00220066019806 125-129 20.75122536761028 27.6332899869961 27.768330499149744 23.847154146243874 130-134 21.075 27.185 28.01 23.73 135-139 20.79 27.445000000000004 28.084999999999997 23.68 140-144 20.515 27.765 27.73 23.990000000000002 145-149 20.42204220422042 27.81278127812781 27.647764776477647 24.117411741174116 150-151 20.1150143767971 28.6160770096262 27.765970746343292 23.502937867233403 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.5 20 1.5 21 0.0 22 0.5 23 1.0 24 1.0 25 2.0 26 4.0 27 5.5 28 5.5 29 13.5 30 21.0 31 26.0 32 35.0 33 44.5 34 52.0 35 55.5 36 68.0 37 105.5 38 133.0 39 142.5 40 175.5 41 208.0 42 240.0 43 268.5 44 283.5 45 284.5 46 261.0 47 240.5 48 242.5 49 238.5 50 188.0 51 138.0 52 111.5 53 97.5 54 78.5 55 48.0 56 40.0 57 38.5 58 30.0 59 16.0 60 8.5 61 8.5 62 6.5 63 6.0 64 4.5 65 3.0 66 2.5 67 3.5 68 3.0 69 1.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.03 75-79 0.01 80-84 0.015 85-89 0.0 90-94 0.02 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.015 120-124 0.03 125-129 0.03 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.07500000000000001 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.1125 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.25 0.0 0.0 0.0 0.0 122-123 0.2625 0.0 0.0 0.0 0.0 124-125 0.32499999999999996 0.0 0.0 0.0 0.0 126-127 0.38749999999999996 0.0 0.0 0.0 0.0 128-129 0.4625 0.0 0.0 0.0 0.0 130-131 0.525 0.0 0.0 0.0 0.0 132-133 0.625 0.0 0.0 0.0 0.0 134-135 0.7 0.0 0.0 0.0 0.0 136-137 0.8 0.0 0.0 0.0 0.0 138-139 0.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169095 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169095_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77775 33.0 33.0 34.0 32.0 34.0 2 33.02 34.0 33.0 34.0 32.0 34.0 3 32.9435 34.0 33.0 34.0 32.0 34.0 4 32.95475 34.0 33.0 34.0 32.0 34.0 5 32.996 34.0 33.0 34.0 32.0 34.0 6 37.119 38.0 38.0 38.0 37.0 38.0 7 37.05275 38.0 38.0 38.0 37.0 38.0 8 37.16975 38.0 38.0 38.0 37.0 38.0 9 36.82725 38.0 38.0 38.0 36.0 38.0 10-14 36.95505 38.0 38.0 38.0 36.4 38.0 15-19 37.01185 38.0 38.0 38.0 36.6 38.0 20-24 36.90624999999999 38.0 38.0 38.0 36.2 38.0 25-29 37.03775 38.0 38.0 38.0 36.6 38.0 30-34 37.06595 38.0 38.0 38.0 37.0 38.0 35-39 36.69565 38.0 38.0 38.0 35.2 38.0 40-44 36.69405 38.0 38.0 38.0 35.8 38.0 45-49 36.920049999999996 38.0 38.0 38.0 36.2 38.0 50-54 36.9721 38.0 38.0 38.0 36.0 38.0 55-59 36.78065 38.0 38.0 38.0 35.6 38.0 60-64 36.8429 38.0 38.0 38.0 36.0 38.0 65-69 36.7724 38.0 38.0 38.0 35.8 38.0 70-74 36.41475 38.0 38.0 38.0 34.2 38.0 75-79 36.459450000000004 38.0 38.0 38.0 34.4 38.0 80-84 36.48575 38.0 38.0 38.0 34.4 38.0 85-89 36.26675 38.0 38.0 38.0 33.8 38.0 90-94 36.1838 38.0 38.0 38.0 33.6 38.0 95-99 36.205349999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.26335 38.0 38.0 38.0 34.0 38.0 105-109 35.89535000000001 38.0 37.4 38.0 32.8 38.0 110-114 35.59785000000001 38.0 37.0 38.0 30.6 38.0 115-119 35.44895 38.0 36.8 38.0 30.0 38.0 120-124 35.58605000000001 38.0 36.8 38.0 31.0 38.0 125-129 35.2977 38.0 36.4 38.0 30.0 38.0 130-134 34.74435 38.0 35.8 38.0 26.8 38.0 135-139 34.0995 38.0 35.0 38.0 22.8 38.0 140-144 34.2602 38.0 35.0 38.0 25.2 38.0 145-149 33.8569 38.0 35.0 38.0 22.8 38.0 150-151 30.44925 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 2.0 5 2.0 6 2.0 7 0.0 8 0.0 9 1.0 10 4.0 11 2.0 12 1.0 13 1.0 14 2.0 15 3.0 16 7.0 17 8.0 18 3.0 19 9.0 20 7.0 21 5.0 22 12.0 23 17.0 24 21.0 25 23.0 26 16.0 27 28.0 28 31.0 29 36.0 30 34.0 31 75.0 32 74.0 33 92.0 34 154.0 35 257.0 36 501.0 37 2563.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.87383764765016 23.548630309122895 13.495853229454639 25.081678813772307 2 28.975 26.525 27.200000000000003 17.299999999999997 3 19.675 28.9 31.2 20.225 4 22.55 34.525 24.5 18.425 5 23.9 36.075 22.0 18.025 6 21.625 38.074999999999996 23.025000000000002 17.275 7 21.2 22.85 36.25 19.7 8 21.4 27.200000000000003 26.150000000000002 25.25 9 21.8 26.05 29.099999999999998 23.05 10-14 23.408511276691506 29.19437915687353 26.368955343301497 21.02815422313347 15-19 23.292329232923294 28.107810781078108 27.557755775577558 21.04210421042104 20-24 23.154630926185238 28.395679135827166 27.255451090218042 21.194238847769554 25-29 23.613264642624916 28.15985594958235 27.269544340519182 20.957335067273547 30-34 22.586776032809844 28.108432529758925 27.748324497349202 21.556466940082025 35-39 23.39052573658146 28.632884798159168 27.247261267570405 20.72932819768896 40-44 22.818691214728837 28.10186111667 27.906744046427857 21.1727036221733 45-49 22.899159663865547 28.031212484994 27.646058423369347 21.42356942777111 50-54 23.356678339169584 28.47423711855928 27.303651825912954 20.86543271635818 55-59 23.581179058952948 28.07140357017851 27.2063603180159 21.141057052852645 60-64 23.678287400590207 28.104836692842493 27.609663382183765 20.607212524383534 65-69 23.231969590877263 27.74332299689907 27.688306491947586 21.336400920276084 70-74 23.562068620586178 27.89336801040312 27.113133940182056 21.43142942882865 75-79 23.31315960586205 28.419946981443506 27.399589856449758 20.867303556244686 80-84 23.506753376688344 27.953976988494244 27.368684342171086 21.170585292646322 85-89 24.0886132919938 27.33910086512977 28.134220133019955 20.438065709856478 90-94 23.559423769507802 27.70608243297319 27.435974389755902 21.298519407763106 95-99 23.836918459229615 27.968984492246125 27.66383191595798 20.530265132566285 100-104 23.9247849569914 27.625525105021005 27.4004800960192 21.049209841968395 105-109 24.019411646988193 27.70162097258355 27.631578947368425 20.647388433059835 110-114 23.62417450470282 27.396437862717633 28.32199319591755 20.657394436661995 115-119 24.139655862344938 27.125850340136054 27.871148459383754 20.863345338135254 120-124 23.704481792717086 27.686074429771907 27.70608243297319 20.903361344537817 125-129 24.092227668300488 27.858357507252173 27.89336801040312 20.156046814044213 130-134 24.396836520172187 27.63539893883272 27.445189708679546 20.522574832315545 135-139 22.98764320376207 28.285557056381013 27.695232377807795 21.031567362049127 140-144 23.819291574944966 27.746647988793278 27.58655193115869 20.847508505103065 145-149 24.13551518790972 28.264024420757643 26.722714307161088 20.877746084171545 150-151 23.62953692115144 27.972465581977474 27.42177722152691 20.97622027534418 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 1.0 24 1.0 25 1.0 26 4.0 27 4.5 28 3.0 29 3.5 30 6.0 31 12.0 32 16.5 33 25.0 34 34.0 35 48.0 36 71.0 37 92.5 38 125.5 39 163.5 40 213.0 41 242.0 42 261.0 43 285.5 44 287.0 45 284.5 46 276.0 47 272.0 48 250.0 49 214.0 50 183.0 51 151.5 52 118.0 53 89.0 54 65.0 55 46.5 56 37.0 57 27.5 58 20.5 59 16.5 60 14.0 61 9.0 62 7.0 63 5.5 64 3.0 65 1.5 66 0.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.01 20-24 0.02 25-29 0.034999999999999996 30-34 0.03 35-39 0.045 40-44 0.06 45-49 0.04 50-54 0.05 55-59 0.005 60-64 0.034999999999999996 65-69 0.03 70-74 0.03 75-79 0.034999999999999996 80-84 0.05 85-89 0.015 90-94 0.04 95-99 0.05 100-104 0.02 105-109 0.06 110-114 0.06 115-119 0.04 120-124 0.04 125-129 0.03 130-134 0.11 135-139 0.055 140-144 0.06 145-149 0.08499999999999999 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5284348263714143 1.05 3 0.025163563160543533 0.075 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.07500000000000001 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.1125 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.25 0.0 0.0 0.0 0.0 122-123 0.2625 0.0 0.0 0.0 0.0 124-125 0.32499999999999996 0.0 0.0 0.0 0.0 126-127 0.38749999999999996 0.0 0.0 0.0 0.0 128-129 0.4625 0.0 0.0 0.0 0.0 130-131 0.525 0.0 0.0 0.0 0.0 132-133 0.65 0.0 0.0 0.0 0.0 134-135 0.75 0.0 0.0 0.0 0.0 136-137 0.85 0.0 0.0 0.0 0.0 138-139 0.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCAAG 10 0.0065789125 146.81013 145 GAGGCCA 10 0.0068343505 144.975 4 GGCTCAA 10 0.0068343505 144.975 1 >>END_MODULE Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898743 spots for SRR7169095.sra Written 898743 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra Read 898735 spots for SRR7169095.sra Written 898735 spots for SRR7169095.sra SRR ids: ['SRR7169095.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yl8830ys SRR7169095.sra spots: 17974708 blocks: [[1, 898735], [898736, 1797470], [1797471, 2696205], [2696206, 3594940], [3594941, 4493675], [4493676, 5392410], [5392411, 6291145], [6291146, 7189880], [7189881, 8088615], [8088616, 8987350], [8987351, 9886085], [9886086, 10784820], [10784821, 11683555], [11683556, 12582290], [12582291, 13481025], [13481026, 14379760], [14379761, 15278495], [15278496, 16177230], [16177231, 17075965], [17075966, 17974708]] SRR7169095 file size 6069338 SRR7169095 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169095 SRR7169095_1.fastq SRR7169095_2.fastq Input file: SRR7169095_1.fastq Paired file: SRR7169095_2.fastq trimmed: SRR7169095-trimmed-pair1.fastq, SRR7169095-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:59:10 2025 >> started Mon Feb 10 20:59:35 2025 >> done (25.518s) 17974708 read pairs processed; of these: 18174 ( 0.10%) short read pairs filtered out after trimming by size control 12489 ( 0.07%) empty read pairs filtered out after trimming by size control 17944045 (99.83%) read pairs available; of these: 8588216 (47.86%) trimmed read pairs available after processing 9355829 (52.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 8 0.00% 20 2 0.00% 21 4 0.00% 22 3 0.00% 23 5 0.00% 24 3 0.00% 25 5 0.00% 26 4 0.00% 27 4 0.00% 28 6 0.00% 29 2 0.00% 30 10 0.00% 31 7 0.00% 32 1 0.00% 33 1 0.00% 34 7 0.00% 35 5 0.00% 36 12 0.00% 37 8 0.00% 38 9 0.00% 39 12 0.00% 40 14 0.00% 41 9 0.00% 42 18 0.00% 43 23 0.00% 44 28 0.00% 45 28 0.00% 46 23 0.00% 47 26 0.00% 48 27 0.00% 49 26 0.00% 50 29 0.00% 51 19 0.00% 52 36 0.00% 53 44 0.00% 54 43 0.00% 55 49 0.00% 56 61 0.00% 57 66 0.00% 58 69 0.00% 59 71 0.00% 60 87 0.00% 61 75 0.00% 62 113 0.00% 63 132 0.00% 64 133 0.00% 65 160 0.00% 66 244 0.00% 67 196 0.00% 68 158 0.00% 69 252 0.00% 70 268 0.00% 71 263 0.00% 72 290 0.00% 73 337 0.00% 74 339 0.00% 75 338 0.00% 76 356 0.00% 77 453 0.00% 78 483 0.00% 79 557 0.00% 80 634 0.00% 81 692 0.00% 82 805 0.00% 83 1004 0.01% 84 1876 0.01% 85 2371 0.01% 86 2394 0.01% 87 2512 0.01% 88 2563 0.01% 89 2542 0.01% 90 2660 0.01% 91 2865 0.02% 92 2954 0.02% 93 3075 0.02% 94 3232 0.02% 95 3460 0.02% 96 3722 0.02% 97 4002 0.02% 98 4124 0.02% 99 4430 0.02% 100 4795 0.03% 101 5117 0.03% 102 5571 0.03% 103 5816 0.03% 104 6341 0.04% 105 6840 0.04% 106 7068 0.04% 107 7672 0.04% 108 8128 0.05% 109 8504 0.05% 110 9088 0.05% 111 9666 0.05% 112 10278 0.06% 113 10927 0.06% 114 11876 0.07% 115 12598 0.07% 116 13186 0.07% 117 14305 0.08% 118 15063 0.08% 119 15718 0.09% 120 16880 0.09% 121 17735 0.10% 122 19177 0.11% 123 20487 0.11% 124 22211 0.12% 125 23415 0.13% 126 25505 0.14% 127 27532 0.15% 128 29259 0.16% 129 31385 0.17% 130 34204 0.19% 131 36855 0.21% 132 39836 0.22% 133 43368 0.24% 134 47759 0.27% 135 52287 0.29% 136 57148 0.32% 137 63749 0.36% 138 70636 0.39% 139 79896 0.45% 140 88058 0.49% 141 101281 0.56% 142 119106 0.66% 143 135674 0.76% 144 163784 0.91% 145 204673 1.14% 146 264990 1.48% 147 362751 2.02% 148 554464 3.09% 149 1095503 6.11% 150 4492070 25.03% 151 9355829 52.14% 17944045 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=34 prefix-density=0.24 prefix-fanout=2.4 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=29 fanout-score=65.12 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=12.2 sequence=CACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=8.86 fanout-score-rank=15 prefix-density=0.34 prefix-fanout=5.7 sequence=TCAATGCTGTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=61.80 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.7 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7169095 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:00:23 Started mapping on | Feb 10 21:00:23 Finished on | Feb 10 21:02:14 Mapping speed, Million of reads per hour | 581.97 Number of input reads | 17944045 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16871267 Uniquely mapped reads % | 94.02% Average mapped length | 296.74 Number of splices: Total | 15849013 Number of splices: Annotated (sjdb) | 15602347 Number of splices: GT/AG | 15632066 Number of splices: GC/AG | 172757 Number of splices: AT/AC | 12860 Number of splices: Non-canonical | 31330 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 310151 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 126657 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.37% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 781749 781749 781749 N_multimapping 310151 310151 310151 N_noFeature 317683 16655272 400449 N_ambiguous 201478 1404 67218 UnstrandedReadsAssigned:16352106 PositiveStrandReadsAssigned:214591 NegativeStrandReadsAssigned:16403600 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169095 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169095-trimmed-pair1.fastq SRR7169095-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,944,045 reads, 16,361,026 reads pseudoaligned [quant] estimated average fragment length: 274.776 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR7169095.ke.tsv 34699 SRR7169095.se.tsv 87100 total ==> SRR7169095.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.22 313 9.60513 Potri.005G024800.1.v4.1 1035 761.224 51 3.58607 Potri.004G059700.1.v4.1 961 687.268 1 0.0778817 Potri.007G009000.2.v4.1 1416 1142.22 0 0 Potri.003G141000.2.v4.1 2943 2669.22 276.061 5.53581 Potri.016G087400.1.v4.1 270 59.5185 1491 1340.87 Potri.015G069301.1.v4.1 564 296.204 0 0 Potri.010G195200.1.v4.1 1773 1499.22 6 0.214213 Potri.012G127500.1.v4.1 977 703.241 5913 450.054 ==> SRR7169095.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1470 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 361 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7169095 completed mapping pipeline successfully