Starting /dee2/code/volunteer_pipeline.sh SRR7169096 current disk space = 3056946266112 free memory = 1506968652 SRR7169096 SRAfilesize 5c7162a6dd2f90ad5adbb335f95e870d SRR7169096.sra SRR7169096.sra file validated SRR7169096 is paired end SRR7169096 is conventional basespace SRR7169096 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169096_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9395 34.0 33.0 34.0 33.0 34.0 2 33.36275 34.0 33.0 34.0 33.0 34.0 3 33.426 34.0 34.0 34.0 33.0 34.0 4 33.4265 34.0 34.0 34.0 33.0 34.0 5 33.425 34.0 34.0 34.0 33.0 34.0 6 36.896 38.0 37.0 38.0 35.0 38.0 7 37.19475 38.0 38.0 38.0 36.0 38.0 8 37.28425 38.0 38.0 38.0 36.0 38.0 9 37.37175 38.0 38.0 38.0 37.0 38.0 10-14 37.343849999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.311099999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.24555 38.0 38.0 38.0 36.6 38.0 25-29 37.1579 38.0 38.0 38.0 36.2 38.0 30-34 37.181149999999995 38.0 38.0 38.0 36.0 38.0 35-39 37.0406 38.0 38.0 38.0 36.0 38.0 40-44 36.67105 38.0 38.0 38.0 34.2 38.0 45-49 36.52695 38.0 38.0 38.0 34.0 38.0 50-54 36.351099999999995 38.0 37.0 38.0 33.8 38.0 55-59 36.27765 38.0 37.0 38.0 33.2 38.0 60-64 36.24205 38.0 37.0 38.0 33.0 38.0 65-69 36.172900000000006 38.0 37.0 38.0 33.0 38.0 70-74 36.0663 38.0 37.0 38.0 32.8 38.0 75-79 35.9828 38.0 37.0 38.0 32.4 38.0 80-84 35.83675 38.0 37.0 38.0 31.4 38.0 85-89 35.632999999999996 38.0 36.6 38.0 30.2 38.0 90-94 35.41555 38.0 36.0 38.0 29.0 38.0 95-99 35.19865 38.0 36.0 38.0 29.0 38.0 100-104 34.916 38.0 35.8 38.0 27.8 38.0 105-109 34.62625 38.0 35.0 38.0 26.4 38.0 110-114 34.402550000000005 38.0 34.8 38.0 25.0 38.0 115-119 34.041599999999995 38.0 34.0 38.0 22.6 38.0 120-124 33.7312 38.0 34.0 38.0 21.0 38.0 125-129 33.21405 38.0 33.6 38.0 15.0 38.0 130-134 32.784000000000006 37.8 33.0 38.0 15.0 38.0 135-139 32.3902 37.2 32.6 38.0 14.8 38.0 140-144 31.825100000000003 36.0 31.8 38.0 14.0 38.0 145-149 30.901549999999997 36.0 31.0 38.0 8.8 38.0 150-151 26.907125 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 1.0 14 3.0 15 3.0 16 4.0 17 8.0 18 7.0 19 12.0 20 18.0 21 9.0 22 18.0 23 18.0 24 27.0 25 23.0 26 29.0 27 48.0 28 34.0 29 63.0 30 63.0 31 92.0 32 131.0 33 177.0 34 264.0 35 500.0 36 1034.0 37 1409.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.35699797160243 13.36206896551724 10.344827586206897 32.936105476673426 2 24.725 14.249999999999998 31.525 29.5 3 19.400000000000002 20.775 26.8 33.025 4 22.85 26.625 25.025 25.5 5 22.8 31.15 24.075 21.975 6 21.425 35.025 23.375 20.175 7 15.8 28.975 38.3 16.925 8 18.775 27.125 28.925 25.174999999999997 9 18.05 24.95 32.975 24.025 10-14 19.73 30.349999999999998 26.71 23.21 15-19 19.67 29.595 27.029999999999998 23.705000000000002 20-24 20.055 29.104999999999997 27.52 23.32 25-29 20.085 28.965000000000003 27.345000000000002 23.605 30-34 20.4 29.275000000000002 27.02 23.305 35-39 20.28 28.02 27.29 24.41 40-44 20.195 29.005 27.525 23.275000000000002 45-49 20.305 28.134999999999998 27.884999999999998 23.674999999999997 50-54 20.36 28.720000000000002 27.51 23.41 55-59 20.78 28.865000000000002 26.634999999999998 23.72 60-64 20.005 28.605000000000004 27.52 23.87 65-69 19.905 28.189999999999998 27.73 24.175 70-74 19.56 28.84 27.27 24.33 75-79 20.52 28.15 27.389999999999997 23.94 80-84 19.915 28.63 27.505000000000003 23.95 85-89 19.785 28.63 27.755000000000003 23.830000000000002 90-94 20.465 29.099999999999998 26.755000000000003 23.68 95-99 20.66 27.805000000000003 27.05 24.485 100-104 20.630000000000003 28.575 27.005000000000003 23.79 105-109 20.365 28.705000000000002 27.125 23.805 110-114 20.349999999999998 29.005 27.11 23.535 115-119 20.695 28.785 26.724999999999998 23.794999999999998 120-124 20.685000000000002 28.65 26.810000000000002 23.855 125-129 20.73 28.02 27.065 24.185000000000002 130-134 20.979999999999997 27.91 27.450000000000003 23.66 135-139 20.446022301115054 28.176408820441022 27.231361568078405 24.14620731036552 140-144 20.200000000000003 28.360000000000003 27.36 24.08 145-149 20.645 28.465 27.12 23.77 150-151 20.549999999999997 27.625 27.375 24.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.5 18 3.0 19 2.0 20 1.0 21 1.5 22 1.5 23 3.0 24 3.0 25 3.5 26 5.0 27 5.0 28 10.0 29 13.0 30 15.0 31 24.5 32 28.5 33 40.5 34 53.0 35 65.5 36 87.0 37 101.5 38 115.0 39 151.0 40 193.5 41 213.5 42 225.0 43 254.0 44 279.5 45 274.0 46 257.0 47 250.0 48 240.5 49 214.0 50 180.0 51 143.5 52 115.0 53 101.0 54 83.5 55 60.5 56 47.5 57 33.5 58 25.5 59 22.5 60 14.0 61 6.5 62 5.5 63 5.5 64 4.5 65 4.0 66 2.5 67 1.0 68 2.5 69 3.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2125 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.3875 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.675 0.0 0.0 0.0 0.0 128-129 0.7375 0.0 0.0 0.0 0.0 130-131 0.8 0.0 0.0 0.0 0.0 132-133 0.875 0.0 0.0 0.0 0.0 134-135 0.9874999999999999 0.0 0.0 0.0 0.0 136-137 1.0375 0.0 0.0 0.0 0.0 138-139 1.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGAAG 10 0.006830828 145.0 3 >>END_MODULE SRR7169096 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169096_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6195 33.0 33.0 34.0 32.0 34.0 2 32.733 33.0 33.0 34.0 32.0 34.0 3 32.79725 34.0 33.0 34.0 32.0 34.0 4 32.72525 34.0 33.0 34.0 32.0 34.0 5 32.7565 34.0 33.0 34.0 32.0 34.0 6 36.8765 38.0 38.0 38.0 36.0 38.0 7 36.83 38.0 38.0 38.0 36.0 38.0 8 36.8585 38.0 38.0 38.0 36.0 38.0 9 36.764 38.0 38.0 38.0 36.0 38.0 10-14 36.809799999999996 38.0 38.0 38.0 36.0 38.0 15-19 36.7216 38.0 38.0 38.0 36.0 38.0 20-24 36.758050000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.73825 38.0 38.0 38.0 36.0 38.0 30-34 36.68085 38.0 38.0 38.0 36.0 38.0 35-39 36.591899999999995 38.0 38.0 38.0 35.6 38.0 40-44 36.57255 38.0 38.0 38.0 35.8 38.0 45-49 36.5053 38.0 38.0 38.0 35.6 38.0 50-54 36.5432 38.0 38.0 38.0 35.6 38.0 55-59 36.47155 38.0 38.0 38.0 35.4 38.0 60-64 36.402 38.0 38.0 38.0 34.8 38.0 65-69 36.36185 38.0 38.0 38.0 34.8 38.0 70-74 36.3493 38.0 38.0 38.0 34.4 38.0 75-79 36.170300000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.1711 38.0 38.0 38.0 34.0 38.0 85-89 35.97615 38.0 38.0 38.0 33.6 38.0 90-94 35.9769 38.0 38.0 38.0 34.0 38.0 95-99 35.84315 38.0 38.0 38.0 33.2 38.0 100-104 35.7174 38.0 38.0 38.0 32.2 38.0 105-109 35.435950000000005 38.0 37.4 38.0 30.8 38.0 110-114 35.342850000000006 38.0 37.0 38.0 30.6 38.0 115-119 35.24845 38.0 37.0 38.0 30.4 38.0 120-124 35.082499999999996 38.0 37.0 38.0 28.4 38.0 125-129 34.6591 38.0 36.2 38.0 27.2 38.0 130-134 34.38415 38.0 36.0 38.0 25.0 38.0 135-139 34.05705 38.0 35.8 38.0 23.0 38.0 140-144 33.72725 38.0 35.0 38.0 19.6 38.0 145-149 32.8611 38.0 35.0 38.0 11.6 38.0 150-151 29.579 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 4.0 4 3.0 5 6.0 6 4.0 7 4.0 8 5.0 9 1.0 10 6.0 11 1.0 12 3.0 13 4.0 14 2.0 15 5.0 16 7.0 17 8.0 18 7.0 19 9.0 20 12.0 21 10.0 22 16.0 23 22.0 24 23.0 25 25.0 26 32.0 27 23.0 28 24.0 29 32.0 30 39.0 31 45.0 32 84.0 33 84.0 34 129.0 35 222.0 36 453.0 37 2627.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.65 24.349999999999998 13.900000000000002 24.099999999999998 2 29.175 25.3 26.974999999999998 18.55 3 21.6 29.299999999999997 31.15 17.95 4 23.325000000000003 33.925 23.0 19.75 5 25.174999999999997 34.125 23.1 17.599999999999998 6 21.3 36.5 22.775000000000002 19.425 7 20.724999999999998 22.825 37.35 19.1 8 23.5 24.65 26.875 24.975 9 21.8 25.074999999999996 29.025000000000002 24.099999999999998 10-14 22.915 28.92 26.96 21.205 15-19 23.380000000000003 28.34 26.875 21.404999999999998 20-24 22.895 28.115000000000002 27.665 21.325 25-29 23.64 28.205000000000002 27.229999999999997 20.925 30-34 23.815 27.775 27.134999999999998 21.275 35-39 23.724999999999998 27.839999999999996 27.125 21.310000000000002 40-44 23.59 27.58 27.715 21.115000000000002 45-49 23.119999999999997 27.855 27.384999999999998 21.64 50-54 23.605 28.415000000000003 27.425 20.555 55-59 23.785 27.145000000000003 27.584999999999997 21.485000000000003 60-64 23.335 27.575 27.87 21.22 65-69 23.5008752188047 27.54688672168042 27.85696424106027 21.09527381845461 70-74 23.66183091545773 27.943971985993 27.548774387193596 20.845422711355678 75-79 24.2864296444667 27.57135703555333 27.681522283425135 20.46069103655483 80-84 23.995 28.044999999999998 26.87 21.09 85-89 24.385 27.779999999999998 27.265 20.57 90-94 24.36 26.555 27.79 21.295 95-99 24.11 27.38 27.834999999999997 20.674999999999997 100-104 24.375 27.3 27.22 21.105 105-109 23.89 27.96 27.445000000000004 20.705000000000002 110-114 24.085 28.02 27.685 20.21 115-119 24.435000000000002 27.685 27.365000000000002 20.515 120-124 24.240000000000002 27.169999999999998 28.225 20.365 125-129 24.435000000000002 27.48 27.705000000000002 20.380000000000003 130-134 23.935000000000002 27.77 27.415 20.880000000000003 135-139 24.32 27.700000000000003 27.66 20.32 140-144 24.41 27.595 27.515 20.48 145-149 24.913477453980036 27.938004714851782 26.809449766765308 20.33906806440287 150-151 24.118831822759315 28.650553877139977 26.913393756294056 20.31722054380665 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 2.0 26 1.5 27 3.0 28 3.5 29 1.5 30 3.5 31 9.0 32 14.5 33 20.5 34 35.0 35 41.0 36 62.5 37 108.5 38 133.5 39 148.0 40 178.5 41 207.5 42 234.5 43 272.5 44 284.0 45 282.5 46 290.5 47 286.0 48 264.0 49 229.0 50 197.0 51 174.5 52 144.5 53 99.5 54 63.0 55 49.0 56 39.5 57 33.5 58 26.5 59 17.0 60 10.5 61 6.0 62 4.5 63 4.0 64 3.5 65 1.5 66 1.5 67 1.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.025 70-74 0.05 75-79 0.15 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.315 150-151 0.7000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2125 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.6000000000000001 0.0 0.0 0.0 0.0 126-127 0.725 0.0 0.0 0.0 0.0 128-129 0.7875000000000001 0.0 0.0 0.0 0.0 130-131 0.85 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 1.0625 0.0 0.0 0.0 0.0 136-137 1.1125 0.0 0.0 0.0 0.0 138-139 1.2374999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825651 spots for SRR7169096.sra Written 825651 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra Read 825643 spots for SRR7169096.sra Written 825643 spots for SRR7169096.sra SRR ids: ['SRR7169096.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y_4vkenu SRR7169096.sra spots: 16512868 blocks: [[1, 825643], [825644, 1651286], [1651287, 2476929], [2476930, 3302572], [3302573, 4128215], [4128216, 4953858], [4953859, 5779501], [5779502, 6605144], [6605145, 7430787], [7430788, 8256430], [8256431, 9082073], [9082074, 9907716], [9907717, 10733359], [10733360, 11559002], [11559003, 12384645], [12384646, 13210288], [13210289, 14035931], [14035932, 14861574], [14861575, 15687217], [15687218, 16512868]] SRR7169096 file size 5573968 SRR7169096 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169096 SRR7169096_1.fastq SRR7169096_2.fastq Input file: SRR7169096_1.fastq Paired file: SRR7169096_2.fastq trimmed: SRR7169096-trimmed-pair1.fastq, SRR7169096-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:24:47 2025 >> started Mon Feb 10 21:25:04 2025 >> done (16.980s) 16512868 read pairs processed; of these: 25195 ( 0.15%) short read pairs filtered out after trimming by size control 16964 ( 0.10%) empty read pairs filtered out after trimming by size control 16470709 (99.74%) read pairs available; of these: 7901711 (47.97%) trimmed read pairs available after processing 8568998 (52.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 10 0.00% 21 7 0.00% 22 4 0.00% 23 8 0.00% 24 4 0.00% 25 4 0.00% 26 8 0.00% 27 18 0.00% 28 8 0.00% 29 8 0.00% 30 14 0.00% 31 12 0.00% 32 14 0.00% 33 9 0.00% 34 15 0.00% 35 10 0.00% 36 16 0.00% 37 11 0.00% 38 24 0.00% 39 20 0.00% 40 20 0.00% 41 22 0.00% 42 22 0.00% 43 24 0.00% 44 24 0.00% 45 30 0.00% 46 40 0.00% 47 35 0.00% 48 40 0.00% 49 54 0.00% 50 43 0.00% 51 53 0.00% 52 53 0.00% 53 63 0.00% 54 75 0.00% 55 66 0.00% 56 70 0.00% 57 84 0.00% 58 98 0.00% 59 82 0.00% 60 113 0.00% 61 122 0.00% 62 127 0.00% 63 141 0.00% 64 145 0.00% 65 169 0.00% 66 208 0.00% 67 232 0.00% 68 244 0.00% 69 278 0.00% 70 296 0.00% 71 327 0.00% 72 337 0.00% 73 375 0.00% 74 383 0.00% 75 448 0.00% 76 506 0.00% 77 558 0.00% 78 645 0.00% 79 726 0.00% 80 774 0.00% 81 913 0.01% 82 1024 0.01% 83 1198 0.01% 84 2406 0.01% 85 3012 0.02% 86 2953 0.02% 87 3123 0.02% 88 3249 0.02% 89 3184 0.02% 90 3181 0.02% 91 3258 0.02% 92 3560 0.02% 93 3682 0.02% 94 3894 0.02% 95 4103 0.02% 96 4404 0.03% 97 4669 0.03% 98 4991 0.03% 99 5099 0.03% 100 5429 0.03% 101 5734 0.03% 102 6111 0.04% 103 6528 0.04% 104 6919 0.04% 105 7527 0.05% 106 7826 0.05% 107 8381 0.05% 108 8820 0.05% 109 9328 0.06% 110 9735 0.06% 111 10416 0.06% 112 11090 0.07% 113 11758 0.07% 114 12668 0.08% 115 13530 0.08% 116 14303 0.09% 117 15167 0.09% 118 16068 0.10% 119 16857 0.10% 120 17721 0.11% 121 18727 0.11% 122 20098 0.12% 123 21250 0.13% 124 23189 0.14% 125 24703 0.15% 126 26280 0.16% 127 28211 0.17% 128 30147 0.18% 129 32332 0.20% 130 34934 0.21% 131 37657 0.23% 132 40943 0.25% 133 44626 0.27% 134 47704 0.29% 135 52097 0.32% 136 57011 0.35% 137 63286 0.38% 138 70548 0.43% 139 78820 0.48% 140 87757 0.53% 141 96434 0.59% 142 108553 0.66% 143 125245 0.76% 144 148634 0.90% 145 182754 1.11% 146 234176 1.42% 147 331144 2.01% 148 504852 3.07% 149 978595 5.94% 150 4058802 24.64% 151 8568998 52.03% 16470709 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=35 prefix-density=0.22 prefix-fanout=2.5 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=86.57 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.4 sequence=AAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTAAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTATTATCAGTACTCATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=41 prefix-density=0.23 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=39 fanout-score=27.02 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=9.3 sequence=CTTCTCTTCTTTT SRR7169096 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:25:49 Started mapping on | Feb 10 21:25:49 Finished on | Feb 10 21:27:23 Mapping speed, Million of reads per hour | 630.79 Number of input reads | 16470709 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15273451 Uniquely mapped reads % | 92.73% Average mapped length | 296.28 Number of splices: Total | 14173728 Number of splices: Annotated (sjdb) | 13945801 Number of splices: GT/AG | 13978626 Number of splices: GC/AG | 156921 Number of splices: AT/AC | 11298 Number of splices: Non-canonical | 26883 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264903 % of reads mapped to multiple loci | 1.61% Number of reads mapped to too many loci | 39659 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.37% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 957372 957372 957372 N_multimapping 264903 264903 264903 N_noFeature 295827 15084607 366742 N_ambiguous 180625 883 62136 UnstrandedReadsAssigned:14796999 PositiveStrandReadsAssigned:187961 NegativeStrandReadsAssigned:14844573 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169096 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169096-trimmed-pair1.fastq SRR7169096-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,470,709 reads, 14,762,708 reads pseudoaligned [quant] estimated average fragment length: 282.582 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,023 rounds 52401 SRR7169096.ke.tsv 34699 SRR7169096.se.tsv 87100 total ==> SRR7169096.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.42 299 10.4503 Potri.005G024800.1.v4.1 1035 753.418 40 3.22208 Potri.004G059700.1.v4.1 961 679.457 1 0.0893203 Potri.007G009000.2.v4.1 1416 1134.42 0 0 Potri.003G141000.2.v4.1 2943 2661.42 279 6.36214 Potri.016G087400.1.v4.1 270 58.6548 1483 1534.44 Potri.015G069301.1.v4.1 564 289.516 0 0 Potri.010G195200.1.v4.1 1773 1491.42 62 2.52293 Potri.012G127500.1.v4.1 977 695.418 4600 401.443 ==> SRR7169096.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1830 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 251 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169096 completed mapping pipeline successfully