Starting /dee2/code/volunteer_pipeline.sh SRR7169097 current disk space = 3056903520256 free memory = 1117299508 SRR7169097 SRAfilesize 6f1d36fe03bbbf4eac9ba92360abd976 SRR7169097.sra SRR7169097.sra file validated SRR7169097 is paired end SRR7169097 is conventional basespace SRR7169097 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169097_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6835 34.0 33.0 34.0 32.0 34.0 2 33.28825 34.0 33.0 34.0 33.0 34.0 3 33.2755 34.0 33.0 34.0 33.0 34.0 4 33.41375 34.0 33.0 34.0 33.0 34.0 5 33.4365 34.0 33.0 34.0 33.0 34.0 6 37.10725 38.0 37.0 38.0 36.0 38.0 7 37.36225 38.0 38.0 38.0 37.0 38.0 8 37.4505 38.0 38.0 38.0 37.0 38.0 9 37.4025 38.0 38.0 38.0 37.0 38.0 10-14 37.0767 38.0 38.0 38.0 36.0 38.0 15-19 37.06155 38.0 38.0 38.0 36.0 38.0 20-24 37.3056 38.0 38.0 38.0 36.8 38.0 25-29 37.1693 38.0 38.0 38.0 36.4 38.0 30-34 37.180600000000005 38.0 38.0 38.0 36.4 38.0 35-39 37.169799999999995 38.0 38.0 38.0 36.4 38.0 40-44 37.02165 38.0 38.0 38.0 35.8 38.0 45-49 36.79825 38.0 38.0 38.0 34.8 38.0 50-54 36.60795 38.0 38.0 38.0 34.2 38.0 55-59 36.2027 38.0 37.0 38.0 32.8 38.0 60-64 36.519999999999996 38.0 37.6 38.0 33.8 38.0 65-69 36.277699999999996 38.0 37.4 38.0 33.0 38.0 70-74 36.101299999999995 38.0 37.0 38.0 32.0 38.0 75-79 36.08155 38.0 37.0 38.0 32.6 38.0 80-84 36.07515 38.0 37.0 38.0 33.0 38.0 85-89 35.78575 38.0 36.8 38.0 31.0 38.0 90-94 35.59105 38.0 36.4 38.0 30.2 38.0 95-99 35.65015000000001 38.0 36.4 38.0 30.6 38.0 100-104 35.2248 38.0 36.0 38.0 28.2 38.0 105-109 34.4499 38.0 34.8 38.0 24.0 38.0 110-114 34.750699999999995 38.0 34.8 38.0 26.8 38.0 115-119 34.89399999999999 38.0 35.2 38.0 27.4 38.0 120-124 34.5374 38.0 35.0 38.0 26.0 38.0 125-129 33.78495 38.0 34.0 38.0 21.0 38.0 130-134 34.04845 38.0 34.0 38.0 23.0 38.0 135-139 33.6683 38.0 34.0 38.0 21.0 38.0 140-144 32.5329 37.4 33.2 38.0 15.4 38.0 145-149 31.88115 36.6 32.6 38.0 11.4 38.0 150-151 28.11175 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 0.0 13 2.0 14 4.0 15 3.0 16 2.0 17 3.0 18 4.0 19 6.0 20 9.0 21 10.0 22 13.0 23 12.0 24 21.0 25 21.0 26 21.0 27 39.0 28 41.0 29 55.0 30 85.0 31 89.0 32 106.0 33 187.0 34 247.0 35 417.0 36 886.0 37 1715.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.330861672206595 13.040143185885963 8.667859882383022 31.96113525952442 2 24.5 14.174999999999999 31.674999999999997 29.65 3 20.925 17.65 26.5 34.925 4 23.575 27.200000000000003 23.175 26.05 5 22.175 31.1 23.75 22.975 6 18.25 35.775 24.7 21.275 7 14.674999999999999 28.1 40.175 17.05 8 17.275 26.424999999999997 30.275000000000002 26.025 9 15.725 25.974999999999998 34.2 24.099999999999998 10-14 19.900000000000002 30.830000000000002 26.83 22.439999999999998 15-19 19.74 28.884999999999998 27.67 23.705000000000002 20-24 19.355 29.89 27.415 23.34 25-29 19.765 29.34 27.445000000000004 23.45 30-34 19.994999999999997 29.12 27.345000000000002 23.54 35-39 19.255 29.03 27.79 23.925 40-44 19.925 29.25 27.55 23.275000000000002 45-49 20.265 28.52 27.485 23.73 50-54 19.85 29.14 27.439999999999998 23.57 55-59 20.34 28.595 27.700000000000003 23.365 60-64 20.380000000000003 29.049999999999997 27.029999999999998 23.54 65-69 20.825 29.110000000000003 26.965 23.1 70-74 20.28710048516981 28.86010103536238 27.33456709848447 23.518231380983345 75-79 19.407911186678 28.779316897534628 27.89418412761914 23.918587788168225 80-84 19.992998949842477 28.58428764314647 28.294244136620495 23.128469270390557 85-89 20.31 28.294999999999998 27.43 23.965 90-94 20.072007200720073 28.657865786578657 27.437743774377438 23.832383238323832 95-99 20.275000000000002 28.535 27.245 23.945 100-104 20.97104855242762 28.22641132056603 27.84639231961598 22.95614780739037 105-109 20.205000000000002 27.785 28.265 23.745 110-114 20.344068813762753 28.49569913982797 27.385477095419088 23.7747549509902 115-119 20.418062709406414 28.254238135720357 27.154073110966642 24.173626043906584 120-124 20.038005700855127 28.45926889033355 27.704155623343503 23.798569785467823 125-129 20.73829531812725 27.62605042016807 27.78611444577831 23.84953981592637 130-134 20.794999999999998 27.860000000000003 27.889999999999997 23.455000000000002 135-139 21.05 27.935 27.339999999999996 23.674999999999997 140-144 20.96104805240262 28.351417570878546 27.13635681784089 23.551177558877946 145-149 21.091054552727638 27.91639581979099 27.531376568828442 23.461173058652932 150-151 20.365045630703836 27.84098012251531 28.178522315289413 23.615451931491435 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 2.5 24 3.5 25 2.5 26 2.5 27 8.0 28 11.5 29 15.5 30 21.0 31 27.5 32 29.5 33 39.0 34 61.0 35 71.5 36 95.5 37 124.0 38 132.5 39 147.0 40 190.0 41 227.0 42 243.0 43 256.0 44 267.5 45 263.0 46 255.5 47 258.5 48 232.0 49 207.0 50 182.0 51 143.5 52 110.5 53 90.0 54 79.0 55 57.0 56 35.0 57 23.5 58 17.5 59 14.5 60 15.5 61 9.5 62 2.5 63 3.5 64 4.0 65 2.0 66 1.0 67 1.0 68 1.5 69 2.5 70 1.5 71 0.0 72 1.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.034999999999999996 75-79 0.015 80-84 0.015 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.02 115-119 0.015 120-124 0.015 125-129 0.04 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.005 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.4273504273504274 0.8500000000000001 3 0.025138260432378077 0.075 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.42500000000000004 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.6 0.0 0.0 0.0 0.0 128-129 0.7875 0.0 0.0 0.0 0.0 130-131 0.9750000000000001 0.0 0.0 0.0 0.0 132-133 1.15 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138-139 1.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACTGGA 10 0.006905315 144.475 7 >>END_MODULE SRR7169097 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169097_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73475 33.0 33.0 34.0 32.0 34.0 2 32.97125 34.0 33.0 34.0 32.0 34.0 3 32.881 34.0 33.0 34.0 32.0 34.0 4 32.88925 34.0 33.0 34.0 32.0 34.0 5 32.914 34.0 33.0 34.0 32.0 34.0 6 37.0475 38.0 38.0 38.0 36.0 38.0 7 36.948 38.0 38.0 38.0 36.0 38.0 8 37.06025 38.0 38.0 38.0 37.0 38.0 9 36.74525 38.0 38.0 38.0 36.0 38.0 10-14 36.86344999999999 38.0 38.0 38.0 35.8 38.0 15-19 36.8988 38.0 38.0 38.0 36.0 38.0 20-24 36.81835 38.0 38.0 38.0 35.8 38.0 25-29 36.9452 38.0 38.0 38.0 36.0 38.0 30-34 36.93285 38.0 38.0 38.0 36.0 38.0 35-39 36.514849999999996 38.0 38.0 38.0 34.8 38.0 40-44 36.552299999999995 38.0 38.0 38.0 34.8 38.0 45-49 36.73665 38.0 38.0 38.0 35.6 38.0 50-54 36.82715 38.0 38.0 38.0 36.0 38.0 55-59 36.63355 38.0 38.0 38.0 35.2 38.0 60-64 36.73545 38.0 38.0 38.0 35.8 38.0 65-69 36.62065 38.0 38.0 38.0 35.0 38.0 70-74 36.252750000000006 38.0 38.0 38.0 33.6 38.0 75-79 36.3517 38.0 38.0 38.0 34.0 38.0 80-84 36.32335 38.0 38.0 38.0 34.0 38.0 85-89 35.98205 38.0 37.8 38.0 32.6 38.0 90-94 35.9347 38.0 37.8 38.0 33.0 38.0 95-99 36.03975 38.0 38.0 38.0 33.0 38.0 100-104 35.955400000000004 38.0 37.8 38.0 33.0 38.0 105-109 35.61084999999999 38.0 37.0 38.0 31.0 38.0 110-114 35.3234 38.0 37.0 38.0 29.2 38.0 115-119 35.11985 38.0 36.4 38.0 28.0 38.0 120-124 35.2618 38.0 36.6 38.0 29.6 38.0 125-129 35.153200000000005 38.0 36.0 38.0 29.4 38.0 130-134 34.405699999999996 38.0 35.2 38.0 24.2 38.0 135-139 33.77645 38.0 34.8 38.0 20.6 38.0 140-144 33.931599999999996 38.0 34.8 38.0 22.6 38.0 145-149 33.471 38.0 34.8 38.0 18.6 38.0 150-151 29.989375000000003 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 2.0 5 3.0 6 7.0 7 3.0 8 0.0 9 2.0 10 0.0 11 2.0 12 5.0 13 2.0 14 5.0 15 1.0 16 2.0 17 6.0 18 8.0 19 10.0 20 3.0 21 8.0 22 18.0 23 15.0 24 16.0 25 24.0 26 26.0 27 34.0 28 32.0 29 41.0 30 68.0 31 66.0 32 71.0 33 129.0 34 155.0 35 253.0 36 550.0 37 2429.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.67805981402363 22.895199798944457 13.520985172153807 24.905755214878113 2 28.275 26.375 26.950000000000003 18.4 3 20.925 26.900000000000002 31.4 20.775 4 23.45 33.225 24.175 19.15 5 24.65 34.925 22.35 18.075 6 21.2 36.075 23.400000000000002 19.325 7 19.625 21.95 38.95 19.475 8 22.05 26.275 27.0 24.675 9 21.8 24.7 28.749999999999996 24.75 10-14 22.634526905381076 29.285857171434287 26.9503900780156 21.129225845169035 15-19 22.679535907181435 27.695539107821567 28.050610122024406 21.574314862972592 20-24 23.199639927985597 27.795559111822364 27.430486097219443 21.574314862972592 25-29 22.97107975582908 28.294806364455116 27.128990293205245 21.605123586510558 30-34 23.150047530895083 28.063241106719367 27.64296792915395 21.143743433231602 35-39 23.310489720374168 28.027612425591514 27.787504376969636 20.87439347706468 40-44 23.475823405746322 28.866753428771645 26.989688657523274 20.667734507958755 45-49 23.808094451948573 28.150482765521033 27.480114062734508 20.561308719795885 50-54 23.700405263421224 27.597938660129085 27.83309150948116 20.86856456696853 55-59 23.53117655882794 27.706385319265962 27.44637231861593 21.316065803290165 60-64 22.84027812515632 28.017607923565606 28.447801510679803 20.69431244059827 65-69 23.006503251625812 27.87393696848424 27.828914457228613 21.29064532266133 70-74 23.69092273068267 27.501875468867215 27.936984246061513 20.8702175543886 75-79 23.54559551798309 27.947576409384222 27.587414336451406 20.91941373618128 80-84 23.36986438472702 28.018815993594554 27.42330981334134 21.188009808337085 85-89 24.13982796559312 27.875575115023004 27.120424084816964 20.86417283456691 90-94 23.27047171227052 27.792506627982593 28.017607923565606 20.91941373618128 95-99 23.521465025517863 28.284799359551688 27.604323026118283 20.58941258881217 100-104 23.57353603040456 28.234235135270293 27.44911736760514 20.743111466720006 105-109 23.68131318186368 27.499749774797316 27.920128115303772 20.89880892803523 110-114 23.476128515664097 28.180362326093483 27.850065058552698 20.49344409968972 115-119 23.627995397468606 28.355595577567662 27.575166341487815 20.441242683475913 120-124 23.488220877307057 27.989796428750065 27.564647626669338 20.957335067273547 125-129 24.27335034268848 27.87533143228776 27.610185602081145 20.24113262294262 130-134 23.853165064102562 28.200120192307693 27.313701923076923 20.633012820512818 135-139 23.428428428428425 28.313313313313316 27.93793793793794 20.32032032032032 140-144 24.10531057610491 27.67405776064868 27.488863306471796 20.731768356774612 145-149 23.77615376914606 27.690459505456 27.815597156872563 20.717789568525376 150-151 24.809016906700062 28.227927363807137 27.075767063243582 19.887288666249216 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 0.5 23 0.0 24 0.5 25 1.0 26 2.0 27 3.0 28 4.0 29 5.5 30 8.5 31 10.5 32 16.0 33 24.5 34 36.5 35 56.0 36 81.0 37 105.5 38 122.0 39 158.5 40 202.0 41 236.5 42 262.0 43 278.0 44 287.0 45 283.5 46 279.5 47 271.0 48 244.5 49 208.0 50 185.0 51 156.0 52 115.0 53 91.5 54 73.0 55 46.5 56 35.0 57 31.5 58 22.5 59 15.0 60 7.5 61 5.0 62 6.0 63 5.0 64 5.0 65 5.0 66 2.5 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.02 15-19 0.02 20-24 0.02 25-29 0.06999999999999999 30-34 0.065 35-39 0.045 40-44 0.11 45-49 0.055 50-54 0.065 55-59 0.005 60-64 0.045 65-69 0.05 70-74 0.025 75-79 0.045 80-84 0.08499999999999999 85-89 0.02 90-94 0.045 95-99 0.06999999999999999 100-104 0.015 105-109 0.09 110-114 0.09 115-119 0.055 120-124 0.034999999999999996 125-129 0.055 130-134 0.16 135-139 0.1 140-144 0.105 145-149 0.11 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.42500000000000004 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.6 0.0 0.0 0.0 0.0 128-129 0.7875 0.0 0.0 0.0 0.0 130-131 0.9750000000000001 0.0 0.0 0.0 0.0 132-133 1.125 0.0 0.0 0.0 0.0 134-135 1.2625000000000002 0.0 0.0 0.0 0.0 136-137 1.3875000000000002 0.0 0.0 0.0 0.0 138-139 1.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGAAAT 10 0.006820425 145.05063 6 GCATCCT 10 0.007085229 143.2375 4 >>END_MODULE Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876406 spots for SRR7169097.sra Written 876406 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra Read 876403 spots for SRR7169097.sra Written 876403 spots for SRR7169097.sra SRR ids: ['SRR7169097.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o9xkqg7i SRR7169097.sra spots: 17528063 blocks: [[1, 876403], [876404, 1752806], [1752807, 2629209], [2629210, 3505612], [3505613, 4382015], [4382016, 5258418], [5258419, 6134821], [6134822, 7011224], [7011225, 7887627], [7887628, 8764030], [8764031, 9640433], [9640434, 10516836], [10516837, 11393239], [11393240, 12269642], [12269643, 13146045], [13146046, 14022448], [14022449, 14898851], [14898852, 15775254], [15775255, 16651657], [16651658, 17528063]] SRR7169097 file size 5917985 SRR7169097 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169097 SRR7169097_1.fastq SRR7169097_2.fastq Input file: SRR7169097_1.fastq Paired file: SRR7169097_2.fastq trimmed: SRR7169097-trimmed-pair1.fastq, SRR7169097-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:17:08 2025 >> started Mon Feb 10 21:17:27 2025 >> done (19.019s) 17528063 read pairs processed; of these: 16807 ( 0.10%) short read pairs filtered out after trimming by size control 9670 ( 0.06%) empty read pairs filtered out after trimming by size control 17501586 (99.85%) read pairs available; of these: 8444260 (48.25%) trimmed read pairs available after processing 9057326 (51.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 2 0.00% 20 3 0.00% 21 11 0.00% 22 8 0.00% 23 6 0.00% 24 6 0.00% 25 3 0.00% 26 8 0.00% 27 2 0.00% 28 5 0.00% 29 1 0.00% 30 2 0.00% 31 5 0.00% 32 6 0.00% 33 7 0.00% 34 7 0.00% 35 7 0.00% 36 8 0.00% 37 11 0.00% 38 12 0.00% 39 15 0.00% 40 17 0.00% 41 14 0.00% 42 14 0.00% 43 27 0.00% 44 26 0.00% 45 28 0.00% 46 32 0.00% 47 38 0.00% 48 17 0.00% 49 23 0.00% 50 40 0.00% 51 42 0.00% 52 25 0.00% 53 36 0.00% 54 39 0.00% 55 55 0.00% 56 64 0.00% 57 51 0.00% 58 88 0.00% 59 64 0.00% 60 94 0.00% 61 102 0.00% 62 100 0.00% 63 115 0.00% 64 182 0.00% 65 167 0.00% 66 235 0.00% 67 197 0.00% 68 187 0.00% 69 238 0.00% 70 262 0.00% 71 232 0.00% 72 308 0.00% 73 324 0.00% 74 319 0.00% 75 364 0.00% 76 373 0.00% 77 500 0.00% 78 556 0.00% 79 593 0.00% 80 670 0.00% 81 814 0.00% 82 868 0.00% 83 1083 0.01% 84 1804 0.01% 85 2419 0.01% 86 2449 0.01% 87 2642 0.02% 88 2784 0.02% 89 2913 0.02% 90 2927 0.02% 91 3007 0.02% 92 3061 0.02% 93 3294 0.02% 94 3476 0.02% 95 3545 0.02% 96 3888 0.02% 97 4172 0.02% 98 4364 0.02% 99 4681 0.03% 100 5081 0.03% 101 5431 0.03% 102 5684 0.03% 103 5999 0.03% 104 6353 0.04% 105 6943 0.04% 106 7321 0.04% 107 7989 0.05% 108 8264 0.05% 109 8757 0.05% 110 9351 0.05% 111 9872 0.06% 112 10476 0.06% 113 11280 0.06% 114 12154 0.07% 115 13162 0.08% 116 13928 0.08% 117 14768 0.08% 118 15711 0.09% 119 16237 0.09% 120 17093 0.10% 121 18275 0.10% 122 19427 0.11% 123 20681 0.12% 124 22475 0.13% 125 23810 0.14% 126 26104 0.15% 127 27489 0.16% 128 29565 0.17% 129 31675 0.18% 130 34153 0.20% 131 36858 0.21% 132 39876 0.23% 133 43937 0.25% 134 47502 0.27% 135 51892 0.30% 136 56933 0.33% 137 63042 0.36% 138 70637 0.40% 139 78946 0.45% 140 88255 0.50% 141 100311 0.57% 142 117874 0.67% 143 133689 0.76% 144 162744 0.93% 145 202020 1.15% 146 262255 1.50% 147 358944 2.05% 148 550084 3.14% 149 1080541 6.17% 150 4371222 24.98% 151 9057326 51.75% 17501586 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=36 prefix-density=0.24 prefix-fanout=2.0 sequence=GTTTATAAGGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=227.39 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=9.63 fanout-score-rank=16 prefix-density=0.34 prefix-fanout=6.0 sequence=TCAATGCTGTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=201.41 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=10.5 sequence=AAAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7169097 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:18:15 Started mapping on | Feb 10 21:18:15 Finished on | Feb 10 21:20:56 Mapping speed, Million of reads per hour | 391.34 Number of input reads | 17501586 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16307479 Uniquely mapped reads % | 93.18% Average mapped length | 296.58 Number of splices: Total | 15404444 Number of splices: Annotated (sjdb) | 15155531 Number of splices: GT/AG | 15194325 Number of splices: GC/AG | 168017 Number of splices: AT/AC | 12122 Number of splices: Non-canonical | 29980 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.02% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285256 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 13543 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.08% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 928189 928189 928189 N_multimapping 285256 285256 285256 N_noFeature 323199 16100160 403502 N_ambiguous 194795 1340 66752 UnstrandedReadsAssigned:15789485 PositiveStrandReadsAssigned:205979 NegativeStrandReadsAssigned:15837225 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169097 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169097-trimmed-pair1.fastq SRR7169097-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,501,586 reads, 15,707,002 reads pseudoaligned [quant] estimated average fragment length: 277.333 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR7169097.ke.tsv 34699 SRR7169097.se.tsv 87100 total ==> SRR7169097.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1741.67 315 10.6341 Potri.005G024800.1.v4.1 1035 758.667 25 1.93751 Potri.004G059700.1.v4.1 961 684.697 3 0.257619 Potri.007G009000.2.v4.1 1416 1139.67 0 0 Potri.003G141000.2.v4.1 2943 2666.67 294.034 6.4831 Potri.016G087400.1.v4.1 270 60.1459 1159.52 1133.51 Potri.015G069301.1.v4.1 564 294.063 0 0 Potri.010G195200.1.v4.1 1773 1496.67 14 0.549994 Potri.012G127500.1.v4.1 977 700.679 4326 363.013 ==> SRR7169097.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1887 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 242 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169097 completed mapping pipeline successfully