Starting /dee2/code/volunteer_pipeline.sh SRR7169098 current disk space = 3056621137920 free memory = 1148871120 SRR7169098 SRAfilesize c41565e52e59eeb1f68648141d54d213 SRR7169098.sra SRR7169098.sra file validated SRR7169098 is paired end SRR7169098 is conventional basespace SRR7169098 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169098_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.26775 34.0 33.0 34.0 33.0 34.0 2 33.518 34.0 34.0 34.0 33.0 34.0 3 33.4775 34.0 34.0 34.0 33.0 34.0 4 33.499 34.0 34.0 34.0 33.0 34.0 5 33.518 34.0 34.0 34.0 33.0 34.0 6 37.1205 38.0 38.0 38.0 36.0 38.0 7 37.342 38.0 38.0 38.0 37.0 38.0 8 37.44475 38.0 38.0 38.0 37.0 38.0 9 37.50075 38.0 38.0 38.0 37.0 38.0 10-14 37.48785 38.0 38.0 38.0 37.4 38.0 15-19 37.41545 38.0 38.0 38.0 37.0 38.0 20-24 37.323750000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.278600000000004 38.0 38.0 38.0 36.8 38.0 30-34 37.217850000000006 38.0 38.0 38.0 36.8 38.0 35-39 37.1248 38.0 38.0 38.0 36.2 38.0 40-44 36.7681 38.0 38.0 38.0 34.8 38.0 45-49 36.658249999999995 38.0 38.0 38.0 34.0 38.0 50-54 36.4644 38.0 37.4 38.0 34.0 38.0 55-59 36.34455 38.0 37.2 38.0 33.4 38.0 60-64 36.300650000000005 38.0 37.0 38.0 33.4 38.0 65-69 36.24935000000001 38.0 37.0 38.0 33.0 38.0 70-74 36.201350000000005 38.0 37.0 38.0 33.4 38.0 75-79 35.948 38.0 37.0 38.0 32.0 38.0 80-84 35.87605 38.0 37.0 38.0 31.8 38.0 85-89 35.6641 38.0 36.6 38.0 30.2 38.0 90-94 35.3986 38.0 36.0 38.0 29.0 38.0 95-99 35.217650000000006 38.0 36.0 38.0 28.8 38.0 100-104 34.85595 38.0 35.4 38.0 27.4 38.0 105-109 34.60945 38.0 35.0 38.0 26.4 38.0 110-114 34.3134 38.0 34.8 38.0 24.0 38.0 115-119 34.136449999999996 38.0 34.4 38.0 23.4 38.0 120-124 33.756800000000005 38.0 34.0 38.0 19.4 38.0 125-129 33.392399999999995 38.0 34.0 38.0 17.4 38.0 130-134 32.90930000000001 38.0 33.6 38.0 15.0 38.0 135-139 32.229 37.0 32.2 38.0 14.4 38.0 140-144 31.45915 36.0 31.0 38.0 13.8 38.0 145-149 30.557 36.0 30.2 38.0 6.4 38.0 150-151 26.641125000000002 34.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 2.0 11 0.0 12 3.0 13 2.0 14 4.0 15 7.0 16 6.0 17 8.0 18 11.0 19 10.0 20 10.0 21 9.0 22 14.0 23 18.0 24 29.0 25 30.0 26 31.0 27 45.0 28 33.0 29 50.0 30 52.0 31 91.0 32 118.0 33 169.0 34 258.0 35 486.0 36 1092.0 37 1411.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.72159234063996 13.63063744016125 8.515998992189468 33.131771227009324 2 24.925 13.600000000000001 30.575000000000003 30.9 3 19.825 17.9 28.199999999999996 34.075 4 22.7 23.375 24.825 29.099999999999998 5 23.799999999999997 29.375 24.75 22.075 6 21.5 32.25 24.25 22.0 7 16.175 28.749999999999996 37.925 17.150000000000002 8 19.1 27.875 30.15 22.875 9 17.325 25.35 34.275 23.05 10-14 19.37 30.48 27.250000000000004 22.900000000000002 15-19 19.605 29.57 27.365000000000002 23.46 20-24 20.34 28.7 27.345000000000002 23.615 25-29 20.18 28.95 27.51 23.36 30-34 19.445 29.14 27.245 24.169999999999998 35-39 19.455 29.095 27.425 24.025 40-44 20.53 28.845 27.195000000000004 23.43 45-49 19.985 28.71 27.125 24.18 50-54 19.99 28.76 27.389999999999997 23.86 55-59 20.369999999999997 29.244999999999997 26.840000000000003 23.544999999999998 60-64 20.055 29.21 27.139999999999997 23.595 65-69 20.155 28.939999999999998 27.425 23.48 70-74 19.88 28.785 27.11 24.224999999999998 75-79 20.34 28.035 27.57 24.055 80-84 20.61 28.64 26.795 23.955000000000002 85-89 20.54 28.144999999999996 27.495000000000005 23.82 90-94 20.43 28.605000000000004 27.065 23.9 95-99 19.805 28.945 27.400000000000002 23.849999999999998 100-104 20.76 28.215 27.61 23.415 105-109 20.345 28.405 27.215 24.035 110-114 20.625 28.46 27.034999999999997 23.880000000000003 115-119 20.8 28.139999999999997 27.38 23.68 120-124 20.810000000000002 28.494999999999997 27.255000000000003 23.44 125-129 20.875 27.61 27.589999999999996 23.925 130-134 20.735 28.63 27.250000000000004 23.385 135-139 20.97 28.199999999999996 27.025 23.805 140-144 21.09 27.860000000000003 27.689999999999998 23.36 145-149 20.78 28.175 27.339999999999996 23.705000000000002 150-151 20.8875 27.9125 26.7625 24.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.5 3 0.5 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 1.5 19 2.5 20 2.5 21 1.5 22 1.5 23 3.5 24 3.5 25 6.0 26 6.0 27 6.0 28 7.0 29 11.5 30 28.0 31 32.0 32 32.5 33 41.5 34 60.5 35 71.0 36 78.0 37 100.5 38 122.5 39 139.0 40 158.0 41 191.5 42 229.0 43 259.0 44 267.5 45 249.5 46 251.0 47 260.0 48 235.5 49 214.5 50 186.0 51 156.0 52 139.5 53 111.0 54 85.5 55 68.0 56 48.5 57 29.0 58 19.5 59 16.5 60 13.0 61 11.0 62 8.0 63 4.5 64 4.0 65 6.0 66 4.5 67 1.5 68 2.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.35 0.0 0.0 0.0 0.0 122-123 0.3875 0.0 0.0 0.0 0.0 124-125 0.48750000000000004 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.7 0.0 0.0 0.0 0.0 130-131 0.7124999999999999 0.0 0.0 0.0 0.0 132-133 0.7625 0.0 0.0 0.0 0.0 134-135 0.8999999999999999 0.0 0.0 0.0 0.0 136-137 0.9874999999999999 0.0 0.0 0.0 0.0 138-139 1.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTTAAT 10 0.006830828 145.0 6 >>END_MODULE SRR7169098 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169098_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.833 33.0 33.0 34.0 32.0 34.0 2 32.92675 34.0 33.0 34.0 32.0 34.0 3 32.8905 34.0 33.0 34.0 32.0 34.0 4 32.8645 34.0 33.0 34.0 32.0 34.0 5 32.8395 34.0 33.0 34.0 32.0 34.0 6 37.01825 38.0 38.0 38.0 37.0 38.0 7 36.933 38.0 38.0 38.0 37.0 38.0 8 36.99725 38.0 38.0 38.0 37.0 38.0 9 36.98425 38.0 38.0 38.0 37.0 38.0 10-14 36.9405 38.0 38.0 38.0 37.0 38.0 15-19 36.956599999999995 38.0 38.0 38.0 37.0 38.0 20-24 36.87505 38.0 38.0 38.0 36.8 38.0 25-29 36.882850000000005 38.0 38.0 38.0 37.0 38.0 30-34 36.871449999999996 38.0 38.0 38.0 37.0 38.0 35-39 36.800149999999995 38.0 38.0 38.0 36.6 38.0 40-44 36.74695 38.0 38.0 38.0 36.2 38.0 45-49 36.760749999999994 38.0 38.0 38.0 36.2 38.0 50-54 36.748000000000005 38.0 38.0 38.0 36.2 38.0 55-59 36.6854 38.0 38.0 38.0 36.0 38.0 60-64 36.6786 38.0 38.0 38.0 36.0 38.0 65-69 36.595549999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.5243 38.0 38.0 38.0 36.0 38.0 75-79 36.4828 38.0 38.0 38.0 35.4 38.0 80-84 36.37749999999999 38.0 38.0 38.0 35.0 38.0 85-89 36.32315 38.0 38.0 38.0 34.8 38.0 90-94 36.2314 38.0 38.0 38.0 34.0 38.0 95-99 36.128949999999996 38.0 38.0 38.0 34.0 38.0 100-104 35.908100000000005 38.0 38.0 38.0 33.6 38.0 105-109 35.8007 38.0 38.0 38.0 33.0 38.0 110-114 35.65095 38.0 38.0 38.0 32.2 38.0 115-119 35.509550000000004 38.0 37.8 38.0 31.0 38.0 120-124 35.22144999999999 38.0 37.0 38.0 30.0 38.0 125-129 35.059749999999994 38.0 37.0 38.0 29.0 38.0 130-134 34.91515 38.0 36.6 38.0 28.4 38.0 135-139 34.5091 38.0 36.0 38.0 26.2 38.0 140-144 33.91595 38.0 35.2 38.0 22.2 38.0 145-149 33.3787 38.0 35.0 38.0 16.6 38.0 150-151 29.972250000000003 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 5.0 4 6.0 5 1.0 6 4.0 7 3.0 8 1.0 9 6.0 10 1.0 11 0.0 12 5.0 13 4.0 14 4.0 15 4.0 16 9.0 17 4.0 18 5.0 19 7.0 20 14.0 21 12.0 22 14.0 23 9.0 24 14.0 25 15.0 26 26.0 27 23.0 28 25.0 29 34.0 30 40.0 31 44.0 32 60.0 33 72.0 34 125.0 35 195.0 36 400.0 37 2791.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.5 23.5 12.875 24.125 2 28.525 26.85 26.5 18.125 3 21.65 28.849999999999998 30.475 19.025 4 24.3 33.225 22.45 20.025000000000002 5 25.15 36.075 21.375 17.4 6 22.175 36.975 21.55 19.3 7 22.25 22.6 36.475 18.675 8 23.175 25.8 25.974999999999998 25.05 9 21.725 25.6 29.95 22.725 10-14 23.655 29.060000000000002 25.71 21.575 15-19 24.11 28.125 26.669999999999998 21.095 20-24 23.445 28.59 27.105 20.86 25-29 23.365 27.865000000000002 27.21 21.560000000000002 30-34 23.815 27.705000000000002 27.005000000000003 21.475 35-39 23.465 27.575 27.405 21.555 40-44 23.945 27.32 27.54 21.195 45-49 23.669999999999998 28.235 26.735 21.36 50-54 23.54 28.110000000000003 27.465 20.885 55-59 24.22 27.500000000000004 27.08 21.2 60-64 23.865 27.845 27.33 20.96 65-69 23.424595825616898 28.024425646929274 27.133490164672907 21.41748836278092 70-74 24.30252942649637 27.417981467568243 27.46306035562234 20.816428750313047 75-79 23.58830596716059 27.598117741289546 27.352823388065676 21.46075290348418 80-84 23.935000000000002 28.1 27.375 20.59 85-89 23.98 27.279999999999998 27.560000000000002 21.18 90-94 23.995 27.589999999999996 27.43 20.985 95-99 24.035 28.134999999999998 27.235 20.595 100-104 24.555 27.615000000000002 27.565 20.265 105-109 23.61 28.050000000000004 27.235 21.105 110-114 23.48 27.79 27.415 21.315 115-119 24.065 27.615000000000002 27.694999999999997 20.625 120-124 24.03 28.12 27.265 20.585 125-129 23.745 27.834999999999997 27.395000000000003 21.025 130-134 24.57 27.375 27.334999999999997 20.72 135-139 23.781647153007103 27.7944561192835 27.934554187931553 20.489342539777844 140-144 23.57805061388123 28.253570533700827 27.441743923828614 20.726634928589327 145-149 24.717691342534504 27.74404015056462 27.176913425345045 20.361355081555836 150-151 24.685613682092555 26.81086519114688 27.91750503018109 20.586016096579478 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 2.5 26 3.5 27 4.0 28 7.0 29 9.0 30 7.5 31 11.0 32 15.0 33 21.5 34 32.5 35 44.5 36 57.0 37 69.0 38 102.5 39 146.0 40 184.0 41 204.0 42 223.0 43 266.5 44 287.0 45 301.0 46 305.0 47 279.0 48 263.5 49 230.5 50 196.0 51 168.5 52 136.0 53 104.5 54 77.0 55 60.0 56 41.0 57 35.0 58 33.5 59 20.5 60 11.0 61 10.5 62 10.5 63 6.0 64 1.0 65 2.5 66 2.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.105 70-74 0.17500000000000002 75-79 0.12 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.06999999999999999 140-144 0.22499999999999998 145-149 0.375 150-151 0.6 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.4125 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.6499999999999999 0.0 0.0 0.0 0.0 128-129 0.725 0.0 0.0 0.0 0.0 130-131 0.7375 0.0 0.0 0.0 0.0 132-133 0.7875000000000001 0.0 0.0 0.0 0.0 134-135 0.925 0.0 0.0 0.0 0.0 136-137 1.0125 0.0 0.0 0.0 0.0 138-139 1.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713157 spots for SRR7169098.sra Written 713157 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra Read 713143 spots for SRR7169098.sra Written 713143 spots for SRR7169098.sra SRR ids: ['SRR7169098.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__jj58f8u SRR7169098.sra spots: 14262874 blocks: [[1, 713143], [713144, 1426286], [1426287, 2139429], [2139430, 2852572], [2852573, 3565715], [3565716, 4278858], [4278859, 4992001], [4992002, 5705144], [5705145, 6418287], [6418288, 7131430], [7131431, 7844573], [7844574, 8557716], [8557717, 9270859], [9270860, 9984002], [9984003, 10697145], [10697146, 11410288], [11410289, 12123431], [12123432, 12836574], [12836575, 13549717], [13549718, 14262874]] SRR7169098 file size 4811519 SRR7169098 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169098 SRR7169098_1.fastq SRR7169098_2.fastq Input file: SRR7169098_1.fastq Paired file: SRR7169098_2.fastq trimmed: SRR7169098-trimmed-pair1.fastq, SRR7169098-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:31:07 2025 >> started Mon Feb 10 21:31:23 2025 >> done (15.758s) 14262874 read pairs processed; of these: 23673 ( 0.17%) short read pairs filtered out after trimming by size control 21581 ( 0.15%) empty read pairs filtered out after trimming by size control 14217620 (99.68%) read pairs available; of these: 7541627 (53.04%) trimmed read pairs available after processing 6675993 (46.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 4 0.00% 21 6 0.00% 22 7 0.00% 23 7 0.00% 24 5 0.00% 25 6 0.00% 26 8 0.00% 27 15 0.00% 28 6 0.00% 29 14 0.00% 30 15 0.00% 31 8 0.00% 32 7 0.00% 33 11 0.00% 34 12 0.00% 35 10 0.00% 36 14 0.00% 37 18 0.00% 38 16 0.00% 39 19 0.00% 40 13 0.00% 41 23 0.00% 42 21 0.00% 43 14 0.00% 44 31 0.00% 45 31 0.00% 46 34 0.00% 47 31 0.00% 48 27 0.00% 49 33 0.00% 50 32 0.00% 51 49 0.00% 52 39 0.00% 53 46 0.00% 54 45 0.00% 55 55 0.00% 56 71 0.00% 57 68 0.00% 58 82 0.00% 59 82 0.00% 60 86 0.00% 61 90 0.00% 62 108 0.00% 63 120 0.00% 64 132 0.00% 65 156 0.00% 66 172 0.00% 67 163 0.00% 68 204 0.00% 69 234 0.00% 70 239 0.00% 71 263 0.00% 72 289 0.00% 73 316 0.00% 74 371 0.00% 75 423 0.00% 76 443 0.00% 77 489 0.00% 78 557 0.00% 79 601 0.00% 80 705 0.00% 81 787 0.01% 82 886 0.01% 83 1024 0.01% 84 1999 0.01% 85 2620 0.02% 86 2618 0.02% 87 2863 0.02% 88 2975 0.02% 89 2898 0.02% 90 2973 0.02% 91 2911 0.02% 92 3201 0.02% 93 3396 0.02% 94 3550 0.02% 95 3824 0.03% 96 3970 0.03% 97 4287 0.03% 98 4628 0.03% 99 4801 0.03% 100 5229 0.04% 101 5408 0.04% 102 5717 0.04% 103 6168 0.04% 104 6644 0.05% 105 7237 0.05% 106 7608 0.05% 107 8309 0.06% 108 8707 0.06% 109 8958 0.06% 110 9481 0.07% 111 10025 0.07% 112 10687 0.08% 113 11571 0.08% 114 12033 0.08% 115 12972 0.09% 116 13803 0.10% 117 14318 0.10% 118 15303 0.11% 119 15933 0.11% 120 16771 0.12% 121 17847 0.13% 122 18807 0.13% 123 19956 0.14% 124 21410 0.15% 125 22821 0.16% 126 24907 0.18% 127 26805 0.19% 128 28473 0.20% 129 30177 0.21% 130 32672 0.23% 131 35135 0.25% 132 38363 0.27% 133 42171 0.30% 134 45543 0.32% 135 49550 0.35% 136 55018 0.39% 137 60900 0.43% 138 69451 0.49% 139 78101 0.55% 140 86219 0.61% 141 96720 0.68% 142 111935 0.79% 143 128769 0.91% 144 156132 1.10% 145 192020 1.35% 146 247565 1.74% 147 347693 2.45% 148 536107 3.77% 149 1002814 7.05% 150 3641246 25.61% 151 6675993 46.96% 14217620 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=37 prefix-density=0.22 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=235.24 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=17.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=42 prefix-density=0.22 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=153.20 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=14.1 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169098 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:32:13 Started mapping on | Feb 10 21:32:13 Finished on | Feb 10 21:34:13 Mapping speed, Million of reads per hour | 426.53 Number of input reads | 14217620 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12999782 Uniquely mapped reads % | 91.43% Average mapped length | 295.69 Number of splices: Total | 11931487 Number of splices: Annotated (sjdb) | 11743366 Number of splices: GT/AG | 11759791 Number of splices: GC/AG | 138468 Number of splices: AT/AC | 9197 Number of splices: Non-canonical | 24031 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 251067 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 36511 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.49% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 987206 987206 987206 N_multimapping 251067 251067 251067 N_noFeature 241917 12848050 296614 N_ambiguous 150889 817 53350 UnstrandedReadsAssigned:12606976 PositiveStrandReadsAssigned:150915 NegativeStrandReadsAssigned:12649818 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169098 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169098-trimmed-pair1.fastq SRR7169098-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,217,620 reads, 12,598,453 reads pseudoaligned [quant] estimated average fragment length: 270.809 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 996 rounds 52401 SRR7169098.ke.tsv 34699 SRR7169098.se.tsv 87100 total ==> SRR7169098.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.19 248 9.07476 Potri.005G024800.1.v4.1 1035 765.191 40 3.34397 Potri.004G059700.1.v4.1 961 691.191 1 0.0925495 Potri.007G009000.2.v4.1 1416 1146.19 0 0 Potri.003G141000.2.v4.1 2943 2673.19 189.033 4.52356 Potri.016G087400.1.v4.1 270 60.3452 1046.46 1109.31 Potri.015G069301.1.v4.1 564 298.888 0 0 Potri.010G195200.1.v4.1 1773 1503.19 7 0.29789 Potri.012G127500.1.v4.1 977 707.191 6873 621.701 ==> SRR7169098.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 850 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 244 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169098 completed mapping pipeline successfully