Starting /dee2/code/volunteer_pipeline.sh SRR7169099 current disk space = 3056998088704 free memory = 1487431276 SRR7169099 SRAfilesize d8e1bdcef24590845ed6c80e879c1a17 SRR7169099.sra SRR7169099.sra file validated SRR7169099 is paired end SRR7169099 is conventional basespace SRR7169099 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169099_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93725 34.0 33.0 34.0 33.0 34.0 2 33.3435 34.0 33.0 34.0 33.0 34.0 3 33.42275 34.0 34.0 34.0 33.0 34.0 4 33.42675 34.0 34.0 34.0 33.0 34.0 5 33.444 34.0 34.0 34.0 33.0 34.0 6 37.013 38.0 37.0 38.0 35.0 38.0 7 37.26675 38.0 38.0 38.0 36.0 38.0 8 37.3505 38.0 38.0 38.0 37.0 38.0 9 37.39425 38.0 38.0 38.0 37.0 38.0 10-14 37.4172 38.0 38.0 38.0 37.0 38.0 15-19 37.3614 38.0 38.0 38.0 37.0 38.0 20-24 37.2744 38.0 38.0 38.0 37.0 38.0 25-29 37.284000000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.232600000000005 38.0 38.0 38.0 36.4 38.0 35-39 37.1706 38.0 38.0 38.0 36.4 38.0 40-44 36.8806 38.0 38.0 38.0 35.2 38.0 45-49 36.647149999999996 38.0 38.0 38.0 34.6 38.0 50-54 36.41655 38.0 37.4 38.0 33.8 38.0 55-59 36.432950000000005 38.0 37.8 38.0 34.0 38.0 60-64 36.32765 38.0 37.2 38.0 33.4 38.0 65-69 36.2787 38.0 37.0 38.0 33.2 38.0 70-74 36.13785 38.0 37.0 38.0 33.0 38.0 75-79 36.141999999999996 38.0 37.0 38.0 33.0 38.0 80-84 36.044650000000004 38.0 37.0 38.0 32.8 38.0 85-89 35.83365 38.0 36.8 38.0 31.4 38.0 90-94 35.6173 38.0 36.4 38.0 30.4 38.0 95-99 35.3684 38.0 36.0 38.0 29.0 38.0 100-104 35.04945 38.0 36.0 38.0 28.8 38.0 105-109 34.8648 38.0 35.8 38.0 27.4 38.0 110-114 34.61305 38.0 35.0 38.0 26.6 38.0 115-119 34.3346 38.0 35.0 38.0 25.2 38.0 120-124 33.9687 38.0 34.0 38.0 23.0 38.0 125-129 33.5575 38.0 34.0 38.0 19.0 38.0 130-134 33.1476 38.0 34.0 38.0 16.2 38.0 135-139 32.7994 38.0 33.2 38.0 15.0 38.0 140-144 32.263600000000004 37.0 32.8 38.0 14.2 38.0 145-149 31.234199999999998 36.0 31.2 38.0 8.8 38.0 150-151 27.054000000000002 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 0.0 12 2.0 13 1.0 14 2.0 15 0.0 16 7.0 17 6.0 18 10.0 19 15.0 20 9.0 21 11.0 22 17.0 23 19.0 24 13.0 25 28.0 26 35.0 27 39.0 28 33.0 29 46.0 30 71.0 31 65.0 32 116.0 33 162.0 34 257.0 35 457.0 36 1018.0 37 1558.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.14329190971342 12.173471975653056 9.840223180319553 32.843012934313975 2 24.375 12.9 31.424999999999997 31.3 3 20.225 18.099999999999998 26.575 35.099999999999994 4 23.375 23.974999999999998 24.925 27.725 5 24.325 29.775000000000002 23.724999999999998 22.175 6 20.724999999999998 34.2 23.65 21.425 7 16.150000000000002 28.875 37.85 17.125 8 16.650000000000002 27.625 30.45 25.275 9 16.775000000000002 26.55 33.900000000000006 22.775000000000002 10-14 20.369999999999997 29.925 27.08 22.625 15-19 20.244999999999997 28.715000000000003 27.439999999999998 23.599999999999998 20-24 20.0 29.45 27.095000000000002 23.455000000000002 25-29 20.580000000000002 29.404999999999998 26.875 23.14 30-34 19.66 29.404999999999998 27.189999999999998 23.745 35-39 20.22 29.03 27.315 23.435 40-44 20.31 28.54 27.560000000000002 23.59 45-49 20.57 28.435 27.400000000000002 23.595 50-54 19.965 29.07 26.540000000000003 24.425 55-59 20.150000000000002 28.849999999999998 27.12 23.880000000000003 60-64 20.265 28.854999999999997 27.04 23.84 65-69 19.78 28.875 27.43 23.915 70-74 20.505000000000003 29.21 27.02 23.265 75-79 20.349999999999998 28.499999999999996 27.075 24.075 80-84 20.549999999999997 28.294999999999998 27.18 23.974999999999998 85-89 20.369999999999997 28.694999999999997 27.355 23.580000000000002 90-94 20.544999999999998 28.549999999999997 27.26 23.645 95-99 20.945 28.255000000000003 26.979999999999997 23.82 100-104 20.465 27.834999999999997 27.77 23.93 105-109 20.52 28.444999999999997 26.924999999999997 24.11 110-114 20.21 27.750000000000004 27.79 24.25 115-119 20.544999999999998 28.54 27.24 23.674999999999997 120-124 20.79 28.18 27.12 23.91 125-129 21.105 27.625 27.139999999999997 24.13 130-134 20.905 27.965 27.644999999999996 23.485 135-139 21.035 28.225 27.11 23.630000000000003 140-144 21.025 28.04 27.22 23.715 145-149 20.86 27.815 27.71 23.615 150-151 21.425 28.199999999999996 27.075 23.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 2.5 24 3.0 25 2.5 26 4.5 27 6.5 28 6.0 29 13.0 30 21.0 31 24.5 32 29.5 33 39.5 34 47.5 35 58.5 36 79.0 37 97.0 38 125.5 39 157.5 40 177.0 41 196.0 42 229.5 43 263.0 44 266.0 45 276.5 46 277.5 47 257.5 48 242.5 49 217.5 50 186.5 51 166.0 52 131.0 53 96.0 54 72.5 55 51.5 56 40.5 57 31.5 58 29.5 59 18.5 60 11.5 61 9.5 62 7.5 63 6.5 64 5.0 65 3.5 66 3.5 67 3.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.1375 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.1875 0.0 0.0 0.0 0.0 118-119 0.2875 0.0 0.0 0.0 0.0 120-121 0.3 0.0 0.0 0.0 0.0 122-123 0.3375 0.0 0.0 0.0 0.0 124-125 0.4 0.0 0.0 0.0 0.0 126-127 0.4375 0.0 0.0 0.0 0.0 128-129 0.525 0.0 0.0 0.0 0.0 130-131 0.6125 0.0 0.0 0.0 0.0 132-133 0.6625000000000001 0.0 0.0 0.0 0.0 134-135 0.7124999999999999 0.0 0.0 0.0 0.0 136-137 0.8500000000000001 0.0 0.0 0.0 0.0 138-139 0.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169099 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169099_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7385 33.0 33.0 34.0 32.0 34.0 2 32.83475 34.0 33.0 34.0 32.0 34.0 3 32.921 34.0 33.0 34.0 32.0 34.0 4 32.9045 34.0 33.0 34.0 32.0 34.0 5 32.84075 34.0 33.0 34.0 32.0 34.0 6 36.996 38.0 38.0 38.0 37.0 38.0 7 37.08125 38.0 38.0 38.0 37.0 38.0 8 37.0225 38.0 38.0 38.0 37.0 38.0 9 36.9145 38.0 38.0 38.0 37.0 38.0 10-14 36.9485 38.0 38.0 38.0 36.6 38.0 15-19 36.90195 38.0 38.0 38.0 36.0 38.0 20-24 36.95955 38.0 38.0 38.0 36.4 38.0 25-29 36.8821 38.0 38.0 38.0 36.4 38.0 30-34 36.905950000000004 38.0 38.0 38.0 36.6 38.0 35-39 36.85985 38.0 38.0 38.0 36.4 38.0 40-44 36.76365 38.0 38.0 38.0 36.0 38.0 45-49 36.77115 38.0 38.0 38.0 36.0 38.0 50-54 36.777249999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.7069 38.0 38.0 38.0 36.0 38.0 60-64 36.6995 38.0 38.0 38.0 36.0 38.0 65-69 36.64385 38.0 38.0 38.0 35.8 38.0 70-74 36.59185 38.0 38.0 38.0 35.4 38.0 75-79 36.4443 38.0 38.0 38.0 34.6 38.0 80-84 36.3949 38.0 38.0 38.0 34.0 38.0 85-89 36.2495 38.0 38.0 38.0 34.0 38.0 90-94 36.23265 38.0 38.0 38.0 34.0 38.0 95-99 36.13725 38.0 38.0 38.0 34.0 38.0 100-104 35.917199999999994 38.0 38.0 38.0 33.2 38.0 105-109 35.8142 38.0 38.0 38.0 32.2 38.0 110-114 35.69855 38.0 38.0 38.0 31.8 38.0 115-119 35.49275 38.0 37.4 38.0 31.0 38.0 120-124 35.41020000000001 38.0 37.2 38.0 30.6 38.0 125-129 35.088049999999996 38.0 36.4 38.0 28.8 38.0 130-134 34.7787 38.0 36.0 38.0 27.6 38.0 135-139 34.474900000000005 38.0 36.0 38.0 26.0 38.0 140-144 34.122 38.0 35.4 38.0 23.4 38.0 145-149 33.163850000000004 38.0 35.0 38.0 13.8 38.0 150-151 29.73375 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 2.0 4 6.0 5 2.0 6 2.0 7 2.0 8 3.0 9 1.0 10 4.0 11 2.0 12 3.0 13 1.0 14 3.0 15 3.0 16 6.0 17 9.0 18 6.0 19 6.0 20 11.0 21 9.0 22 7.0 23 9.0 24 16.0 25 34.0 26 31.0 27 27.0 28 34.0 29 38.0 30 45.0 31 37.0 32 72.0 33 84.0 34 133.0 35 186.0 36 418.0 37 2736.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.2 23.225 13.3 24.275 2 28.525 26.75 27.275 17.45 3 19.75 28.475 30.875000000000004 20.9 4 23.974999999999998 33.324999999999996 24.275 18.425 5 25.15 35.8 21.275 17.775 6 20.95 37.875 23.400000000000002 17.775 7 20.200000000000003 23.775 36.85 19.175 8 22.475 25.324999999999996 26.575 25.624999999999996 9 22.175 25.124999999999996 29.849999999999998 22.85 10-14 23.200000000000003 29.12 26.555 21.125 15-19 23.72 27.505000000000003 27.35 21.425 20-24 23.419999999999998 27.800000000000004 27.52 21.26 25-29 23.46 28.044999999999998 27.169999999999998 21.325 30-34 23.195 27.794999999999998 27.485 21.525 35-39 23.77 27.665 27.305 21.26 40-44 22.994999999999997 28.22 27.255000000000003 21.529999999999998 45-49 23.375 27.529999999999998 28.03 21.065 50-54 23.485 27.965 27.284999999999997 21.265 55-59 23.97 27.685 27.235 21.11 60-64 24.060000000000002 27.91 27.450000000000003 20.580000000000002 65-69 23.77951180472189 28.2312925170068 26.735694277711087 21.253501400560225 70-74 23.980383325826953 27.94875644297653 27.173097132562678 20.89776309863384 75-79 23.63317464294663 27.40165372087196 28.088198446504638 20.87697318967677 80-84 24.455 27.245 27.439999999999998 20.86 85-89 23.68 28.025 27.49 20.805 90-94 24.445 27.485 27.625 20.445 95-99 23.595 27.860000000000003 27.915 20.630000000000003 100-104 24.09 27.439999999999998 27.6 20.87 105-109 23.91 27.29 27.565 21.235 110-114 23.595 27.544999999999998 27.900000000000002 20.96 115-119 23.77 27.985 27.505000000000003 20.74 120-124 24.14 27.235 28.07 20.555 125-129 24.815 27.325 27.474999999999998 20.385 130-134 24.45 27.29 27.33 20.93 135-139 23.955000000000002 27.54 27.72 20.785 140-144 24.104999999999997 27.245 27.755000000000003 20.895 145-149 24.198645598194133 27.524454477050416 27.654878354652624 20.622021570102834 150-151 25.003144258583827 27.480820022638664 26.839391271538172 20.67664444723934 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 3.0 26 5.0 27 4.0 28 3.0 29 4.5 30 5.5 31 9.5 32 14.5 33 19.5 34 31.0 35 39.0 36 57.5 37 81.5 38 108.0 39 155.0 40 197.5 41 226.0 42 248.0 43 268.0 44 292.0 45 300.5 46 299.0 47 286.0 48 248.0 49 218.0 50 200.5 51 172.0 52 135.5 53 107.5 54 80.5 55 48.5 56 32.0 57 27.0 58 19.5 59 11.5 60 10.0 61 9.5 62 4.5 63 2.5 64 3.5 65 4.0 66 2.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.04 70-74 0.08499999999999999 75-79 0.22499999999999998 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.325 150-151 0.6125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.16249999999999998 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.2125 0.0 0.0 0.0 0.0 118-119 0.3375 0.0 0.0 0.0 0.0 120-121 0.35 0.0 0.0 0.0 0.0 122-123 0.3875 0.0 0.0 0.0 0.0 124-125 0.44999999999999996 0.0 0.0 0.0 0.0 126-127 0.4875 0.0 0.0 0.0 0.0 128-129 0.6 0.0 0.0 0.0 0.0 130-131 0.6625000000000001 0.0 0.0 0.0 0.0 132-133 0.7124999999999999 0.0 0.0 0.0 0.0 134-135 0.7375 0.0 0.0 0.0 0.0 136-137 0.875 0.0 0.0 0.0 0.0 138-139 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATTC 10 0.006830828 145.0 2 GGAAATT 10 0.006830828 145.0 1 >>END_MODULE Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790180 spots for SRR7169099.sra Written 790180 spots for SRR7169099.sra Read 790194 spots for SRR7169099.sra Written 790194 spots for SRR7169099.sra SRR ids: ['SRR7169099.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_33gmpq7v SRR7169099.sra spots: 15803614 blocks: [[1, 790180], [790181, 1580360], [1580361, 2370540], [2370541, 3160720], [3160721, 3950900], [3950901, 4741080], [4741081, 5531260], [5531261, 6321440], [6321441, 7111620], [7111621, 7901800], [7901801, 8691980], [8691981, 9482160], [9482161, 10272340], [10272341, 11062520], [11062521, 11852700], [11852701, 12642880], [12642881, 13433060], [13433061, 14223240], [14223241, 15013420], [15013421, 15803614]] SRR7169099 file size 5333625 SRR7169099 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169099 SRR7169099_1.fastq SRR7169099_2.fastq Input file: SRR7169099_1.fastq Paired file: SRR7169099_2.fastq trimmed: SRR7169099-trimmed-pair1.fastq, SRR7169099-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:39:20 2025 >> started Mon Feb 10 21:39:37 2025 >> done (17.489s) 15803614 read pairs processed; of these: 20429 ( 0.13%) short read pairs filtered out after trimming by size control 16280 ( 0.10%) empty read pairs filtered out after trimming by size control 15766905 (99.77%) read pairs available; of these: 7357293 (46.66%) trimmed read pairs available after processing 8409612 (53.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 6 0.00% 21 3 0.00% 22 3 0.00% 23 3 0.00% 24 4 0.00% 25 5 0.00% 26 2 0.00% 27 5 0.00% 28 2 0.00% 29 5 0.00% 30 12 0.00% 31 12 0.00% 32 8 0.00% 33 8 0.00% 34 10 0.00% 35 21 0.00% 36 18 0.00% 37 15 0.00% 38 20 0.00% 39 12 0.00% 40 18 0.00% 41 20 0.00% 42 23 0.00% 43 33 0.00% 44 19 0.00% 45 25 0.00% 46 19 0.00% 47 33 0.00% 48 27 0.00% 49 31 0.00% 50 34 0.00% 51 42 0.00% 52 46 0.00% 53 37 0.00% 54 38 0.00% 55 58 0.00% 56 63 0.00% 57 70 0.00% 58 96 0.00% 59 87 0.00% 60 93 0.00% 61 102 0.00% 62 100 0.00% 63 110 0.00% 64 138 0.00% 65 142 0.00% 66 162 0.00% 67 154 0.00% 68 182 0.00% 69 220 0.00% 70 220 0.00% 71 250 0.00% 72 294 0.00% 73 313 0.00% 74 351 0.00% 75 369 0.00% 76 422 0.00% 77 444 0.00% 78 477 0.00% 79 585 0.00% 80 631 0.00% 81 694 0.00% 82 787 0.00% 83 951 0.01% 84 1873 0.01% 85 2382 0.02% 86 2334 0.01% 87 2452 0.02% 88 2629 0.02% 89 2707 0.02% 90 2693 0.02% 91 2865 0.02% 92 2985 0.02% 93 3097 0.02% 94 3418 0.02% 95 3578 0.02% 96 3805 0.02% 97 3997 0.03% 98 4197 0.03% 99 4496 0.03% 100 4803 0.03% 101 5101 0.03% 102 5337 0.03% 103 5647 0.04% 104 6011 0.04% 105 6499 0.04% 106 6918 0.04% 107 7362 0.05% 108 7735 0.05% 109 8239 0.05% 110 8839 0.06% 111 9565 0.06% 112 10078 0.06% 113 10597 0.07% 114 11387 0.07% 115 12093 0.08% 116 12990 0.08% 117 13696 0.09% 118 14625 0.09% 119 15361 0.10% 120 16473 0.10% 121 17218 0.11% 122 18315 0.12% 123 19772 0.13% 124 21102 0.13% 125 22666 0.14% 126 24248 0.15% 127 26242 0.17% 128 27915 0.18% 129 30004 0.19% 130 32007 0.20% 131 34546 0.22% 132 37316 0.24% 133 40625 0.26% 134 43214 0.27% 135 47000 0.30% 136 51253 0.33% 137 56850 0.36% 138 63964 0.41% 139 71322 0.45% 140 78917 0.50% 141 86473 0.55% 142 98074 0.62% 143 112096 0.71% 144 133646 0.85% 145 163600 1.04% 146 209793 1.33% 147 297224 1.89% 148 455367 2.89% 149 894671 5.67% 150 3883795 24.63% 151 8409612 53.34% 15766905 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=40 prefix-density=0.23 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=61.56 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=11.7 sequence=CACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAACACCTTGTTGAATCTTGGATCCGTGCCATGATATTCAAATGCAGTCATCCCATAGGCCTTGTTAAATGGAATTCCTCCATCAAGAATTGCATCTTTCAAATAATACCAGCTTTCCATGAGGACCTTGTCCTGGTTCATGAGA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=44 prefix-density=0.23 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=16 fanout-score=43.89 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=11.0 sequence=TGTTGGTGGTGGGACTGGAGCTGTCGTTAACACCATCGTCTCTAAATACCCTTCAATTAAGGGCATTAACTTTGATCTGCCCCACGTCATTGAGGATGCCCCATCTTATCCCGGTGTGGAGCATGTTGGTGGGGACATGTTTGTTAG SRR7169099 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:40:21 Started mapping on | Feb 10 21:40:22 Finished on | Feb 10 21:41:53 Mapping speed, Million of reads per hour | 623.75 Number of input reads | 15766905 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14834919 Uniquely mapped reads % | 94.09% Average mapped length | 296.65 Number of splices: Total | 14007089 Number of splices: Annotated (sjdb) | 13787748 Number of splices: GT/AG | 13811888 Number of splices: GC/AG | 155940 Number of splices: AT/AC | 11595 Number of splices: Non-canonical | 27666 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 258988 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 25660 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.07% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 693486 693486 693486 N_multimapping 258988 258988 258988 N_noFeature 269309 14660613 331750 N_ambiguous 175004 789 62636 UnstrandedReadsAssigned:14390606 PositiveStrandReadsAssigned:173517 NegativeStrandReadsAssigned:14440533 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169099 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169099-trimmed-pair1.fastq SRR7169099-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,766,905 reads, 14,343,982 reads pseudoaligned [quant] estimated average fragment length: 268.018 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52401 SRR7169099.ke.tsv 34699 SRR7169099.se.tsv 87100 total ==> SRR7169099.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.98 294 10.2706 Potri.005G024800.1.v4.1 1035 767.982 37 2.94701 Potri.004G059700.1.v4.1 961 694.02 6 0.528823 Potri.007G009000.2.v4.1 1416 1148.98 0 0 Potri.003G141000.2.v4.1 2943 2675.98 260.035 5.94401 Potri.016G087400.1.v4.1 270 60.5809 1298.56 1311.17 Potri.015G069301.1.v4.1 564 301.255 0 0 Potri.010G195200.1.v4.1 1773 1505.98 6 0.243704 Potri.012G127500.1.v4.1 977 709.995 8342 718.698 ==> SRR7169099.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1531 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 315 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7169099 completed mapping pipeline successfully