Starting /dee2/code/volunteer_pipeline.sh SRR7169100 current disk space = 3056903602176 free memory = 1207669720 SRR7169100 SRAfilesize 8bf0cb6170d43d1c3d1b7f59f86b9e24 SRR7169100.sra SRR7169100.sra file validated SRR7169100 is paired end SRR7169100 is conventional basespace SRR7169100 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169100_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76075 34.0 33.0 34.0 32.0 34.0 2 33.271 34.0 33.0 34.0 33.0 34.0 3 33.26475 34.0 33.0 34.0 32.0 34.0 4 33.3465 34.0 33.0 34.0 33.0 34.0 5 33.35825 34.0 33.0 34.0 33.0 34.0 6 36.83475 38.0 37.0 38.0 35.0 38.0 7 37.19125 38.0 38.0 38.0 36.0 38.0 8 37.36625 38.0 38.0 38.0 37.0 38.0 9 37.40125 38.0 38.0 38.0 37.0 38.0 10-14 37.33205 38.0 38.0 38.0 37.0 38.0 15-19 37.3193 38.0 38.0 38.0 37.0 38.0 20-24 37.1491 38.0 38.0 38.0 36.2 38.0 25-29 37.145700000000005 38.0 38.0 38.0 36.2 38.0 30-34 37.12179999999999 38.0 38.0 38.0 36.0 38.0 35-39 36.904999999999994 38.0 38.0 38.0 35.6 38.0 40-44 36.8391 38.0 38.0 38.0 34.8 38.0 45-49 36.57040000000001 38.0 38.0 38.0 34.0 38.0 50-54 36.46745 38.0 37.4 38.0 33.8 38.0 55-59 36.3706 38.0 37.4 38.0 33.8 38.0 60-64 36.4 38.0 37.2 38.0 34.0 38.0 65-69 36.29445 38.0 37.2 38.0 33.4 38.0 70-74 35.9896 38.0 37.0 38.0 32.2 38.0 75-79 36.05755 38.0 37.0 38.0 32.6 38.0 80-84 35.416650000000004 38.0 36.0 38.0 28.6 38.0 85-89 35.6948 38.0 36.6 38.0 30.2 38.0 90-94 35.626349999999995 38.0 36.4 38.0 30.6 38.0 95-99 35.24335 38.0 35.8 38.0 28.2 38.0 100-104 34.876599999999996 38.0 35.2 38.0 27.4 38.0 105-109 34.19235 38.0 34.2 38.0 23.8 38.0 110-114 34.18895 38.0 34.0 38.0 23.4 38.0 115-119 34.560849999999995 38.0 35.0 38.0 25.8 38.0 120-124 33.72835 38.0 34.2 38.0 18.8 38.0 125-129 33.26519999999999 38.0 33.6 38.0 15.0 38.0 130-134 33.177499999999995 37.4 33.6 38.0 15.0 38.0 135-139 32.74409999999999 37.2 33.0 38.0 16.2 38.0 140-144 31.731150000000003 36.0 31.2 38.0 14.0 38.0 145-149 30.4852 36.0 29.8 38.0 8.6 38.0 150-151 26.142375 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 2.0 15 3.0 16 4.0 17 8.0 18 3.0 19 3.0 20 15.0 21 14.0 22 7.0 23 13.0 24 15.0 25 32.0 26 42.0 27 30.0 28 54.0 29 51.0 30 82.0 31 101.0 32 174.0 33 195.0 34 313.0 35 467.0 36 983.0 37 1385.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.27485380116959 12.280701754385964 9.636409865242818 34.80803457920163 2 23.325000000000003 14.6 32.675 29.4 3 18.55 19.5 25.924999999999997 36.025 4 22.775000000000002 26.075 24.075 27.075 5 23.075000000000003 30.8 24.05 22.075 6 20.825 33.375 23.599999999999998 22.2 7 13.675 28.4 40.45 17.474999999999998 8 18.65 26.400000000000002 31.2 23.75 9 17.7 26.275 32.75 23.275000000000002 10-14 19.939999999999998 29.805 27.034999999999997 23.22 15-19 19.900000000000002 28.735 28.125 23.24 20-24 19.62 28.794999999999998 27.810000000000002 23.775 25-29 19.33 28.910000000000004 27.57 24.19 30-34 19.985 29.044999999999998 27.88 23.09 35-39 19.915 28.99 27.07 24.025 40-44 20.46 28.955 27.045 23.54 45-49 19.975 28.825 27.265 23.935000000000002 50-54 20.105 28.65 27.334999999999997 23.91 55-59 20.064999999999998 28.89 26.979999999999997 24.065 60-64 19.939999999999998 28.895 27.115000000000002 24.05 65-69 20.51 28.32 27.22 23.95 70-74 19.830000000000002 28.955 27.275 23.94 75-79 20.32 28.804999999999996 27.605 23.27 80-84 20.74 28.244999999999997 27.26 23.755000000000003 85-89 20.265 28.16 27.665 23.91 90-94 20.195 28.99 27.224999999999998 23.59 95-99 20.235 27.87 27.884999999999998 24.01 100-104 20.77 28.005000000000003 27.73 23.494999999999997 105-109 20.505000000000003 28.155 27.235 24.104999999999997 110-114 20.880000000000003 28.194999999999997 27.125 23.799999999999997 115-119 20.605 28.12 27.35 23.925 120-124 20.385 27.77 27.884999999999998 23.96 125-129 20.77 27.884999999999998 28.1 23.244999999999997 130-134 20.89 27.91 27.655 23.544999999999998 135-139 20.645 27.305 28.115000000000002 23.935000000000002 140-144 21.490000000000002 27.544999999999998 27.43 23.535 145-149 20.965 27.315 27.825 23.895 150-151 21.625 27.5875 26.924999999999997 23.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 1.0 23 2.0 24 1.5 25 1.0 26 3.0 27 8.5 28 13.0 29 15.0 30 18.5 31 25.0 32 30.0 33 32.0 34 46.0 35 60.0 36 78.5 37 107.5 38 132.0 39 150.5 40 177.5 41 205.0 42 237.5 43 264.5 44 276.5 45 275.5 46 274.5 47 275.5 48 245.5 49 207.5 50 178.0 51 152.0 52 126.5 53 102.5 54 79.0 55 51.0 56 33.5 57 29.5 58 20.0 59 15.5 60 12.5 61 8.5 62 5.5 63 2.5 64 2.0 65 2.0 66 2.5 67 2.0 68 1.5 69 2.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.07500000000000001 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.1375 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.23750000000000002 0.0 0.0 0.0 0.0 122-123 0.3125 0.0 0.0 0.0 0.0 124-125 0.35 0.0 0.0 0.0 0.0 126-127 0.375 0.0 0.0 0.0 0.0 128-129 0.42500000000000004 0.0 0.0 0.0 0.0 130-131 0.4625 0.0 0.0 0.0 0.0 132-133 0.5375000000000001 0.0 0.0 0.0 0.0 134-135 0.6125 0.0 0.0 0.0 0.0 136-137 0.75 0.0 0.0 0.0 0.0 138-139 0.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACGAG 10 0.006832588 144.9875 2 >>END_MODULE SRR7169100 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169100_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8875 33.0 33.0 34.0 32.0 34.0 2 32.82225 33.0 33.0 34.0 32.0 34.0 3 32.83475 34.0 33.0 34.0 32.0 34.0 4 32.61825 34.0 33.0 34.0 32.0 34.0 5 32.837 34.0 33.0 34.0 32.0 34.0 6 36.99825 38.0 38.0 38.0 36.0 38.0 7 37.0515 38.0 38.0 38.0 37.0 38.0 8 37.045 38.0 38.0 38.0 37.0 38.0 9 36.81825 38.0 38.0 38.0 36.0 38.0 10-14 36.79260000000001 38.0 38.0 38.0 35.6 38.0 15-19 36.9928 38.0 38.0 38.0 36.2 38.0 20-24 36.93685000000001 38.0 38.0 38.0 36.2 38.0 25-29 36.77885 38.0 38.0 38.0 36.0 38.0 30-34 36.911350000000006 38.0 38.0 38.0 36.0 38.0 35-39 36.77285 38.0 38.0 38.0 35.6 38.0 40-44 36.58135 38.0 38.0 38.0 34.6 38.0 45-49 36.77405 38.0 38.0 38.0 35.6 38.0 50-54 36.81955000000001 38.0 38.0 38.0 35.8 38.0 55-59 36.795249999999996 38.0 38.0 38.0 35.6 38.0 60-64 36.63575 38.0 38.0 38.0 35.0 38.0 65-69 36.66715000000001 38.0 38.0 38.0 35.2 38.0 70-74 36.5279 38.0 38.0 38.0 34.6 38.0 75-79 36.443200000000004 38.0 38.0 38.0 34.4 38.0 80-84 36.1959 38.0 38.0 38.0 33.6 38.0 85-89 36.129 38.0 38.0 38.0 33.4 38.0 90-94 35.90965 38.0 37.6 38.0 32.2 38.0 95-99 36.165350000000004 38.0 38.0 38.0 33.6 38.0 100-104 36.00025 38.0 37.8 38.0 33.2 38.0 105-109 35.8558 38.0 37.6 38.0 32.4 38.0 110-114 35.45015 38.0 37.0 38.0 30.2 38.0 115-119 35.30355000000001 38.0 36.8 38.0 29.6 38.0 120-124 35.222249999999995 38.0 36.4 38.0 29.0 38.0 125-129 34.8578 38.0 36.0 38.0 27.8 38.0 130-134 34.303999999999995 38.0 35.0 38.0 23.6 38.0 135-139 34.19325 38.0 35.0 38.0 24.0 38.0 140-144 33.867 38.0 34.8 38.0 22.2 38.0 145-149 33.18575 38.0 34.4 38.0 14.4 38.0 150-151 29.490125 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 3.0 11 0.0 12 4.0 13 3.0 14 1.0 15 5.0 16 5.0 17 4.0 18 9.0 19 7.0 20 13.0 21 11.0 22 18.0 23 11.0 24 11.0 25 18.0 26 18.0 27 37.0 28 33.0 29 49.0 30 58.0 31 57.0 32 86.0 33 120.0 34 162.0 35 268.0 36 511.0 37 2463.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.1 23.674999999999997 14.774999999999999 24.45 2 28.65 26.85 26.474999999999998 18.025 3 20.205051262815704 28.207051762940733 31.732933233308323 19.854963740935233 4 23.080770192548137 33.48337084271068 25.03125781445361 18.404601150287572 5 25.3 35.0 22.175 17.525 6 22.175 36.975 22.725 18.125 7 21.775 22.0 38.125 18.099999999999998 8 22.2 25.05 27.750000000000004 25.0 9 21.15 26.025 29.549999999999997 23.275000000000002 10-14 22.770000000000003 28.985 26.26 21.985 15-19 23.22 27.694999999999997 27.965 21.12 20-24 22.91 27.915 28.199999999999996 20.974999999999998 25-29 23.599999999999998 27.515 27.544999999999998 21.34 30-34 23.52 27.575 27.47 21.435000000000002 35-39 23.3 28.199999999999996 27.375 21.125 40-44 23.65 28.405 26.97 20.974999999999998 45-49 23.43 27.800000000000004 28.055000000000003 20.715 50-54 23.16 28.325 26.745 21.77 55-59 23.87 27.495000000000005 27.32 21.315 60-64 23.405 28.275 27.544999999999998 20.775 65-69 23.71 27.49 27.905 20.895 70-74 23.94 28.044999999999998 27.034999999999997 20.979999999999997 75-79 23.585 27.215 27.775 21.425 80-84 23.985 27.85 27.13 21.035 85-89 23.830000000000002 27.98 27.700000000000003 20.49 90-94 23.84 27.51 27.6 21.05 95-99 23.56 27.68 27.250000000000004 21.51 100-104 23.794999999999998 27.91 27.67 20.625 105-109 23.435 28.360000000000003 27.655 20.549999999999997 110-114 23.195 27.525 27.98 21.3 115-119 23.705000000000002 27.650000000000002 27.950000000000003 20.695 120-124 23.494999999999997 27.63 27.939999999999998 20.935000000000002 125-129 23.89 27.08 27.584999999999997 21.445 130-134 23.95 27.33 27.250000000000004 21.47 135-139 23.78 27.045 27.575 21.6 140-144 23.215 27.96 27.3 21.525 145-149 23.815 27.860000000000003 27.3 21.025 150-151 24.525 26.25 28.1875 21.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 1.0 26 1.0 27 3.5 28 7.0 29 7.5 30 8.0 31 11.5 32 13.5 33 16.0 34 29.0 35 49.0 36 69.5 37 92.5 38 115.5 39 155.0 40 185.5 41 229.5 42 277.5 43 290.0 44 293.0 45 286.5 46 285.0 47 286.0 48 265.0 49 207.0 50 158.0 51 144.5 52 123.5 53 99.0 54 71.0 55 44.0 56 41.0 57 35.0 58 19.5 59 15.0 60 14.5 61 11.0 62 8.5 63 6.5 64 6.0 65 4.0 66 3.0 67 2.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.07500000000000001 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.1375 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.23750000000000002 0.0 0.0 0.0 0.0 122-123 0.3 0.0 0.0 0.0 0.0 124-125 0.325 0.0 0.0 0.0 0.0 126-127 0.35 0.0 0.0 0.0 0.0 128-129 0.4 0.0 0.0 0.0 0.0 130-131 0.4375 0.0 0.0 0.0 0.0 132-133 0.5375000000000001 0.0 0.0 0.0 0.0 134-135 0.6125 0.0 0.0 0.0 0.0 136-137 0.75 0.0 0.0 0.0 0.0 138-139 0.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTTCT 10 0.006830828 145.0 9 CTCGCCA 10 0.006830828 145.0 9 >>END_MODULE Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra Read 932324 spots for SRR7169100.sra Written 932324 spots for SRR7169100.sra Read 932308 spots for SRR7169100.sra Written 932308 spots for SRR7169100.sra SRR ids: ['SRR7169100.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zjadqpzd SRR7169100.sra spots: 18646176 blocks: [[1, 932308], [932309, 1864616], [1864617, 2796924], [2796925, 3729232], [3729233, 4661540], [4661541, 5593848], [5593849, 6526156], [6526157, 7458464], [7458465, 8390772], [8390773, 9323080], [9323081, 10255388], [10255389, 11187696], [11187697, 12120004], [12120005, 13052312], [13052313, 13984620], [13984621, 14916928], [14916929, 15849236], [15849237, 16781544], [16781545, 17713852], [17713853, 18646176]] SRR7169100 file size 6296876 SRR7169100 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169100 SRR7169100_1.fastq SRR7169100_2.fastq Input file: SRR7169100_1.fastq Paired file: SRR7169100_2.fastq trimmed: SRR7169100-trimmed-pair1.fastq, SRR7169100-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:17:01 2025 >> started Mon Feb 10 21:17:22 2025 >> done (21.401s) 18646176 read pairs processed; of these: 22522 ( 0.12%) short read pairs filtered out after trimming by size control 15425 ( 0.08%) empty read pairs filtered out after trimming by size control 18608229 (99.80%) read pairs available; of these: 8355184 (44.90%) trimmed read pairs available after processing 10253045 (55.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 4 0.00% 21 4 0.00% 22 4 0.00% 23 6 0.00% 24 4 0.00% 25 6 0.00% 26 6 0.00% 27 11 0.00% 28 6 0.00% 29 6 0.00% 30 10 0.00% 31 7 0.00% 32 8 0.00% 33 10 0.00% 34 16 0.00% 35 16 0.00% 36 10 0.00% 37 13 0.00% 38 11 0.00% 39 8 0.00% 40 9 0.00% 41 16 0.00% 42 18 0.00% 43 16 0.00% 44 17 0.00% 45 15 0.00% 46 21 0.00% 47 18 0.00% 48 20 0.00% 49 19 0.00% 50 25 0.00% 51 30 0.00% 52 36 0.00% 53 38 0.00% 54 49 0.00% 55 50 0.00% 56 48 0.00% 57 44 0.00% 58 61 0.00% 59 69 0.00% 60 77 0.00% 61 72 0.00% 62 84 0.00% 63 73 0.00% 64 121 0.00% 65 106 0.00% 66 124 0.00% 67 141 0.00% 68 178 0.00% 69 259 0.00% 70 259 0.00% 71 238 0.00% 72 235 0.00% 73 288 0.00% 74 265 0.00% 75 275 0.00% 76 377 0.00% 77 386 0.00% 78 474 0.00% 79 515 0.00% 80 584 0.00% 81 607 0.00% 82 760 0.00% 83 865 0.00% 84 2002 0.01% 85 2560 0.01% 86 2614 0.01% 87 2763 0.01% 88 2941 0.02% 89 2819 0.02% 90 3011 0.02% 91 3089 0.02% 92 3365 0.02% 93 3314 0.02% 94 3551 0.02% 95 3610 0.02% 96 3833 0.02% 97 4145 0.02% 98 4522 0.02% 99 4528 0.02% 100 4953 0.03% 101 5189 0.03% 102 5462 0.03% 103 5834 0.03% 104 6226 0.03% 105 6617 0.04% 106 6971 0.04% 107 7477 0.04% 108 7927 0.04% 109 8298 0.04% 110 8753 0.05% 111 9508 0.05% 112 10211 0.05% 113 10972 0.06% 114 11511 0.06% 115 12455 0.07% 116 13123 0.07% 117 13813 0.07% 118 14830 0.08% 119 15193 0.08% 120 16195 0.09% 121 17261 0.09% 122 18239 0.10% 123 19449 0.10% 124 21318 0.11% 125 22841 0.12% 126 24284 0.13% 127 26198 0.14% 128 27974 0.15% 129 30115 0.16% 130 32745 0.18% 131 35099 0.19% 132 37890 0.20% 133 41212 0.22% 134 44928 0.24% 135 49384 0.27% 136 54062 0.29% 137 59751 0.32% 138 66194 0.36% 139 73304 0.39% 140 81865 0.44% 141 92916 0.50% 142 106326 0.57% 143 124814 0.67% 144 149399 0.80% 145 184526 0.99% 146 240107 1.29% 147 332871 1.79% 148 516348 2.77% 149 1000171 5.37% 150 4561252 24.51% 151 10253045 55.10% 18608229 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=33 prefix-density=0.21 prefix-fanout=2.8 sequence=AAAGAAGTCAAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=45 fanout-score=186.89 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=13.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=39 prefix-density=0.34 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.04 sequence-density-rank=41 fanout-score=164.69 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=15.4 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169100 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:18:08 Started mapping on | Feb 10 21:18:09 Finished on | Feb 10 21:19:56 Mapping speed, Million of reads per hour | 626.07 Number of input reads | 18608229 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17656207 Uniquely mapped reads % | 94.88% Average mapped length | 297.13 Number of splices: Total | 17094337 Number of splices: Annotated (sjdb) | 16826448 Number of splices: GT/AG | 16847869 Number of splices: GC/AG | 198607 Number of splices: AT/AC | 13731 Number of splices: Non-canonical | 34130 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 333545 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 15981 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 642343 642343 642343 N_multimapping 333545 333545 333545 N_noFeature 346601 17472096 422666 N_ambiguous 183723 1118 74820 UnstrandedReadsAssigned:17125883 PositiveStrandReadsAssigned:182993 NegativeStrandReadsAssigned:17158721 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169100 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169100-trimmed-pair1.fastq SRR7169100-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,608,229 reads, 17,035,264 reads pseudoaligned [quant] estimated average fragment length: 285.409 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52401 SRR7169100.ke.tsv 34699 SRR7169100.se.tsv 87100 total ==> SRR7169100.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1733.59 363 10.968 Potri.005G024800.1.v4.1 1035 750.591 48 3.34969 Potri.004G059700.1.v4.1 961 676.654 4 0.309642 Potri.007G009000.2.v4.1 1416 1131.59 0 0 Potri.003G141000.2.v4.1 2943 2658.59 335 6.60024 Potri.016G087400.1.v4.1 270 57.6755 1617.89 1469.35 Potri.015G069301.1.v4.1 564 287.14 0 0 Potri.010G195200.1.v4.1 1773 1488.59 45 1.58345 Potri.012G127500.1.v4.1 977 692.619 6568 496.712 ==> SRR7169100.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1791 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 365 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169100 completed mapping pipeline successfully