Starting /dee2/code/volunteer_pipeline.sh SRR7169101 current disk space = 3057011548160 free memory = 1477755464 SRR7169101 SRAfilesize 9bb835af6b4ee6543f0192504947d25f SRR7169101.sra SRR7169101.sra file validated SRR7169101 is paired end SRR7169101 is conventional basespace SRR7169101 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169101_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8275 34.0 33.0 34.0 32.0 34.0 2 33.2995 34.0 33.0 34.0 33.0 34.0 3 33.361 34.0 33.0 34.0 33.0 34.0 4 33.4545 34.0 33.0 34.0 33.0 34.0 5 33.47875 34.0 33.0 34.0 33.0 34.0 6 36.9525 38.0 37.0 38.0 36.0 38.0 7 37.37925 38.0 38.0 38.0 37.0 38.0 8 37.49525 38.0 38.0 38.0 37.0 38.0 9 37.54125 38.0 38.0 38.0 37.0 38.0 10-14 37.44605 38.0 38.0 38.0 37.2 38.0 15-19 37.4147 38.0 38.0 38.0 37.0 38.0 20-24 37.27795 38.0 38.0 38.0 36.8 38.0 25-29 37.2624 38.0 38.0 38.0 37.0 38.0 30-34 37.2399 38.0 38.0 38.0 36.8 38.0 35-39 37.035199999999996 38.0 38.0 38.0 36.0 38.0 40-44 37.0317 38.0 38.0 38.0 36.0 38.0 45-49 36.90525 38.0 38.0 38.0 35.4 38.0 50-54 36.7669 38.0 38.0 38.0 34.6 38.0 55-59 36.75665 38.0 38.0 38.0 34.6 38.0 60-64 36.78315 38.0 38.0 38.0 34.8 38.0 65-69 36.6336 38.0 38.0 38.0 34.4 38.0 70-74 36.39789999999999 38.0 38.0 38.0 33.8 38.0 75-79 36.38895 38.0 37.4 38.0 33.6 38.0 80-84 35.879599999999996 38.0 36.8 38.0 31.6 38.0 85-89 36.104749999999996 38.0 37.0 38.0 33.2 38.0 90-94 35.9858 38.0 37.0 38.0 32.6 38.0 95-99 35.7967 38.0 36.8 38.0 31.2 38.0 100-104 35.3569 38.0 36.0 38.0 29.0 38.0 105-109 34.81635 38.0 35.2 38.0 26.8 38.0 110-114 34.8854 38.0 35.2 38.0 27.2 38.0 115-119 35.1644 38.0 36.0 38.0 28.2 38.0 120-124 34.48295 38.0 34.8 38.0 25.6 38.0 125-129 34.1006 38.0 34.0 38.0 23.0 38.0 130-134 33.933350000000004 38.0 34.0 38.0 22.6 38.0 135-139 33.65825 38.0 34.0 38.0 20.8 38.0 140-144 32.623400000000004 37.2 33.4 38.0 14.4 38.0 145-149 31.47525 36.2 31.8 38.0 11.2 38.0 150-151 27.346874999999997 35.0 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 0.0 14 3.0 15 2.0 16 1.0 17 4.0 18 2.0 19 6.0 20 7.0 21 8.0 22 8.0 23 9.0 24 15.0 25 24.0 26 28.0 27 37.0 28 49.0 29 60.0 30 65.0 31 73.0 32 118.0 33 131.0 34 243.0 35 430.0 36 881.0 37 1792.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.11614875191034 13.423331635252165 8.6856851757514 33.77483443708609 2 24.025 13.8 32.175 30.0 3 20.925 19.425 25.25 34.4 4 22.475 26.525 25.05 25.95 5 23.375 30.575000000000003 23.95 22.1 6 20.0 34.1 24.224999999999998 21.675 7 14.95 28.749999999999996 39.175 17.125 8 17.175 27.750000000000004 30.775000000000002 24.3 9 17.45 26.474999999999998 32.725 23.35 10-14 19.655 30.505 27.145000000000003 22.695 15-19 19.74 29.349999999999998 27.465 23.445 20-24 19.845 28.88 27.544999999999998 23.73 25-29 19.545 29.544999999999998 26.91 24.0 30-34 20.150000000000002 29.354999999999997 27.095000000000002 23.400000000000002 35-39 20.380000000000003 28.689999999999998 27.22 23.71 40-44 20.3 28.904999999999998 27.22 23.575 45-49 20.0 28.799999999999997 27.68 23.52 50-54 19.775000000000002 28.665000000000003 27.905 23.655 55-59 20.485 28.754999999999995 26.924999999999997 23.835 60-64 20.544999999999998 28.294999999999998 27.605 23.555 65-69 20.1 28.675 27.265 23.96 70-74 20.244999999999997 28.785 26.810000000000002 24.16 75-79 20.78 28.335 27.560000000000002 23.325000000000003 80-84 20.27 29.24 26.87 23.62 85-89 20.150000000000002 28.544999999999998 27.555000000000003 23.75 90-94 20.635 28.12 27.37 23.875 95-99 20.585 28.83 26.685 23.9 100-104 21.145 28.285 27.065 23.505000000000003 105-109 20.82 28.1 27.584999999999997 23.494999999999997 110-114 20.13 28.125 27.35 24.395 115-119 19.84 27.900000000000002 27.875 24.385 120-124 20.62 27.755000000000003 27.74 23.885 125-129 21.14 27.79 27.35 23.72 130-134 21.095 27.925 27.365000000000002 23.615 135-139 21.13 28.025 27.245 23.599999999999998 140-144 21.575 27.57 27.32 23.535 145-149 21.265 28.355000000000004 26.855 23.525 150-151 20.25 28.025 27.1125 24.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 2.0 25 4.0 26 6.5 27 7.0 28 7.5 29 12.5 30 17.0 31 19.0 32 23.5 33 34.5 34 55.0 35 76.5 36 84.5 37 103.5 38 129.5 39 153.5 40 180.5 41 214.5 42 244.0 43 263.0 44 278.5 45 270.0 46 267.5 47 273.5 48 233.5 49 192.5 50 177.0 51 149.5 52 123.0 53 105.5 54 75.5 55 48.0 56 37.0 57 30.5 58 27.0 59 20.5 60 15.5 61 9.0 62 5.5 63 6.5 64 5.5 65 2.0 66 0.5 67 1.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.8499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.07500000000000001 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.4875 0.0 0.0 0.0 0.0 126-127 0.55 0.0 0.0 0.0 0.0 128-129 0.6 0.0 0.0 0.0 0.0 130-131 0.6375 0.0 0.0 0.0 0.0 132-133 0.7375 0.0 0.0 0.0 0.0 134-135 0.875 0.0 0.0 0.0 0.0 136-137 0.9624999999999999 0.0 0.0 0.0 0.0 138-139 1.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACAGT 10 0.006577216 146.82278 1 CAGTTTC 10 0.006832588 144.9875 2 GACTTGT 10 0.006832588 144.9875 9 >>END_MODULE SRR7169101 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169101_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92325 33.0 33.0 34.0 32.0 34.0 2 32.89375 34.0 33.0 34.0 32.0 34.0 3 33.00025 34.0 33.0 34.0 32.0 34.0 4 32.85175 34.0 33.0 34.0 32.0 34.0 5 33.05125 34.0 33.0 34.0 32.0 34.0 6 37.1005 38.0 38.0 38.0 37.0 38.0 7 37.252 38.0 38.0 38.0 37.0 38.0 8 37.12525 38.0 38.0 38.0 37.0 38.0 9 37.07625 38.0 38.0 38.0 37.0 38.0 10-14 36.92895 38.0 38.0 38.0 36.0 38.0 15-19 37.15085 38.0 38.0 38.0 36.8 38.0 20-24 37.05105 38.0 38.0 38.0 36.4 38.0 25-29 36.982 38.0 38.0 38.0 36.0 38.0 30-34 37.0515 38.0 38.0 38.0 36.2 38.0 35-39 36.9443 38.0 38.0 38.0 36.0 38.0 40-44 36.7861 38.0 38.0 38.0 35.4 38.0 45-49 36.8799 38.0 38.0 38.0 36.0 38.0 50-54 36.91295 38.0 38.0 38.0 36.0 38.0 55-59 36.92139999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.77395 38.0 38.0 38.0 35.2 38.0 65-69 36.79815 38.0 38.0 38.0 35.4 38.0 70-74 36.68900000000001 38.0 38.0 38.0 35.2 38.0 75-79 36.56655 38.0 38.0 38.0 34.6 38.0 80-84 36.3959 38.0 38.0 38.0 34.0 38.0 85-89 36.3503 38.0 38.0 38.0 33.8 38.0 90-94 36.192150000000005 38.0 37.8 38.0 33.6 38.0 95-99 36.3883 38.0 38.0 38.0 34.0 38.0 100-104 36.211749999999995 38.0 38.0 38.0 33.6 38.0 105-109 36.00905 38.0 37.8 38.0 32.8 38.0 110-114 35.7667 38.0 37.0 38.0 31.2 38.0 115-119 35.55975 38.0 36.8 38.0 30.6 38.0 120-124 35.537 38.0 37.0 38.0 31.0 38.0 125-129 35.18125 38.0 36.0 38.0 28.4 38.0 130-134 34.71635 38.0 35.2 38.0 26.4 38.0 135-139 34.5137 38.0 35.0 38.0 25.6 38.0 140-144 34.2507 38.0 35.0 38.0 24.2 38.0 145-149 33.69259999999999 38.0 34.8 38.0 21.6 38.0 150-151 30.108249999999998 36.0 28.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 2.0 5 0.0 6 2.0 7 2.0 8 2.0 9 0.0 10 1.0 11 1.0 12 2.0 13 0.0 14 2.0 15 1.0 16 2.0 17 9.0 18 6.0 19 6.0 20 5.0 21 8.0 22 13.0 23 9.0 24 10.0 25 21.0 26 27.0 27 30.0 28 36.0 29 40.0 30 52.0 31 68.0 32 86.0 33 113.0 34 159.0 35 262.0 36 488.0 37 2535.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.9 23.1 13.450000000000001 24.55 2 29.45 25.55 27.250000000000004 17.75 3 21.5607803901951 27.763881940970485 30.515257628814407 20.16008004002001 4 22.611305652826413 33.691845922961484 24.537268634317158 19.15957978989495 5 26.506626656664167 33.983495873968494 21.43035758939735 18.079519879969993 6 21.725 38.125 22.45 17.7 7 20.125 22.95 38.1 18.825 8 23.599999999999998 25.474999999999998 26.05 24.875 9 21.85 25.974999999999998 28.475 23.7 10-14 23.1 29.215000000000003 26.534999999999997 21.15 15-19 23.665 27.985 27.284999999999997 21.065 20-24 23.080000000000002 28.34 27.715 20.865000000000002 25-29 23.175 28.715000000000003 27.134999999999998 20.974999999999998 30-34 23.905 28.51 26.865 20.72 35-39 23.355 27.939999999999998 27.595 21.11 40-44 23.64 27.805000000000003 27.675 20.880000000000003 45-49 23.39 28.110000000000003 27.505000000000003 20.995 50-54 23.615 27.575 27.825 20.985 55-59 23.95 27.85 27.125 21.075 60-64 23.630000000000003 28.294999999999998 27.625 20.45 65-69 23.35 27.93 27.985 20.735 70-74 23.96 27.715 27.505000000000003 20.82 75-79 24.11 26.86 27.765 21.265 80-84 24.154999999999998 27.525 27.894999999999996 20.424999999999997 85-89 24.165 27.435 27.815 20.585 90-94 24.275 27.315 27.66 20.75 95-99 23.745 28.33 27.245 20.68 100-104 24.45 27.26 27.529999999999998 20.76 105-109 23.91 27.41 28.22 20.46 110-114 23.965 27.83 27.425 20.78 115-119 23.84 27.37 27.57 21.22 120-124 23.52 27.794999999999998 27.950000000000003 20.735 125-129 24.05 27.615000000000002 27.33 21.005 130-134 23.905 27.57 27.76 20.765 135-139 23.68 27.855 27.834999999999997 20.630000000000003 140-144 23.77 27.615000000000002 27.68 20.935000000000002 145-149 24.04 27.800000000000004 27.605 20.555 150-151 23.3125 26.5875 28.549999999999997 21.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.0 25 2.0 26 1.5 27 2.5 28 5.0 29 6.0 30 9.5 31 11.0 32 19.0 33 30.0 34 38.5 35 47.0 36 60.0 37 89.5 38 124.0 39 151.5 40 185.5 41 226.0 42 262.5 43 286.0 44 291.0 45 299.5 46 292.0 47 263.0 48 228.0 49 206.5 50 186.0 51 156.5 52 126.0 53 99.5 54 81.5 55 61.0 56 37.5 57 26.5 58 26.0 59 18.0 60 11.0 61 6.5 62 6.0 63 5.5 64 3.5 65 1.5 66 1.0 67 1.5 68 1.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.05 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.2508780732563974 0.5 3 0.050175614651279475 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.07500000000000001 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.4875 0.0 0.0 0.0 0.0 126-127 0.55 0.0 0.0 0.0 0.0 128-129 0.6 0.0 0.0 0.0 0.0 130-131 0.65 0.0 0.0 0.0 0.0 132-133 0.75 0.0 0.0 0.0 0.0 134-135 0.875 0.0 0.0 0.0 0.0 136-137 0.9624999999999999 0.0 0.0 0.0 0.0 138-139 1.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849876 spots for SRR7169101.sra Written 849876 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra Read 849873 spots for SRR7169101.sra Written 849873 spots for SRR7169101.sra SRR ids: ['SRR7169101.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__schoi4_ SRR7169101.sra spots: 16997463 blocks: [[1, 849873], [849874, 1699746], [1699747, 2549619], [2549620, 3399492], [3399493, 4249365], [4249366, 5099238], [5099239, 5949111], [5949112, 6798984], [6798985, 7648857], [7648858, 8498730], [8498731, 9348603], [9348604, 10198476], [10198477, 11048349], [11048350, 11898222], [11898223, 12748095], [12748096, 13597968], [13597969, 14447841], [14447842, 15297714], [15297715, 16147587], [16147588, 16997463]] SRR7169101 file size 5738182 SRR7169101 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169101 SRR7169101_1.fastq SRR7169101_2.fastq Input file: SRR7169101_1.fastq Paired file: SRR7169101_2.fastq trimmed: SRR7169101-trimmed-pair1.fastq, SRR7169101-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:42:31 2025 >> started Mon Feb 10 21:42:50 2025 >> done (19.701s) 16997463 read pairs processed; of these: 11192 ( 0.07%) short read pairs filtered out after trimming by size control 6727 ( 0.04%) empty read pairs filtered out after trimming by size control 16979544 (99.89%) read pairs available; of these: 7346970 (43.27%) trimmed read pairs available after processing 9632574 (56.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 1 0.00% 21 3 0.00% 22 1 0.00% 23 3 0.00% 24 5 0.00% 25 4 0.00% 26 2 0.00% 27 8 0.00% 28 4 0.00% 29 5 0.00% 30 6 0.00% 31 2 0.00% 32 7 0.00% 33 7 0.00% 34 7 0.00% 35 8 0.00% 36 5 0.00% 37 9 0.00% 38 10 0.00% 39 11 0.00% 40 11 0.00% 41 12 0.00% 42 10 0.00% 43 13 0.00% 44 19 0.00% 45 14 0.00% 46 20 0.00% 47 17 0.00% 48 25 0.00% 49 18 0.00% 50 25 0.00% 51 19 0.00% 52 23 0.00% 53 28 0.00% 54 31 0.00% 55 45 0.00% 56 51 0.00% 57 42 0.00% 58 42 0.00% 59 65 0.00% 60 67 0.00% 61 64 0.00% 62 70 0.00% 63 79 0.00% 64 86 0.00% 65 100 0.00% 66 97 0.00% 67 122 0.00% 68 122 0.00% 69 162 0.00% 70 158 0.00% 71 171 0.00% 72 197 0.00% 73 227 0.00% 74 260 0.00% 75 246 0.00% 76 367 0.00% 77 369 0.00% 78 388 0.00% 79 407 0.00% 80 486 0.00% 81 578 0.00% 82 639 0.00% 83 762 0.00% 84 1325 0.01% 85 1691 0.01% 86 1841 0.01% 87 2095 0.01% 88 2243 0.01% 89 2278 0.01% 90 2387 0.01% 91 2477 0.01% 92 2558 0.02% 93 2680 0.02% 94 2739 0.02% 95 2917 0.02% 96 3274 0.02% 97 3471 0.02% 98 3603 0.02% 99 3860 0.02% 100 3999 0.02% 101 4476 0.03% 102 4713 0.03% 103 4927 0.03% 104 5480 0.03% 105 5701 0.03% 106 6214 0.04% 107 6539 0.04% 108 7072 0.04% 109 7290 0.04% 110 7891 0.05% 111 8259 0.05% 112 8744 0.05% 113 9549 0.06% 114 10332 0.06% 115 11092 0.07% 116 11627 0.07% 117 12476 0.07% 118 13352 0.08% 119 13832 0.08% 120 14482 0.09% 121 15244 0.09% 122 16275 0.10% 123 17383 0.10% 124 18632 0.11% 125 19988 0.12% 126 21535 0.13% 127 23049 0.14% 128 24813 0.15% 129 26733 0.16% 130 28380 0.17% 131 30665 0.18% 132 33211 0.20% 133 35987 0.21% 134 38812 0.23% 135 42771 0.25% 136 46879 0.28% 137 51374 0.30% 138 56829 0.33% 139 63273 0.37% 140 69997 0.41% 141 79042 0.47% 142 89922 0.53% 143 104936 0.62% 144 125766 0.74% 145 154185 0.91% 146 201306 1.19% 147 278162 1.64% 148 433623 2.55% 149 850142 5.01% 150 4121702 24.27% 151 9632574 56.73% 16979544 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=39 prefix-density=0.19 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=415.13 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=21.4 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=40 prefix-density=0.22 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=295.69 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=8.4 sequence=TCTTCCTCTTCACAATTAGCAAACAGTAAGTTTGAACACACTCAAGATTTGAAATATCCTACAACGATGAGAAAGCAACTCCTCTCCCCATTCGTTCCTTTCTTGATGTTCTTCCTCTACAGCTCCACCACTTTTGCTCAAACCCCATCTCCAGCACCTTCAGGTCCAACCAACATAACGGCGATCCTTGCGAAAGCTGGTCAGTTCACAACCTTAATTCGGTTGTTGAAAAGCACCCAAGAGGCTGACCAAATCAACACACAACTCAACAATTCAAACCAAGGCCTAACAGTCTTTGCACCAACTGATAATTCCTTTGCTAA SRR7169101 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:43:43 Started mapping on | Feb 10 21:43:43 Finished on | Feb 10 21:46:08 Mapping speed, Million of reads per hour | 421.56 Number of input reads | 16979544 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15888073 Uniquely mapped reads % | 93.57% Average mapped length | 297.30 Number of splices: Total | 15244509 Number of splices: Annotated (sjdb) | 14993803 Number of splices: GT/AG | 15021250 Number of splices: GC/AG | 179936 Number of splices: AT/AC | 12120 Number of splices: Non-canonical | 31203 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 300614 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 17783 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.52% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 805424 805424 805424 N_multimapping 300614 300614 300614 N_noFeature 326153 15701044 406961 N_ambiguous 173885 942 67054 UnstrandedReadsAssigned:15388035 PositiveStrandReadsAssigned:186087 NegativeStrandReadsAssigned:15414058 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169101 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169101-trimmed-pair1.fastq SRR7169101-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,979,544 reads, 15,291,999 reads pseudoaligned [quant] estimated average fragment length: 281.091 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR7169101.ke.tsv 34699 SRR7169101.se.tsv 87100 total ==> SRR7169101.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.91 328 10.6927 Potri.005G024800.1.v4.1 1035 754.909 33 2.47663 Potri.004G059700.1.v4.1 961 680.939 10 0.832018 Potri.007G009000.2.v4.1 1416 1135.91 0 0 Potri.003G141000.2.v4.1 2943 2662.91 295.067 6.27776 Potri.016G087400.1.v4.1 270 58.4642 1490.07 1443.97 Potri.015G069301.1.v4.1 564 290.837 0 0 Potri.010G195200.1.v4.1 1773 1492.91 17 0.645144 Potri.012G127500.1.v4.1 977 696.927 6461 525.235 ==> SRR7169101.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1450 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 300 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169101 completed mapping pipeline successfully