Starting /dee2/code/volunteer_pipeline.sh SRR7169102 current disk space = 3057324294144 free memory = 1579726168 SRR7169102 SRAfilesize 47ab118509a0f9f7fc335a6b19292010 SRR7169102.sra SRR7169102.sra file validated SRR7169102 is paired end SRR7169102 is conventional basespace SRR7169102 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169102_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.016 34.0 33.0 34.0 33.0 34.0 2 33.35525 34.0 34.0 34.0 33.0 34.0 3 33.4255 34.0 34.0 34.0 33.0 34.0 4 33.49375 34.0 34.0 34.0 33.0 34.0 5 33.4925 34.0 34.0 34.0 33.0 34.0 6 36.96925 38.0 37.0 38.0 36.0 38.0 7 37.3215 38.0 38.0 38.0 37.0 38.0 8 37.41 38.0 38.0 38.0 37.0 38.0 9 37.43825 38.0 38.0 38.0 37.0 38.0 10-14 37.47515 38.0 38.0 38.0 37.6 38.0 15-19 37.4486 38.0 38.0 38.0 37.2 38.0 20-24 37.4447 38.0 38.0 38.0 37.0 38.0 25-29 37.41844999999999 38.0 38.0 38.0 37.2 38.0 30-34 37.3858 38.0 38.0 38.0 37.0 38.0 35-39 37.246500000000005 38.0 38.0 38.0 36.8 38.0 40-44 36.9883 38.0 38.0 38.0 35.8 38.0 45-49 36.88475 38.0 38.0 38.0 35.2 38.0 50-54 36.8104 38.0 38.0 38.0 35.0 38.0 55-59 36.72395 38.0 38.0 38.0 34.6 38.0 60-64 36.63315 38.0 38.0 38.0 34.2 38.0 65-69 36.517300000000006 38.0 38.0 38.0 34.0 38.0 70-74 36.46365000000001 38.0 38.0 38.0 34.0 38.0 75-79 36.30714999999999 38.0 37.0 38.0 33.6 38.0 80-84 36.193650000000005 38.0 37.0 38.0 33.2 38.0 85-89 36.0339 38.0 37.0 38.0 32.6 38.0 90-94 35.892900000000004 38.0 37.0 38.0 31.2 38.0 95-99 35.755750000000006 38.0 37.0 38.0 30.6 38.0 100-104 35.560849999999995 38.0 36.2 38.0 30.6 38.0 105-109 35.4385 38.0 36.0 38.0 29.8 38.0 110-114 35.0499 38.0 35.8 38.0 28.2 38.0 115-119 34.8179 38.0 35.0 38.0 27.6 38.0 120-124 34.4528 38.0 34.8 38.0 25.0 38.0 125-129 34.16795 38.0 34.6 38.0 24.0 38.0 130-134 33.8348 38.0 34.2 38.0 22.6 38.0 135-139 33.270849999999996 38.0 33.8 38.0 17.4 38.0 140-144 32.73695 38.0 33.2 38.0 14.4 38.0 145-149 31.86605 37.2 32.8 38.0 11.4 38.0 150-151 27.720375 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 2.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 3.0 16 4.0 17 6.0 18 5.0 19 7.0 20 6.0 21 13.0 22 15.0 23 14.0 24 19.0 25 23.0 26 19.0 27 29.0 28 40.0 29 52.0 30 56.0 31 72.0 32 86.0 33 120.0 34 205.0 35 418.0 36 966.0 37 1817.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.449201925513044 13.630605523182163 10.894350139346338 34.02584241195845 2 25.775 13.700000000000001 29.549999999999997 30.975 3 20.849999999999998 17.025000000000002 26.650000000000002 35.475 4 22.7 22.45 24.125 30.725 5 23.200000000000003 27.3 25.025 24.474999999999998 6 22.0 31.85 23.375 22.775000000000002 7 16.75 29.549999999999997 36.85 16.85 8 17.299999999999997 28.875 30.825000000000003 23.0 9 18.224999999999998 27.325 32.85 21.6 10-14 19.695 30.585 27.200000000000003 22.52 15-19 19.759999999999998 29.085 27.589999999999996 23.565 20-24 19.564999999999998 29.630000000000003 27.310000000000002 23.494999999999997 25-29 19.6 29.585 27.185 23.630000000000003 30-34 20.275000000000002 29.29 26.44 23.995 35-39 19.925 28.79 27.3 23.985 40-44 19.82 29.505 26.740000000000002 23.935000000000002 45-49 20.4 28.51 27.339999999999996 23.75 50-54 20.544999999999998 28.144999999999996 27.375 23.935000000000002 55-59 20.11 28.904999999999998 26.775 24.21 60-64 19.755 28.395 27.725 24.125 65-69 20.07 28.189999999999998 27.560000000000002 24.18 70-74 20.055 28.22 27.555000000000003 24.169999999999998 75-79 20.285 27.525 27.639999999999997 24.55 80-84 20.155 28.544999999999998 27.595 23.705000000000002 85-89 20.395 28.43 26.974999999999998 24.2 90-94 20.625 27.474999999999998 27.405 24.495 95-99 20.53 27.755000000000003 27.305 24.41 100-104 20.21 28.21 27.779999999999998 23.799999999999997 105-109 21.235 27.605 27.26 23.9 110-114 20.365 28.299999999999997 27.235 24.099999999999998 115-119 20.645 27.665 27.450000000000003 24.240000000000002 120-124 20.59 27.694999999999997 27.42 24.295 125-129 20.89 27.145000000000003 27.834999999999997 24.13 130-134 20.255000000000003 28.455000000000002 27.334999999999997 23.955000000000002 135-139 20.57 28.075 27.175 24.18 140-144 20.59 27.42 27.794999999999998 24.195 145-149 21.4 27.255000000000003 27.229999999999997 24.115000000000002 150-151 20.8875 27.712500000000002 26.525 24.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 3.0 24 3.0 25 1.5 26 4.5 27 10.0 28 12.5 29 9.5 30 13.5 31 19.5 32 20.0 33 32.5 34 55.0 35 69.0 36 89.0 37 111.0 38 127.5 39 155.0 40 177.0 41 200.0 42 225.5 43 244.5 44 264.0 45 270.5 46 262.0 47 248.0 48 240.5 49 212.5 50 181.5 51 164.5 52 123.0 53 93.5 54 89.5 55 70.5 56 50.0 57 37.0 58 26.5 59 18.5 60 10.0 61 8.5 62 10.5 63 7.5 64 3.5 65 6.5 66 6.5 67 3.5 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.44999999999999996 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.5625 0.0 0.0 0.0 0.0 126-127 0.5874999999999999 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.05 0.0 0.0 0.0 0.0 138-139 1.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169102 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169102_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7605 33.0 33.0 34.0 32.0 34.0 2 32.866 34.0 33.0 34.0 32.0 34.0 3 32.894 34.0 33.0 34.0 32.0 34.0 4 32.8185 34.0 33.0 34.0 32.0 34.0 5 32.74225 34.0 33.0 34.0 32.0 34.0 6 36.9295 38.0 38.0 38.0 36.0 38.0 7 36.9835 38.0 38.0 38.0 36.0 38.0 8 36.8795 38.0 38.0 38.0 36.0 38.0 9 37.0255 38.0 38.0 38.0 36.0 38.0 10-14 36.9545 38.0 38.0 38.0 36.4 38.0 15-19 36.96635 38.0 38.0 38.0 36.6 38.0 20-24 36.94015 38.0 38.0 38.0 36.4 38.0 25-29 36.93294999999999 38.0 38.0 38.0 36.6 38.0 30-34 36.9976 38.0 38.0 38.0 36.6 38.0 35-39 36.902550000000005 38.0 38.0 38.0 36.4 38.0 40-44 36.82795 38.0 38.0 38.0 36.0 38.0 45-49 36.75170000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.8067 38.0 38.0 38.0 36.0 38.0 55-59 36.77175 38.0 38.0 38.0 36.0 38.0 60-64 36.73665 38.0 38.0 38.0 35.8 38.0 65-69 36.656600000000005 38.0 38.0 38.0 35.4 38.0 70-74 36.51735 38.0 38.0 38.0 35.0 38.0 75-79 36.501599999999996 38.0 38.0 38.0 34.8 38.0 80-84 36.4967 38.0 38.0 38.0 34.8 38.0 85-89 36.530649999999994 38.0 38.0 38.0 34.8 38.0 90-94 36.4428 38.0 38.0 38.0 34.2 38.0 95-99 36.209950000000006 38.0 38.0 38.0 34.0 38.0 100-104 36.08055 38.0 38.0 38.0 34.0 38.0 105-109 36.028299999999994 38.0 38.0 38.0 33.8 38.0 110-114 35.78805 38.0 38.0 38.0 33.0 38.0 115-119 35.6844 38.0 37.4 38.0 32.4 38.0 120-124 35.4597 38.0 37.0 38.0 31.0 38.0 125-129 35.2943 38.0 36.8 38.0 30.6 38.0 130-134 35.03605 38.0 36.0 38.0 29.0 38.0 135-139 34.56515 38.0 36.0 38.0 26.4 38.0 140-144 34.3635 38.0 35.4 38.0 25.8 38.0 145-149 33.5923 38.0 35.0 38.0 17.6 38.0 150-151 30.057375 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 3.0 4 1.0 5 1.0 6 3.0 7 3.0 8 0.0 9 1.0 10 1.0 11 2.0 12 1.0 13 1.0 14 5.0 15 2.0 16 6.0 17 6.0 18 10.0 19 7.0 20 10.0 21 10.0 22 8.0 23 16.0 24 12.0 25 19.0 26 20.0 27 28.0 28 34.0 29 45.0 30 46.0 31 64.0 32 68.0 33 96.0 34 98.0 35 196.0 36 430.0 37 2738.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.25 21.875 14.524999999999999 27.35 2 29.025000000000002 27.175 25.874999999999996 17.925 3 21.825 29.125 28.7 20.349999999999998 4 23.175 33.925 23.95 18.95 5 24.9 34.625 22.675 17.8 6 21.75 38.375 22.15 17.724999999999998 7 22.175 22.275 35.975 19.575 8 23.25 25.825 26.075 24.85 9 21.75 26.200000000000003 28.549999999999997 23.5 10-14 23.830000000000002 29.225 25.759999999999998 21.185000000000002 15-19 23.599999999999998 27.825 27.11 21.465 20-24 23.080000000000002 28.689999999999998 26.939999999999998 21.29 25-29 23.445 28.560000000000002 26.334999999999997 21.66 30-34 23.215 28.375 27.11 21.3 35-39 24.115000000000002 27.889999999999997 26.75 21.245 40-44 23.91 28.439999999999998 26.525 21.125 45-49 23.36 27.74 27.435 21.465 50-54 24.355 27.595 27.07 20.979999999999997 55-59 24.375 27.685 26.805 21.135 60-64 23.855 28.310000000000002 26.810000000000002 21.025 65-69 23.707155742633795 27.751052315093204 27.04950891962317 21.49228302264983 70-74 23.939637019953874 28.090845282262105 26.827434071994382 21.14208362578963 75-79 24.13274513735713 27.586725486264285 27.67194706236214 20.608582314016445 80-84 23.91739173917392 27.652765276527653 27.3977397739774 21.032103210321033 85-89 24.125 28.09 26.895000000000003 20.89 90-94 24.685000000000002 27.36 27.500000000000004 20.455000000000002 95-99 24.005000000000003 27.675 27.255000000000003 21.065 100-104 24.36 27.800000000000004 26.784999999999997 21.055 105-109 24.349999999999998 28.005000000000003 26.595000000000002 21.05 110-114 24.495 27.884999999999998 26.76 20.86 115-119 24.240000000000002 27.365000000000002 26.96 21.435000000000002 120-124 23.815 28.315 27.115000000000002 20.755000000000003 125-129 23.895 28.410000000000004 26.915 20.78 130-134 24.154999999999998 28.025 27.384999999999998 20.435 135-139 24.047214164249276 27.513253976192857 27.143142942882864 21.296388916675003 140-144 24.271553018924603 27.841193551617106 27.34554921397817 20.541704215480124 145-149 24.785380792208443 28.0887594758773 26.472212460464885 20.653647271449373 150-151 24.300478951348627 27.060751197378373 27.716158306024703 20.922611545248298 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 2.5 27 3.0 28 4.0 29 4.0 30 6.5 31 10.0 32 8.5 33 15.5 34 28.0 35 40.5 36 54.5 37 76.0 38 111.5 39 137.0 40 175.0 41 226.0 42 240.0 43 272.0 44 294.0 45 298.0 46 310.0 47 305.0 48 275.5 49 215.0 50 186.0 51 180.5 52 142.0 53 100.0 54 72.0 55 49.5 56 37.5 57 26.0 58 18.5 59 14.0 60 10.5 61 13.0 62 12.5 63 6.5 64 4.0 65 2.5 66 1.5 67 1.5 68 2.5 69 1.0 70 1.0 71 1.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.22 70-74 0.27 75-79 0.26 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.03 140-144 0.13 145-149 0.40499999999999997 150-151 0.8250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.44999999999999996 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.5874999999999999 0.0 0.0 0.0 0.0 126-127 0.6125 0.0 0.0 0.0 0.0 128-129 0.7124999999999999 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.0625 0.0 0.0 0.0 0.0 136-137 1.125 0.0 0.0 0.0 0.0 138-139 1.1749999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792718 spots for SRR7169102.sra Written 792718 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra Read 792717 spots for SRR7169102.sra Written 792717 spots for SRR7169102.sra SRR ids: ['SRR7169102.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jrwov8uz SRR7169102.sra spots: 15854341 blocks: [[1, 792717], [792718, 1585434], [1585435, 2378151], [2378152, 3170868], [3170869, 3963585], [3963586, 4756302], [4756303, 5549019], [5549020, 6341736], [6341737, 7134453], [7134454, 7927170], [7927171, 8719887], [8719888, 9512604], [9512605, 10305321], [10305322, 11098038], [11098039, 11890755], [11890756, 12683472], [12683473, 13476189], [13476190, 14268906], [14268907, 15061623], [15061624, 15854341]] SRR7169102 file size 5350815 SRR7169102 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169102 SRR7169102_1.fastq SRR7169102_2.fastq Input file: SRR7169102_1.fastq Paired file: SRR7169102_2.fastq trimmed: SRR7169102-trimmed-pair1.fastq, SRR7169102-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:23:38 2025 >> started Mon Feb 10 22:23:55 2025 >> done (16.891s) 15854341 read pairs processed; of these: 20146 ( 0.13%) short read pairs filtered out after trimming by size control 18459 ( 0.12%) empty read pairs filtered out after trimming by size control 15815736 (99.76%) read pairs available; of these: 7303274 (46.18%) trimmed read pairs available after processing 8512462 (53.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 3 0.00% 21 2 0.00% 22 3 0.00% 23 6 0.00% 24 3 0.00% 25 10 0.00% 26 8 0.00% 27 16 0.00% 28 7 0.00% 29 4 0.00% 30 12 0.00% 31 12 0.00% 32 8 0.00% 33 11 0.00% 34 7 0.00% 35 10 0.00% 36 12 0.00% 37 14 0.00% 38 17 0.00% 39 14 0.00% 40 12 0.00% 41 22 0.00% 42 15 0.00% 43 20 0.00% 44 29 0.00% 45 24 0.00% 46 29 0.00% 47 26 0.00% 48 41 0.00% 49 51 0.00% 50 40 0.00% 51 37 0.00% 52 52 0.00% 53 52 0.00% 54 56 0.00% 55 65 0.00% 56 77 0.00% 57 63 0.00% 58 69 0.00% 59 90 0.00% 60 89 0.00% 61 123 0.00% 62 130 0.00% 63 114 0.00% 64 129 0.00% 65 138 0.00% 66 154 0.00% 67 176 0.00% 68 176 0.00% 69 203 0.00% 70 227 0.00% 71 260 0.00% 72 285 0.00% 73 322 0.00% 74 327 0.00% 75 392 0.00% 76 420 0.00% 77 505 0.00% 78 530 0.00% 79 593 0.00% 80 703 0.00% 81 738 0.00% 82 885 0.01% 83 1017 0.01% 84 1843 0.01% 85 2403 0.02% 86 2336 0.01% 87 2563 0.02% 88 2619 0.02% 89 2712 0.02% 90 2789 0.02% 91 2850 0.02% 92 3002 0.02% 93 3273 0.02% 94 3475 0.02% 95 3612 0.02% 96 3944 0.02% 97 4204 0.03% 98 4633 0.03% 99 4911 0.03% 100 5101 0.03% 101 5263 0.03% 102 5662 0.04% 103 6000 0.04% 104 6583 0.04% 105 7017 0.04% 106 7505 0.05% 107 7933 0.05% 108 8305 0.05% 109 8839 0.06% 110 9615 0.06% 111 10227 0.06% 112 10754 0.07% 113 11455 0.07% 114 11942 0.08% 115 13002 0.08% 116 13572 0.09% 117 14443 0.09% 118 15717 0.10% 119 16441 0.10% 120 17285 0.11% 121 18408 0.12% 122 19694 0.12% 123 20533 0.13% 124 22098 0.14% 125 23615 0.15% 126 25063 0.16% 127 26887 0.17% 128 28515 0.18% 129 30622 0.19% 130 32748 0.21% 131 35462 0.22% 132 38324 0.24% 133 40742 0.26% 134 43945 0.28% 135 47273 0.30% 136 51774 0.33% 137 57001 0.36% 138 63722 0.40% 139 70756 0.45% 140 77865 0.49% 141 85386 0.54% 142 96137 0.61% 143 110447 0.70% 144 130494 0.83% 145 159376 1.01% 146 204354 1.29% 147 282511 1.79% 148 442495 2.80% 149 880425 5.57% 150 3863080 24.43% 151 8512462 53.82% 15815736 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=40 prefix-density=0.24 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=204.01 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=15.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=6.85 fanout-score-rank=20 prefix-density=0.31 prefix-fanout=4.2 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=176.29 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=14.7 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169102 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:24:41 Started mapping on | Feb 10 22:24:41 Finished on | Feb 10 22:26:17 Mapping speed, Million of reads per hour | 593.09 Number of input reads | 15815736 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14899635 Uniquely mapped reads % | 94.21% Average mapped length | 296.52 Number of splices: Total | 14085546 Number of splices: Annotated (sjdb) | 13864119 Number of splices: GT/AG | 13882829 Number of splices: GC/AG | 161705 Number of splices: AT/AC | 11494 Number of splices: Non-canonical | 29518 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 293134 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 26220 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.74% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 641232 641232 641232 N_multimapping 293134 293134 293134 N_noFeature 243795 14725235 307026 N_ambiguous 172977 1269 60975 UnstrandedReadsAssigned:14482863 PositiveStrandReadsAssigned:173131 NegativeStrandReadsAssigned:14531634 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169102 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169102-trimmed-pair1.fastq SRR7169102-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,815,736 reads, 14,436,965 reads pseudoaligned [quant] estimated average fragment length: 270.817 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR7169102.ke.tsv 34699 SRR7169102.se.tsv 87100 total ==> SRR7169102.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.18 296 9.29925 Potri.005G024800.1.v4.1 1035 765.183 69 4.95253 Potri.004G059700.1.v4.1 961 691.217 4 0.317825 Potri.007G009000.2.v4.1 1416 1146.18 0 0 Potri.003G141000.2.v4.1 2943 2673.18 248 5.09526 Potri.016G087400.1.v4.1 270 59.7401 1420.53 1305.95 Potri.015G069301.1.v4.1 564 298.582 0 0 Potri.010G195200.1.v4.1 1773 1503.18 14 0.511516 Potri.012G127500.1.v4.1 977 707.195 5506 427.603 ==> SRR7169102.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1259 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 219 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169102 completed mapping pipeline successfully