Starting /dee2/code/volunteer_pipeline.sh SRR7169103 current disk space = 3056914513920 free memory = 1416877840 SRR7169103 SRAfilesize 1e050dbb7de96cff85065e0c28e22879 SRR7169103.sra SRR7169103.sra file validated SRR7169103 is paired end SRR7169103 is conventional basespace SRR7169103 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169103_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.85 34.0 33.0 34.0 32.0 34.0 2 33.23325 34.0 33.0 34.0 32.0 34.0 3 33.32825 34.0 33.0 34.0 32.0 34.0 4 33.4895 34.0 33.0 34.0 33.0 34.0 5 33.35325 34.0 33.0 34.0 33.0 34.0 6 37.12625 38.0 37.0 38.0 36.0 38.0 7 35.564 38.0 37.0 38.0 29.0 38.0 8 36.229 38.0 37.0 38.0 31.0 38.0 9 37.14075 38.0 38.0 38.0 36.0 38.0 10-14 37.31375 38.0 38.0 38.0 36.8 38.0 15-19 37.058499999999995 38.0 38.0 38.0 36.0 38.0 20-24 37.37910000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.251 38.0 38.0 38.0 36.8 38.0 30-34 37.2447 38.0 38.0 38.0 37.0 38.0 35-39 37.313 38.0 38.0 38.0 36.8 38.0 40-44 36.78345 38.0 37.8 38.0 34.6 38.0 45-49 36.69505 38.0 38.0 38.0 34.8 38.0 50-54 36.38195 38.0 37.4 38.0 33.2 38.0 55-59 36.3275 38.0 37.2 38.0 33.2 38.0 60-64 36.453500000000005 38.0 37.8 38.0 33.4 38.0 65-69 36.3289 38.0 37.0 38.0 33.4 38.0 70-74 36.068400000000004 38.0 37.0 38.0 32.6 38.0 75-79 36.3042 38.0 37.0 38.0 33.6 38.0 80-84 36.14555 38.0 37.0 38.0 32.8 38.0 85-89 35.830149999999996 38.0 36.6 38.0 31.4 38.0 90-94 35.7385 38.0 36.8 38.0 30.8 38.0 95-99 35.4894 38.0 36.0 38.0 29.6 38.0 100-104 35.01755 38.0 35.6 38.0 27.6 38.0 105-109 34.4652 38.0 34.6 38.0 23.6 38.0 110-114 34.4658 38.0 34.4 38.0 25.2 38.0 115-119 34.3806 38.0 34.6 38.0 25.2 38.0 120-124 33.9837 38.0 34.0 38.0 23.0 38.0 125-129 33.6811 38.0 34.0 38.0 22.2 38.0 130-134 33.38075 37.8 33.6 38.0 20.2 38.0 135-139 32.78255 37.4 32.4 38.0 17.4 38.0 140-144 31.5551 36.0 30.6 38.0 13.4 38.0 145-149 30.078699999999998 36.0 29.2 38.0 8.6 38.0 150-151 25.079500000000003 33.0 14.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 2.0 17 6.0 18 4.0 19 3.0 20 8.0 21 9.0 22 18.0 23 11.0 24 23.0 25 22.0 26 30.0 27 40.0 28 47.0 29 57.0 30 73.0 31 112.0 32 127.0 33 193.0 34 287.0 35 551.0 36 1118.0 37 1253.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.8566166798211 12.996579847408576 8.760852407261247 33.385951065509076 2 24.0 13.575000000000001 33.75 28.675 3 19.45 18.4 27.400000000000002 34.75 4 21.875 26.674999999999997 23.674999999999997 27.775 5 23.05 32.175 24.025 20.75 6 20.4 35.35 24.2 20.05 7 15.475 27.875 40.1 16.55 8 17.45 26.200000000000003 31.175000000000004 25.174999999999997 9 16.525000000000002 24.825 34.325 24.325 10-14 19.97 29.595 27.42 23.015 15-19 20.11 28.915000000000003 27.145000000000003 23.830000000000002 20-24 19.891989198919894 28.797879787978797 27.402740274027405 23.907390739073907 25-29 20.215 29.544999999999998 27.04 23.200000000000003 30-34 19.577936690503574 28.839325898884834 27.49412411861779 24.0886132919938 35-39 20.382038203820382 28.922892289228923 26.652665266526654 24.04240424042404 40-44 20.285071267816953 29.692423105776445 26.791697924481124 23.23080770192548 45-49 19.98 28.794999999999998 27.305 23.919999999999998 50-54 20.37101855092755 28.371418570928547 27.616380819040952 23.641182059102956 55-59 20.215 28.605000000000004 27.24 23.94 60-64 20.051002550127507 28.641432071603578 27.68638431921596 23.621181059052955 65-69 19.975 28.03 27.96 24.035 70-74 20.136006800340017 28.7964398219911 27.226361318065905 23.84119205960298 75-79 19.86 28.57 27.794999999999998 23.775 80-84 20.48 28.53 26.515 24.474999999999998 85-89 19.885994299714984 28.491424571228563 27.60138006900345 24.021201060053002 90-94 20.39907981596319 28.185637127425483 27.510502100420087 23.90478095619124 95-99 20.075000000000003 28.01 28.1 23.815 100-104 20.405 27.87 27.744999999999997 23.98 105-109 20.424999999999997 28.345 27.165 24.065 110-114 20.54 28.03 27.68 23.75 115-119 20.235 27.985 27.72 24.060000000000002 120-124 20.275000000000002 27.77 27.68 24.275 125-129 20.169999999999998 27.779999999999998 28.115000000000002 23.935000000000002 130-134 20.335 28.13 27.48 24.055 135-139 20.42306345951893 27.839175876381457 27.879181877281596 23.858578786818022 140-144 20.336016800840042 27.996399819990998 27.626381319065953 24.041202060103007 145-149 20.92627788336501 28.0334100230069 27.463238971691506 23.577073121936582 150-151 20.025000000000002 28.050000000000004 28.0625 23.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 3.5 24 4.0 25 1.5 26 3.0 27 5.5 28 7.5 29 12.5 30 16.5 31 19.0 32 28.5 33 43.5 34 55.5 35 65.0 36 77.5 37 97.5 38 131.0 39 157.0 40 185.5 41 234.5 42 245.5 43 244.5 44 271.5 45 266.5 46 264.5 47 271.0 48 247.5 49 214.5 50 175.5 51 138.5 52 120.0 53 103.5 54 71.5 55 50.0 56 41.0 57 29.5 58 21.5 59 21.0 60 14.5 61 6.5 62 5.5 63 4.5 64 3.5 65 4.0 66 4.5 67 3.0 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.9750000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.0 30-34 0.015 35-39 0.01 40-44 0.025 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.005 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.02 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.015 140-144 0.005 145-149 0.03 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.0875 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.16249999999999998 0.0 0.0 0.0 0.0 120-121 0.2 0.0 0.0 0.0 0.0 122-123 0.2625 0.0 0.0 0.0 0.0 124-125 0.3625 0.0 0.0 0.0 0.0 126-127 0.4 0.0 0.0 0.0 0.0 128-129 0.48750000000000004 0.0 0.0 0.0 0.0 130-131 0.5875 0.0 0.0 0.0 0.0 132-133 0.65 0.0 0.0 0.0 0.0 134-135 0.7 0.0 0.0 0.0 0.0 136-137 0.775 0.0 0.0 0.0 0.0 138-139 0.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGCTGC 10 0.006836113 144.9625 2 >>END_MODULE SRR7169103 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169103_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0115 34.0 33.0 34.0 32.0 34.0 2 33.055 34.0 33.0 34.0 33.0 34.0 3 33.01 34.0 33.0 34.0 32.0 34.0 4 33.02175 34.0 33.0 34.0 32.0 34.0 5 33.0345 34.0 33.0 34.0 33.0 34.0 6 37.18825 38.0 38.0 38.0 37.0 38.0 7 37.1685 38.0 38.0 38.0 37.0 38.0 8 36.6205 38.0 38.0 38.0 35.0 38.0 9 37.04725 38.0 38.0 38.0 36.0 38.0 10-14 37.09675 38.0 38.0 38.0 37.0 38.0 15-19 37.1524 38.0 38.0 38.0 37.0 38.0 20-24 37.0708 38.0 38.0 38.0 37.0 38.0 25-29 37.13625 38.0 38.0 38.0 37.0 38.0 30-34 37.134100000000004 38.0 38.0 38.0 37.0 38.0 35-39 36.841499999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.8894 38.0 38.0 38.0 36.0 38.0 45-49 36.999900000000004 38.0 38.0 38.0 36.6 38.0 50-54 36.967400000000005 38.0 38.0 38.0 36.2 38.0 55-59 36.910900000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.765950000000004 38.0 38.0 38.0 35.8 38.0 65-69 36.718650000000004 38.0 38.0 38.0 35.4 38.0 70-74 36.6423 38.0 38.0 38.0 35.0 38.0 75-79 36.56485 38.0 38.0 38.0 34.6 38.0 80-84 36.43145 38.0 38.0 38.0 34.4 38.0 85-89 36.16015 38.0 38.0 38.0 33.2 38.0 90-94 36.17215 38.0 38.0 38.0 33.6 38.0 95-99 36.20635 38.0 38.0 38.0 33.8 38.0 100-104 36.115649999999995 38.0 38.0 38.0 33.8 38.0 105-109 35.85165 38.0 37.4 38.0 32.0 38.0 110-114 35.573499999999996 38.0 37.0 38.0 30.6 38.0 115-119 35.38445 38.0 36.6 38.0 30.0 38.0 120-124 35.451350000000005 38.0 36.8 38.0 31.0 38.0 125-129 34.82085 38.0 35.6 38.0 26.6 38.0 130-134 34.4293 38.0 35.0 38.0 24.4 38.0 135-139 33.996249999999996 38.0 35.0 38.0 22.6 38.0 140-144 33.699799999999996 38.0 34.2 38.0 21.8 38.0 145-149 32.74085 38.0 33.2 38.0 13.6 38.0 150-151 28.612625 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 1.0 5 1.0 6 0.0 7 0.0 8 2.0 9 1.0 10 3.0 11 0.0 12 3.0 13 1.0 14 5.0 15 7.0 16 5.0 17 3.0 18 7.0 19 5.0 20 5.0 21 5.0 22 10.0 23 18.0 24 19.0 25 14.0 26 25.0 27 31.0 28 33.0 29 51.0 30 44.0 31 70.0 32 79.0 33 98.0 34 163.0 35 238.0 36 560.0 37 2484.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.525 24.975 11.625 22.875 2 28.1 26.400000000000002 28.275 17.224999999999998 3 21.6 28.65 30.8 18.95 4 24.099999999999998 32.95 23.974999999999998 18.975 5 24.55 35.975 21.7 17.775 6 21.775 37.574999999999996 21.925 18.725 7 20.150000000000002 23.25 38.550000000000004 18.05 8 22.325 24.95 28.1 24.625 9 21.525 24.525 30.25 23.7 10-14 23.87 27.96 27.255000000000003 20.915 15-19 22.395 28.345 27.375 21.884999999999998 20-24 23.31 27.48 28.105000000000004 21.105 25-29 23.1 28.310000000000002 27.125 21.465 30-34 22.62 28.110000000000003 28.000000000000004 21.27 35-39 23.02 27.74 27.755000000000003 21.485000000000003 40-44 23.32 28.08 27.74 20.86 45-49 23.380000000000003 27.67 27.525 21.425 50-54 22.98 28.610000000000003 27.67 20.74 55-59 23.805 27.915 27.855 20.424999999999997 60-64 23.525 28.595 27.275 20.605 65-69 23.705000000000002 27.63 27.915 20.75 70-74 23.535 27.905 28.165000000000003 20.395 75-79 23.845 27.900000000000002 27.839999999999996 20.415 80-84 23.365 27.650000000000002 27.58 21.404999999999998 85-89 23.89 27.36 27.73 21.02 90-94 23.275000000000002 28.09 27.43 21.205 95-99 23.169999999999998 27.950000000000003 28.035 20.845 100-104 23.926196309815488 27.60638031901595 27.84639231961598 20.621031051552578 105-109 23.705000000000002 27.685 28.04 20.57 110-114 23.665 27.700000000000003 28.08 20.555 115-119 24.18 27.525 27.82 20.474999999999998 120-124 23.669999999999998 27.98 27.279999999999998 21.07 125-129 23.65354803220483 27.759163874581187 27.529129369405407 21.05815872380857 130-134 24.275 28.205000000000002 27.485 20.035 135-139 24.255 27.735 27.955000000000002 20.055 140-144 23.91 28.294999999999998 27.025 20.77 145-149 24.165 28.084999999999997 27.37 20.380000000000003 150-151 24.375 27.975 27.6 20.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 0.5 26 2.0 27 3.0 28 3.0 29 7.0 30 9.5 31 11.5 32 21.5 33 29.0 34 36.5 35 53.5 36 70.5 37 102.0 38 132.5 39 148.0 40 191.5 41 235.5 42 262.0 43 283.0 44 300.0 45 313.5 46 277.5 47 240.0 48 235.5 49 221.5 50 182.0 51 140.0 52 122.0 53 97.5 54 70.5 55 52.0 56 43.0 57 34.0 58 19.5 59 13.0 60 8.5 61 5.5 62 3.5 63 2.5 64 2.5 65 2.5 66 2.5 67 2.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.015 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.0875 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.1375 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.1875 0.0 0.0 0.0 0.0 120-121 0.23750000000000002 0.0 0.0 0.0 0.0 122-123 0.3125 0.0 0.0 0.0 0.0 124-125 0.4125 0.0 0.0 0.0 0.0 126-127 0.45 0.0 0.0 0.0 0.0 128-129 0.5375 0.0 0.0 0.0 0.0 130-131 0.6375 0.0 0.0 0.0 0.0 132-133 0.7 0.0 0.0 0.0 0.0 134-135 0.7625 0.0 0.0 0.0 0.0 136-137 0.8375 0.0 0.0 0.0 0.0 138-139 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTAGTT 10 0.006830828 145.0 2 ACAACTG 10 0.006830828 145.0 7 >>END_MODULE Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033980 spots for SRR7169103.sra Written 1033980 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra Read 1033962 spots for SRR7169103.sra Written 1033962 spots for SRR7169103.sra SRR ids: ['SRR7169103.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sk54ad8d SRR7169103.sra spots: 20679258 blocks: [[1, 1033962], [1033963, 2067924], [2067925, 3101886], [3101887, 4135848], [4135849, 5169810], [5169811, 6203772], [6203773, 7237734], [7237735, 8271696], [8271697, 9305658], [9305659, 10339620], [10339621, 11373582], [11373583, 12407544], [12407545, 13441506], [13441507, 14475468], [14475469, 15509430], [15509431, 16543392], [16543393, 17577354], [17577355, 18611316], [18611317, 19645278], [19645279, 20679258]] SRR7169103 file size 6985821 SRR7169103 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169103 SRR7169103_1.fastq SRR7169103_2.fastq Input file: SRR7169103_1.fastq Paired file: SRR7169103_2.fastq trimmed: SRR7169103-trimmed-pair1.fastq, SRR7169103-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:17:45 2025 >> started Mon Feb 10 21:18:20 2025 >> done (35.647s) 20679258 read pairs processed; of these: 21107 ( 0.10%) short read pairs filtered out after trimming by size control 14504 ( 0.07%) empty read pairs filtered out after trimming by size control 20643647 (99.83%) read pairs available; of these: 10244915 (49.63%) trimmed read pairs available after processing 10398732 (50.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 6 0.00% 21 8 0.00% 22 2 0.00% 23 6 0.00% 24 7 0.00% 25 5 0.00% 26 11 0.00% 27 4 0.00% 28 3 0.00% 29 12 0.00% 30 15 0.00% 31 8 0.00% 32 6 0.00% 33 6 0.00% 34 7 0.00% 35 15 0.00% 36 10 0.00% 37 8 0.00% 38 12 0.00% 39 11 0.00% 40 15 0.00% 41 14 0.00% 42 15 0.00% 43 26 0.00% 44 25 0.00% 45 11 0.00% 46 23 0.00% 47 28 0.00% 48 33 0.00% 49 31 0.00% 50 35 0.00% 51 37 0.00% 52 34 0.00% 53 57 0.00% 54 46 0.00% 55 53 0.00% 56 56 0.00% 57 49 0.00% 58 70 0.00% 59 86 0.00% 60 81 0.00% 61 87 0.00% 62 99 0.00% 63 101 0.00% 64 104 0.00% 65 119 0.00% 66 156 0.00% 67 154 0.00% 68 174 0.00% 69 207 0.00% 70 225 0.00% 71 254 0.00% 72 256 0.00% 73 313 0.00% 74 276 0.00% 75 346 0.00% 76 414 0.00% 77 438 0.00% 78 510 0.00% 79 605 0.00% 80 633 0.00% 81 756 0.00% 82 880 0.00% 83 1039 0.01% 84 2056 0.01% 85 2610 0.01% 86 2673 0.01% 87 2825 0.01% 88 3134 0.02% 89 3008 0.01% 90 3260 0.02% 91 3172 0.02% 92 3533 0.02% 93 3614 0.02% 94 3688 0.02% 95 3934 0.02% 96 4146 0.02% 97 4349 0.02% 98 4713 0.02% 99 5004 0.02% 100 5436 0.03% 101 5665 0.03% 102 6021 0.03% 103 6530 0.03% 104 6866 0.03% 105 7263 0.04% 106 7888 0.04% 107 8226 0.04% 108 8869 0.04% 109 9300 0.05% 110 9751 0.05% 111 10662 0.05% 112 11286 0.05% 113 12170 0.06% 114 12709 0.06% 115 13746 0.07% 116 14479 0.07% 117 15394 0.07% 118 16711 0.08% 119 17336 0.08% 120 18419 0.09% 121 19467 0.09% 122 20757 0.10% 123 22514 0.11% 124 24352 0.12% 125 26314 0.13% 126 28604 0.14% 127 30529 0.15% 128 32907 0.16% 129 35674 0.17% 130 37940 0.18% 131 40677 0.20% 132 44760 0.22% 133 49044 0.24% 134 53556 0.26% 135 58808 0.28% 136 64678 0.31% 137 71793 0.35% 138 79949 0.39% 139 88981 0.43% 140 100419 0.49% 141 114483 0.55% 142 134371 0.65% 143 155882 0.76% 144 190358 0.92% 145 238686 1.16% 146 308336 1.49% 147 432699 2.10% 148 671860 3.25% 149 1303766 6.32% 150 5473161 26.51% 151 10398732 50.37% 20643647 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.11 prefix-fanout=2.0 sequence=TCTGACCTGGGCTGGCAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=13 fanout-score=269.81 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=29.4 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=36 prefix-density=0.33 prefix-fanout=2.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=266.72 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=27.6 sequence=GAAGAAGAAGAAA SRR7169103 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:19:25 Started mapping on | Feb 10 21:19:26 Finished on | Feb 10 21:22:26 Mapping speed, Million of reads per hour | 412.87 Number of input reads | 20643647 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19469685 Uniquely mapped reads % | 94.31% Average mapped length | 296.76 Number of splices: Total | 19763121 Number of splices: Annotated (sjdb) | 19456613 Number of splices: GT/AG | 19465689 Number of splices: GC/AG | 241778 Number of splices: AT/AC | 15648 Number of splices: Non-canonical | 40006 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 384665 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 35314 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.61% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 813593 813593 813593 N_multimapping 384665 384665 384665 N_noFeature 391930 19272679 491176 N_ambiguous 180663 874 82420 UnstrandedReadsAssigned:18897092 PositiveStrandReadsAssigned:196132 NegativeStrandReadsAssigned:18896089 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169103 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169103-trimmed-pair1.fastq SRR7169103-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,643,647 reads, 18,724,391 reads pseudoaligned [quant] estimated average fragment length: 292.686 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR7169103.ke.tsv 34699 SRR7169103.se.tsv 87100 total ==> SRR7169103.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1726.31 388 11.319 Potri.005G024800.1.v4.1 1035 743.314 43 2.91334 Potri.004G059700.1.v4.1 961 669.426 4 0.300921 Potri.007G009000.2.v4.1 1416 1124.31 0 0 Potri.003G141000.2.v4.1 2943 2651.31 378.127 7.18244 Potri.016G087400.1.v4.1 270 57.6455 1932 1687.86 Potri.015G069301.1.v4.1 564 283.072 0 0 Potri.010G195200.1.v4.1 1773 1481.31 12 0.407971 Potri.012G127500.1.v4.1 977 685.352 8300 609.902 ==> SRR7169103.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1021 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 368 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7169103 completed mapping pipeline successfully