Starting /dee2/code/volunteer_pipeline.sh SRR7169104 current disk space = 3057607045120 free memory = 1572298720 SRR7169104 SRAfilesize 88f1b4ebb569c546e418eb9560399e66 SRR7169104.sra SRR7169104.sra file validated SRR7169104 is paired end SRR7169104 is conventional basespace SRR7169104 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169104_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0955 34.0 33.0 34.0 33.0 34.0 2 33.3635 34.0 33.0 34.0 33.0 34.0 3 33.4155 34.0 34.0 34.0 33.0 34.0 4 33.527 34.0 34.0 34.0 33.0 34.0 5 33.48225 34.0 34.0 34.0 33.0 34.0 6 36.9265 38.0 37.0 38.0 35.0 38.0 7 37.321 38.0 38.0 38.0 36.0 38.0 8 37.35275 38.0 38.0 38.0 37.0 38.0 9 37.3915 38.0 38.0 38.0 37.0 38.0 10-14 37.4298 38.0 38.0 38.0 37.0 38.0 15-19 37.3408 38.0 38.0 38.0 37.0 38.0 20-24 37.35365 38.0 38.0 38.0 37.0 38.0 25-29 37.283300000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.227450000000005 38.0 38.0 38.0 36.8 38.0 35-39 37.0995 38.0 38.0 38.0 36.2 38.0 40-44 36.791700000000006 38.0 38.0 38.0 34.8 38.0 45-49 36.5482 38.0 38.0 38.0 34.0 38.0 50-54 36.4203 38.0 37.4 38.0 33.8 38.0 55-59 36.3409 38.0 37.0 38.0 33.6 38.0 60-64 36.2706 38.0 37.0 38.0 33.4 38.0 65-69 36.14775 38.0 37.0 38.0 33.0 38.0 70-74 36.0226 38.0 37.0 38.0 32.6 38.0 75-79 35.885149999999996 38.0 37.0 38.0 31.8 38.0 80-84 35.71475 38.0 36.6 38.0 30.2 38.0 85-89 35.50940000000001 38.0 36.2 38.0 29.2 38.0 90-94 35.3263 38.0 36.0 38.0 29.0 38.0 95-99 35.240899999999996 38.0 36.0 38.0 29.0 38.0 100-104 34.96065 38.0 35.8 38.0 28.0 38.0 105-109 34.814949999999996 38.0 35.2 38.0 27.6 38.0 110-114 34.353750000000005 38.0 34.4 38.0 24.6 38.0 115-119 33.9988 38.0 34.0 38.0 22.8 38.0 120-124 33.6948 38.0 34.0 38.0 19.4 38.0 125-129 33.409 38.0 34.0 38.0 17.4 38.0 130-134 33.0272 37.6 33.4 38.0 15.0 38.0 135-139 32.25255 36.8 31.6 38.0 14.6 38.0 140-144 31.668 36.0 31.0 38.0 14.0 38.0 145-149 30.718399999999995 36.0 30.2 38.0 8.8 38.0 150-151 26.599625 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 2.0 11 2.0 12 0.0 13 3.0 14 3.0 15 3.0 16 4.0 17 8.0 18 6.0 19 11.0 20 8.0 21 12.0 22 15.0 23 16.0 24 16.0 25 27.0 26 31.0 27 42.0 28 50.0 29 56.0 30 60.0 31 104.0 32 126.0 33 166.0 34 294.0 35 493.0 36 1067.0 37 1373.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.70894391106619 12.910560889338049 9.247094492167761 34.133400707427995 2 24.625 13.25 30.675 31.45 3 19.225 17.45 27.250000000000004 36.075 4 21.224999999999998 25.15 24.575 29.049999999999997 5 22.85 29.225 24.375 23.549999999999997 6 20.349999999999998 34.825 24.15 20.674999999999997 7 14.649999999999999 28.225 38.925 18.2 8 17.925 28.15 29.775000000000002 24.15 9 16.475 25.724999999999998 34.4 23.400000000000002 10-14 19.365 30.470000000000002 27.015 23.150000000000002 15-19 19.85 28.21 28.075 23.865 20-24 19.27 29.54 27.79 23.400000000000002 25-29 19.455 29.459999999999997 27.134999999999998 23.95 30-34 19.72 28.615000000000002 27.334999999999997 24.33 35-39 19.79 29.04 27.785 23.385 40-44 19.85 29.81 26.625 23.715 45-49 20.349999999999998 28.449999999999996 27.584999999999997 23.615 50-54 19.68 28.499999999999996 27.915 23.905 55-59 19.919999999999998 28.46 27.694999999999997 23.925 60-64 19.975 28.4 27.315 24.310000000000002 65-69 19.73 28.685 27.715 23.87 70-74 20.185 28.74 27.18 23.895 75-79 20.165 28.599999999999998 27.38 23.855 80-84 20.49 28.63 27.275 23.605 85-89 20.215 29.275000000000002 26.715 23.794999999999998 90-94 20.06 28.895 27.08 23.965 95-99 20.305 28.599999999999998 27.295 23.799999999999997 100-104 19.985 28.560000000000002 27.54 23.915 105-109 20.84 28.235 27.395000000000003 23.53 110-114 19.97 27.825 27.685 24.52 115-119 20.455000000000002 27.839999999999996 27.725 23.98 120-124 20.19 27.815 27.46 24.535 125-129 20.669999999999998 27.24 28.02 24.07 130-134 20.75 28.165000000000003 27.305 23.78 135-139 20.36 28.194999999999997 27.21 24.235 140-144 20.855 28.065 27.325 23.755000000000003 145-149 20.865000000000002 27.97 27.195000000000004 23.97 150-151 21.375 28.199999999999996 26.8375 23.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 1.5 20 2.0 21 0.5 22 1.0 23 2.0 24 3.0 25 4.0 26 6.0 27 10.5 28 14.0 29 16.0 30 19.0 31 26.0 32 35.0 33 45.0 34 57.0 35 67.5 36 95.0 37 127.0 38 137.0 39 155.5 40 173.5 41 193.5 42 216.0 43 229.0 44 266.0 45 281.0 46 254.5 47 244.0 48 229.0 49 207.0 50 181.5 51 139.5 52 116.5 53 106.5 54 83.5 55 61.5 56 44.5 57 35.0 58 28.5 59 21.0 60 17.0 61 11.0 62 7.5 63 5.5 64 5.5 65 3.0 66 1.5 67 2.5 68 1.5 69 1.5 70 1.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.325 0.0 0.0 0.0 0.0 120-121 0.325 0.0 0.0 0.0 0.0 122-123 0.35 0.0 0.0 0.0 0.0 124-125 0.44999999999999996 0.0 0.0 0.0 0.0 126-127 0.5 0.0 0.0 0.0 0.0 128-129 0.575 0.0 0.0 0.0 0.0 130-131 0.675 0.0 0.0 0.0 0.0 132-133 0.825 0.0 0.0 0.0 0.0 134-135 0.9624999999999999 0.0 0.0 0.0 0.0 136-137 1.125 0.0 0.0 0.0 0.0 138-139 1.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAATAA 10 0.006832588 144.9875 4 >>END_MODULE SRR7169104 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169104_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.70275 33.0 33.0 34.0 32.0 34.0 2 32.77975 33.0 33.0 34.0 32.0 34.0 3 32.85 34.0 33.0 34.0 32.0 34.0 4 32.717 34.0 33.0 34.0 32.0 34.0 5 32.7895 34.0 33.0 34.0 32.0 34.0 6 36.85975 38.0 38.0 38.0 36.0 38.0 7 36.8205 38.0 38.0 38.0 36.0 38.0 8 36.824 38.0 38.0 38.0 36.0 38.0 9 36.907 38.0 38.0 38.0 36.0 38.0 10-14 36.86905 38.0 38.0 38.0 36.0 38.0 15-19 36.8547 38.0 38.0 38.0 36.0 38.0 20-24 36.76090000000001 38.0 38.0 38.0 36.0 38.0 25-29 36.79325 38.0 38.0 38.0 36.0 38.0 30-34 36.87865 38.0 38.0 38.0 36.0 38.0 35-39 36.78155 38.0 38.0 38.0 36.0 38.0 40-44 36.669450000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.67784999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.660849999999996 38.0 38.0 38.0 35.6 38.0 55-59 36.6032 38.0 38.0 38.0 35.0 38.0 60-64 36.570449999999994 38.0 38.0 38.0 35.0 38.0 65-69 36.43205 38.0 38.0 38.0 34.6 38.0 70-74 36.392100000000006 38.0 38.0 38.0 34.4 38.0 75-79 36.3174 38.0 38.0 38.0 34.0 38.0 80-84 36.28385000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.2107 38.0 38.0 38.0 33.8 38.0 90-94 36.151250000000005 38.0 38.0 38.0 34.0 38.0 95-99 35.981049999999996 38.0 38.0 38.0 33.2 38.0 100-104 35.7567 38.0 37.8 38.0 31.8 38.0 105-109 35.68865000000001 38.0 37.8 38.0 31.4 38.0 110-114 35.48365 38.0 37.0 38.0 31.0 38.0 115-119 35.33005000000001 38.0 37.0 38.0 30.2 38.0 120-124 34.9937 38.0 36.2 38.0 28.0 38.0 125-129 34.92165000000001 38.0 36.0 38.0 28.2 38.0 130-134 34.508649999999996 38.0 36.0 38.0 26.2 38.0 135-139 34.10545 38.0 35.0 38.0 22.6 38.0 140-144 33.64955 38.0 35.0 38.0 19.0 38.0 145-149 32.90295 38.0 34.8 38.0 11.8 38.0 150-151 29.282875 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 5.0 4 3.0 5 2.0 6 2.0 7 1.0 8 1.0 9 1.0 10 3.0 11 2.0 12 4.0 13 6.0 14 3.0 15 6.0 16 2.0 17 3.0 18 9.0 19 10.0 20 7.0 21 8.0 22 16.0 23 9.0 24 20.0 25 25.0 26 22.0 27 26.0 28 38.0 29 44.0 30 50.0 31 83.0 32 87.0 33 93.0 34 123.0 35 206.0 36 501.0 37 2565.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.6 23.375 13.625000000000002 24.4 2 29.875 26.0 25.825 18.3 3 21.825 27.650000000000002 30.349999999999998 20.175 4 23.724999999999998 33.375 23.025000000000002 19.875 5 24.5 36.725 21.425 17.349999999999998 6 21.975 37.275000000000006 21.925 18.825 7 20.95 22.725 36.875 19.45 8 21.9 27.325 25.124999999999996 25.650000000000002 9 22.675 25.650000000000002 28.9 22.775000000000002 10-14 23.64 29.03 25.865 21.465 15-19 23.435 28.025 27.165 21.375 20-24 23.665 28.01 27.169999999999998 21.154999999999998 25-29 23.555 28.095 26.985 21.365000000000002 30-34 23.145 27.555000000000003 27.99 21.310000000000002 35-39 23.255 27.855 27.52 21.37 40-44 23.71 27.01 27.41 21.87 45-49 23.974999999999998 27.700000000000003 27.255000000000003 21.07 50-54 23.94 27.944999999999997 27.54 20.575 55-59 23.535 28.15 27.57 20.745 60-64 24.29 27.46 27.575 20.674999999999997 65-69 23.946696057311758 27.974550373227796 27.578778618305694 20.49997495115475 70-74 23.869447508272334 27.544369798455833 27.39897723854407 21.187205454727764 75-79 23.774436090225564 26.93233082706767 27.74436090225564 21.548872180451127 80-84 23.995 28.044999999999998 27.33 20.630000000000003 85-89 24.15 27.37 27.644999999999996 20.835 90-94 24.27 27.425 27.689999999999998 20.615 95-99 24.385 27.555000000000003 27.644999999999996 20.415 100-104 24.404999999999998 27.41 27.83 20.355 105-109 23.735 27.71 27.775 20.78 110-114 24.4 27.685 27.425 20.49 115-119 23.724999999999998 27.54 27.839999999999996 20.895 120-124 24.035 28.17 27.145000000000003 20.65 125-129 24.3 28.000000000000004 27.215 20.485 130-134 24.255 27.83 27.83 20.085 135-139 24.172417241724172 27.622762276227625 27.61776177617762 20.587058705870586 140-144 24.502051846661995 27.699929936943253 27.309578620758685 20.488439595636073 145-149 24.4230383303231 27.69917720248846 27.578767810555888 20.299016656632553 150-151 24.26794017845922 28.201583511373634 27.221314565791126 20.30916174437602 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.5 22 1.5 23 0.5 24 1.0 25 2.0 26 1.0 27 1.0 28 2.5 29 5.0 30 9.0 31 11.0 32 17.5 33 24.0 34 33.0 35 51.5 36 67.0 37 88.0 38 120.0 39 142.5 40 186.5 41 233.5 42 246.0 43 252.0 44 280.5 45 299.0 46 281.0 47 247.5 48 244.5 49 225.5 50 175.5 51 165.0 52 145.0 53 110.5 54 80.5 55 59.5 56 48.5 57 38.0 58 24.0 59 15.0 60 15.0 61 10.5 62 5.5 63 5.0 64 4.5 65 4.0 66 4.5 67 4.0 68 1.5 69 1.0 70 1.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.19499999999999998 70-74 0.27 75-79 0.25 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.09 145-149 0.33999999999999997 150-151 0.5375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.325 0.0 0.0 0.0 0.0 120-121 0.325 0.0 0.0 0.0 0.0 122-123 0.35 0.0 0.0 0.0 0.0 124-125 0.44999999999999996 0.0 0.0 0.0 0.0 126-127 0.5 0.0 0.0 0.0 0.0 128-129 0.575 0.0 0.0 0.0 0.0 130-131 0.675 0.0 0.0 0.0 0.0 132-133 0.8 0.0 0.0 0.0 0.0 134-135 0.9375 0.0 0.0 0.0 0.0 136-137 1.1 0.0 0.0 0.0 0.0 138-139 1.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCTTG 10 0.006830828 145.0 4 >>END_MODULE Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra Read 705447 spots for SRR7169104.sra Written 705447 spots for SRR7169104.sra SRR ids: ['SRR7169104.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zl42vd8d SRR7169104.sra spots: 14108940 blocks: [[1, 705447], [705448, 1410894], [1410895, 2116341], [2116342, 2821788], [2821789, 3527235], [3527236, 4232682], [4232683, 4938129], [4938130, 5643576], [5643577, 6349023], [6349024, 7054470], [7054471, 7759917], [7759918, 8465364], [8465365, 9170811], [9170812, 9876258], [9876259, 10581705], [10581706, 11287152], [11287153, 11992599], [11992600, 12698046], [12698047, 13403493], [13403494, 14108940]] SRR7169104 file size 4759356 SRR7169104 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169104 SRR7169104_1.fastq SRR7169104_2.fastq Input file: SRR7169104_1.fastq Paired file: SRR7169104_2.fastq trimmed: SRR7169104-trimmed-pair1.fastq, SRR7169104-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:53:16 2025 >> started Mon Feb 10 22:53:31 2025 >> done (15.569s) 14108940 read pairs processed; of these: 19040 ( 0.13%) short read pairs filtered out after trimming by size control 16661 ( 0.12%) empty read pairs filtered out after trimming by size control 14073239 (99.75%) read pairs available; of these: 6881208 (48.90%) trimmed read pairs available after processing 7192031 (51.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 10 0.00% 20 3 0.00% 21 6 0.00% 22 6 0.00% 23 8 0.00% 24 4 0.00% 25 8 0.00% 26 7 0.00% 27 13 0.00% 28 9 0.00% 29 5 0.00% 30 8 0.00% 31 9 0.00% 32 10 0.00% 33 14 0.00% 34 14 0.00% 35 11 0.00% 36 13 0.00% 37 19 0.00% 38 14 0.00% 39 15 0.00% 40 14 0.00% 41 17 0.00% 42 19 0.00% 43 22 0.00% 44 27 0.00% 45 23 0.00% 46 29 0.00% 47 18 0.00% 48 35 0.00% 49 33 0.00% 50 33 0.00% 51 40 0.00% 52 52 0.00% 53 55 0.00% 54 54 0.00% 55 64 0.00% 56 65 0.00% 57 66 0.00% 58 70 0.00% 59 81 0.00% 60 105 0.00% 61 99 0.00% 62 99 0.00% 63 121 0.00% 64 136 0.00% 65 163 0.00% 66 178 0.00% 67 180 0.00% 68 221 0.00% 69 210 0.00% 70 242 0.00% 71 273 0.00% 72 317 0.00% 73 335 0.00% 74 366 0.00% 75 406 0.00% 76 424 0.00% 77 499 0.00% 78 507 0.00% 79 605 0.00% 80 694 0.00% 81 785 0.01% 82 863 0.01% 83 1052 0.01% 84 1873 0.01% 85 2348 0.02% 86 2313 0.02% 87 2345 0.02% 88 2550 0.02% 89 2573 0.02% 90 2662 0.02% 91 2762 0.02% 92 2981 0.02% 93 3161 0.02% 94 3266 0.02% 95 3511 0.02% 96 3806 0.03% 97 4208 0.03% 98 4398 0.03% 99 4561 0.03% 100 4876 0.03% 101 5208 0.04% 102 5443 0.04% 103 5716 0.04% 104 6084 0.04% 105 6665 0.05% 106 6903 0.05% 107 7565 0.05% 108 7882 0.06% 109 8352 0.06% 110 8946 0.06% 111 9475 0.07% 112 10262 0.07% 113 10973 0.08% 114 11653 0.08% 115 12376 0.09% 116 13010 0.09% 117 14020 0.10% 118 14785 0.11% 119 15835 0.11% 120 16432 0.12% 121 17450 0.12% 122 18769 0.13% 123 19896 0.14% 124 21210 0.15% 125 22835 0.16% 126 24344 0.17% 127 26307 0.19% 128 28091 0.20% 129 29797 0.21% 130 32065 0.23% 131 34088 0.24% 132 36761 0.26% 133 40213 0.29% 134 42747 0.30% 135 46423 0.33% 136 51201 0.36% 137 56007 0.40% 138 62489 0.44% 139 68996 0.49% 140 76877 0.55% 141 84578 0.60% 142 95586 0.68% 143 110061 0.78% 144 130228 0.93% 145 159596 1.13% 146 205209 1.46% 147 284726 2.02% 148 442583 3.14% 149 863060 6.13% 150 3487331 24.78% 151 7192031 51.10% 14073239 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=42 prefix-density=0.14 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=123.19 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=17.7 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=38 prefix-density=0.19 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=255.96 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=26.6 sequence=GAAGAAGAAGAAA SRR7169104 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:54:16 Started mapping on | Feb 10 22:54:16 Finished on | Feb 10 22:55:49 Mapping speed, Million of reads per hour | 544.77 Number of input reads | 14073239 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13072749 Uniquely mapped reads % | 92.89% Average mapped length | 296.00 Number of splices: Total | 12052779 Number of splices: Annotated (sjdb) | 11827771 Number of splices: GT/AG | 11862704 Number of splices: GC/AG | 151000 Number of splices: AT/AC | 10582 Number of splices: Non-canonical | 28493 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 273204 % of reads mapped to multiple loci | 1.94% Number of reads mapped to too many loci | 121702 % of reads mapped to too many loci | 0.86% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.16% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 745015 745015 745015 N_multimapping 273204 273204 273204 N_noFeature 304415 12903794 383982 N_ambiguous 150169 1648 59492 UnstrandedReadsAssigned:12618165 PositiveStrandReadsAssigned:167307 NegativeStrandReadsAssigned:12629275 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169104 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169104-trimmed-pair1.fastq SRR7169104-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,073,239 reads, 12,650,938 reads pseudoaligned [quant] estimated average fragment length: 266.435 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR7169104.ke.tsv 34699 SRR7169104.se.tsv 87100 total ==> SRR7169104.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.57 325 12.2968 Potri.005G024800.1.v4.1 1035 769.565 58 4.99765 Potri.004G059700.1.v4.1 961 695.596 4 0.381318 Potri.007G009000.2.v4.1 1416 1150.57 0 0 Potri.003G141000.2.v4.1 2943 2677.57 238 5.89414 Potri.016G087400.1.v4.1 270 61.6177 1481.16 1593.97 Potri.015G069301.1.v4.1 564 303.17 0 0 Potri.010G195200.1.v4.1 1773 1507.57 92 4.04665 Potri.012G127500.1.v4.1 977 711.59 8241 767.952 ==> SRR7169104.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1851 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 325 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 19 SRR7169104 completed mapping pipeline successfully