Starting /dee2/code/volunteer_pipeline.sh SRR7169105 current disk space = 3056964247552 free memory = 1322290672 SRR7169105 SRAfilesize a6d951aaccfb8985ab746be08255ba97 SRR7169105.sra SRR7169105.sra file validated SRR7169105 is paired end SRR7169105 is conventional basespace SRR7169105 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169105_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92975 34.0 33.0 34.0 33.0 34.0 2 33.35975 34.0 33.0 34.0 33.0 34.0 3 33.399 34.0 34.0 34.0 33.0 34.0 4 33.4295 34.0 34.0 34.0 33.0 34.0 5 33.40375 34.0 33.0 34.0 33.0 34.0 6 36.82 38.0 37.0 38.0 35.0 38.0 7 37.25025 38.0 38.0 38.0 36.0 38.0 8 37.3405 38.0 38.0 38.0 37.0 38.0 9 37.438 38.0 38.0 38.0 37.0 38.0 10-14 37.39115 38.0 38.0 38.0 37.0 38.0 15-19 37.2769 38.0 38.0 38.0 37.0 38.0 20-24 37.23244999999999 38.0 38.0 38.0 36.6 38.0 25-29 37.20495 38.0 38.0 38.0 36.4 38.0 30-34 37.1761 38.0 38.0 38.0 36.0 38.0 35-39 37.04195 38.0 38.0 38.0 36.0 38.0 40-44 36.765499999999996 38.0 38.0 38.0 34.6 38.0 45-49 36.6015 38.0 38.0 38.0 34.0 38.0 50-54 36.38605 38.0 37.0 38.0 33.8 38.0 55-59 36.39415 38.0 37.0 38.0 34.0 38.0 60-64 36.236599999999996 38.0 37.0 38.0 33.2 38.0 65-69 36.132349999999995 38.0 37.0 38.0 33.0 38.0 70-74 36.065999999999995 38.0 37.0 38.0 33.0 38.0 75-79 36.048100000000005 38.0 37.0 38.0 33.0 38.0 80-84 35.84135 38.0 37.0 38.0 31.6 38.0 85-89 35.57915 38.0 36.4 38.0 30.0 38.0 90-94 35.510000000000005 38.0 36.0 38.0 29.4 38.0 95-99 35.2601 38.0 36.0 38.0 29.0 38.0 100-104 35.0687 38.0 36.0 38.0 28.6 38.0 105-109 34.77035 38.0 35.2 38.0 26.8 38.0 110-114 34.51545 38.0 34.8 38.0 26.2 38.0 115-119 34.16945 38.0 34.2 38.0 23.2 38.0 120-124 33.849900000000005 38.0 34.0 38.0 23.0 38.0 125-129 33.44815 37.8 33.8 38.0 19.0 38.0 130-134 33.042 37.6 33.2 38.0 15.0 38.0 135-139 32.659299999999995 37.4 33.0 38.0 14.8 38.0 140-144 32.07275 36.0 32.2 38.0 14.0 38.0 145-149 30.97695 36.0 31.0 38.0 8.8 38.0 150-151 26.588 34.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 2.0 10 0.0 11 2.0 12 1.0 13 1.0 14 3.0 15 3.0 16 8.0 17 3.0 18 8.0 19 9.0 20 7.0 21 9.0 22 14.0 23 21.0 24 18.0 25 25.0 26 37.0 27 46.0 28 36.0 29 61.0 30 65.0 31 92.0 32 106.0 33 172.0 34 287.0 35 482.0 36 1056.0 37 1425.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.58534111082932 13.84732437230535 9.358356581283287 32.20897793558205 2 23.65 15.2 32.85 28.299999999999997 3 18.675 22.05 27.325 31.95 4 21.224999999999998 26.924999999999997 25.674999999999997 26.174999999999997 5 23.025000000000002 31.55 23.599999999999998 21.825 6 19.0 35.15 25.1 20.75 7 14.149999999999999 27.400000000000002 40.175 18.275 8 17.424999999999997 27.425 28.975 26.174999999999997 9 16.325 25.75 33.050000000000004 24.875 10-14 19.515 29.654999999999998 26.8 24.03 15-19 19.8 29.125 27.21 23.865 20-24 19.82 28.810000000000002 27.405 23.965 25-29 19.535 29.32 27.305 23.84 30-34 19.725 29.255 26.87 24.15 35-39 20.47 28.865000000000002 26.779999999999998 23.885 40-44 20.150000000000002 28.84 27.215 23.794999999999998 45-49 20.805 28.325 26.71 24.16 50-54 20.075000000000003 28.57 26.855 24.5 55-59 20.24 28.994999999999997 26.695 24.07 60-64 20.275000000000002 28.73 26.755000000000003 24.240000000000002 65-69 20.115 28.4 27.165 24.32 70-74 20.435 28.37 27.575 23.62 75-79 20.095 27.955000000000002 27.200000000000003 24.75 80-84 20.87 28.299999999999997 27.24 23.59 85-89 20.369999999999997 28.09 27.084999999999997 24.455 90-94 20.525 28.194999999999997 27.084999999999997 24.195 95-99 19.950000000000003 28.194999999999997 27.49 24.365000000000002 100-104 20.395 28.655 27.21 23.74 105-109 20.36 27.884999999999998 27.500000000000004 24.255 110-114 20.544999999999998 27.785 27.169999999999998 24.5 115-119 20.32 27.985 27.83 23.865 120-124 20.69 27.67 27.12 24.52 125-129 20.4 27.74 27.694999999999997 24.165 130-134 21.08 28.044999999999998 26.935 23.94 135-139 20.571028551427574 28.361418070903543 27.161358067903397 23.906195309765486 140-144 21.285 28.325 26.619999999999997 23.77 145-149 20.8 27.779999999999998 27.105 24.315 150-151 20.825 27.500000000000004 26.887499999999996 24.7875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.5 21 2.5 22 1.5 23 1.0 24 1.5 25 3.0 26 8.0 27 10.0 28 8.5 29 12.0 30 15.5 31 19.0 32 28.5 33 47.0 34 55.0 35 60.0 36 79.0 37 103.0 38 129.0 39 158.0 40 176.5 41 197.0 42 228.5 43 245.0 44 248.0 45 250.0 46 267.5 47 287.5 48 246.5 49 189.0 50 171.5 51 145.0 52 122.0 53 114.0 54 93.0 55 65.0 56 49.5 57 39.5 58 26.5 59 19.5 60 18.0 61 12.0 62 10.0 63 10.5 64 5.5 65 3.5 66 4.0 67 4.0 68 2.5 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.45 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.85 0.0 0.0 0.0 0.0 130-131 0.9125 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.0750000000000002 0.0 0.0 0.0 0.0 136-137 1.125 0.0 0.0 0.0 0.0 138-139 1.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169105 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169105_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.65725 33.0 33.0 34.0 32.0 34.0 2 32.71225 33.0 33.0 34.0 32.0 34.0 3 32.72275 34.0 33.0 34.0 32.0 34.0 4 32.69775 34.0 33.0 34.0 32.0 34.0 5 32.65675 34.0 33.0 34.0 32.0 34.0 6 36.73825 38.0 38.0 38.0 36.0 38.0 7 36.7865 38.0 38.0 38.0 36.0 38.0 8 36.715 38.0 38.0 38.0 36.0 38.0 9 36.74675 38.0 38.0 38.0 36.0 38.0 10-14 36.72865 38.0 38.0 38.0 36.0 38.0 15-19 36.61710000000001 38.0 38.0 38.0 36.0 38.0 20-24 36.6473 38.0 38.0 38.0 36.0 38.0 25-29 36.60955 38.0 38.0 38.0 36.0 38.0 30-34 36.571600000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.53905 38.0 38.0 38.0 36.0 38.0 40-44 36.503350000000005 38.0 38.0 38.0 35.8 38.0 45-49 36.50385 38.0 38.0 38.0 35.6 38.0 50-54 36.459250000000004 38.0 38.0 38.0 35.4 38.0 55-59 36.47135 38.0 38.0 38.0 35.4 38.0 60-64 36.407399999999996 38.0 38.0 38.0 35.0 38.0 65-69 36.31205 38.0 38.0 38.0 34.6 38.0 70-74 36.26495 38.0 38.0 38.0 34.6 38.0 75-79 36.1106 38.0 38.0 38.0 34.0 38.0 80-84 36.1177 38.0 38.0 38.0 34.0 38.0 85-89 36.00745 38.0 38.0 38.0 34.0 38.0 90-94 36.0099 38.0 38.0 38.0 33.8 38.0 95-99 35.834500000000006 38.0 38.0 38.0 33.2 38.0 100-104 35.640049999999995 38.0 37.8 38.0 32.2 38.0 105-109 35.5594 38.0 38.0 38.0 31.6 38.0 110-114 35.43265 38.0 37.4 38.0 31.0 38.0 115-119 35.2266 38.0 37.2 38.0 30.2 38.0 120-124 35.09695 38.0 36.8 38.0 29.2 38.0 125-129 34.825 38.0 36.0 38.0 28.0 38.0 130-134 34.5707 38.0 36.0 38.0 26.8 38.0 135-139 34.2195 38.0 35.8 38.0 23.2 38.0 140-144 33.915949999999995 38.0 35.4 38.0 22.2 38.0 145-149 33.04885 38.0 35.0 38.0 13.8 38.0 150-151 29.662625000000002 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 15.0 4 3.0 5 2.0 6 2.0 7 5.0 8 2.0 9 3.0 10 3.0 11 2.0 12 5.0 13 5.0 14 3.0 15 7.0 16 4.0 17 4.0 18 6.0 19 9.0 20 6.0 21 14.0 22 9.0 23 13.0 24 20.0 25 12.0 26 22.0 27 32.0 28 30.0 29 45.0 30 47.0 31 55.0 32 63.0 33 88.0 34 128.0 35 185.0 36 482.0 37 2643.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.85 22.45 14.124999999999998 24.575 2 29.049999999999997 26.3 27.775 16.875 3 21.85 29.5 30.225 18.425 4 23.5 34.0 23.150000000000002 19.35 5 24.3 35.475 22.400000000000002 17.825 6 21.125 37.9 22.6 18.375 7 20.075000000000003 21.425 37.8 20.7 8 22.775000000000002 25.124999999999996 26.474999999999998 25.624999999999996 9 21.55 26.424999999999997 28.625 23.400000000000002 10-14 23.68 28.78 26.169999999999998 21.37 15-19 23.445 27.250000000000004 27.865000000000002 21.44 20-24 23.21 28.37 27.43 20.990000000000002 25-29 23.585 28.235 27.339999999999996 20.84 30-34 23.494999999999997 27.735 27.839999999999996 20.93 35-39 23.575 28.24 26.695 21.490000000000002 40-44 23.419999999999998 27.810000000000002 27.375 21.395 45-49 23.36 27.275 27.860000000000003 21.505 50-54 23.595 27.365000000000002 27.665 21.375 55-59 24.11 27.655 27.334999999999997 20.9 60-64 23.115 27.1 28.815 20.97 65-69 23.696848424212106 27.658829414707352 27.378689344672335 21.265632816408203 70-74 23.83883883883884 27.09209209209209 27.75275275275275 21.316316316316318 75-79 24.43497870207968 27.045853169631673 27.4718115760461 21.047356552242547 80-84 23.945 27.245 27.625 21.185000000000002 85-89 23.955000000000002 27.089999999999996 27.565 21.39 90-94 23.86 27.925 27.525 20.69 95-99 24.315 28.110000000000003 26.640000000000004 20.935000000000002 100-104 24.635 27.58 27.27 20.515 105-109 23.915 27.685 27.639999999999997 20.76 110-114 23.94 27.61 27.175 21.275 115-119 23.955000000000002 26.740000000000002 28.115000000000002 21.19 120-124 23.849999999999998 27.495000000000005 27.66 20.995 125-129 23.799999999999997 27.485 27.700000000000003 21.015 130-134 24.52 27.02 27.450000000000003 21.01 135-139 24.395 28.134999999999998 27.13 20.34 140-144 24.16 27.589999999999996 27.555000000000003 20.695 145-149 24.30112923462986 27.693851944792975 27.392722710163113 20.612296110414054 150-151 23.72327044025157 26.905660377358494 27.735849056603772 21.635220125786166 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 2.5 25 1.5 26 2.0 27 4.0 28 3.0 29 4.5 30 7.0 31 10.0 32 17.0 33 23.0 34 33.5 35 47.0 36 65.0 37 85.0 38 106.5 39 137.0 40 176.5 41 220.0 42 259.0 43 279.5 44 288.5 45 298.5 46 289.5 47 269.0 48 255.0 49 219.0 50 178.0 51 165.5 52 140.5 53 103.0 54 78.5 55 57.5 56 43.0 57 34.0 58 23.5 59 20.0 60 15.0 61 7.0 62 4.0 63 5.0 64 4.5 65 2.5 66 2.0 67 3.0 68 3.0 69 0.5 70 0.5 71 1.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.05 70-74 0.1 75-79 0.22499999999999998 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.375 150-151 0.625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.7125 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.85 0.0 0.0 0.0 0.0 130-131 0.9125 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.0750000000000002 0.0 0.0 0.0 0.0 136-137 1.15 0.0 0.0 0.0 0.0 138-139 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGCTGC 10 0.006830828 145.0 8 GGGGGGG 25 4.977651E-4 29.0 20-24 >>END_MODULE Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799230 spots for SRR7169105.sra Written 799230 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra Read 799216 spots for SRR7169105.sra Written 799216 spots for SRR7169105.sra SRR ids: ['SRR7169105.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jbw8tzci SRR7169105.sra spots: 15984334 blocks: [[1, 799216], [799217, 1598432], [1598433, 2397648], [2397649, 3196864], [3196865, 3996080], [3996081, 4795296], [4795297, 5594512], [5594513, 6393728], [6393729, 7192944], [7192945, 7992160], [7992161, 8791376], [8791377, 9590592], [9590593, 10389808], [10389809, 11189024], [11189025, 11988240], [11988241, 12787456], [12787457, 13586672], [13586673, 14385888], [14385889, 15185104], [15185105, 15984334]] SRR7169105 file size 5394865 SRR7169105 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169105 SRR7169105_1.fastq SRR7169105_2.fastq Input file: SRR7169105_1.fastq Paired file: SRR7169105_2.fastq trimmed: SRR7169105-trimmed-pair1.fastq, SRR7169105-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:34:50 2025 >> started Mon Feb 10 21:35:07 2025 >> done (17.487s) 15984334 read pairs processed; of these: 31888 ( 0.20%) short read pairs filtered out after trimming by size control 20318 ( 0.13%) empty read pairs filtered out after trimming by size control 15932128 (99.67%) read pairs available; of these: 7770205 (48.77%) trimmed read pairs available after processing 8161923 (51.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 8 0.00% 21 10 0.00% 22 4 0.00% 23 7 0.00% 24 11 0.00% 25 11 0.00% 26 12 0.00% 27 14 0.00% 28 8 0.00% 29 16 0.00% 30 12 0.00% 31 9 0.00% 32 12 0.00% 33 11 0.00% 34 11 0.00% 35 14 0.00% 36 26 0.00% 37 20 0.00% 38 12 0.00% 39 21 0.00% 40 19 0.00% 41 23 0.00% 42 28 0.00% 43 21 0.00% 44 27 0.00% 45 28 0.00% 46 35 0.00% 47 37 0.00% 48 39 0.00% 49 47 0.00% 50 48 0.00% 51 48 0.00% 52 48 0.00% 53 60 0.00% 54 75 0.00% 55 82 0.00% 56 79 0.00% 57 105 0.00% 58 108 0.00% 59 117 0.00% 60 130 0.00% 61 141 0.00% 62 115 0.00% 63 153 0.00% 64 186 0.00% 65 189 0.00% 66 208 0.00% 67 208 0.00% 68 297 0.00% 69 300 0.00% 70 338 0.00% 71 335 0.00% 72 407 0.00% 73 426 0.00% 74 465 0.00% 75 519 0.00% 76 540 0.00% 77 616 0.00% 78 692 0.00% 79 721 0.00% 80 886 0.01% 81 932 0.01% 82 1146 0.01% 83 1380 0.01% 84 2706 0.02% 85 3532 0.02% 86 3407 0.02% 87 3448 0.02% 88 3569 0.02% 89 3539 0.02% 90 3552 0.02% 91 3712 0.02% 92 4015 0.03% 93 4200 0.03% 94 4444 0.03% 95 4686 0.03% 96 4894 0.03% 97 5202 0.03% 98 5405 0.03% 99 5702 0.04% 100 6026 0.04% 101 6293 0.04% 102 6785 0.04% 103 7162 0.04% 104 7340 0.05% 105 8149 0.05% 106 8641 0.05% 107 8648 0.05% 108 9508 0.06% 109 9831 0.06% 110 10458 0.07% 111 11263 0.07% 112 11665 0.07% 113 12613 0.08% 114 13436 0.08% 115 14308 0.09% 116 15164 0.10% 117 15922 0.10% 118 17059 0.11% 119 17943 0.11% 120 18559 0.12% 121 19749 0.12% 122 20758 0.13% 123 22298 0.14% 124 23849 0.15% 125 25604 0.16% 126 27484 0.17% 127 29392 0.18% 128 30930 0.19% 129 33163 0.21% 130 35490 0.22% 131 38362 0.24% 132 41453 0.26% 133 45036 0.28% 134 48373 0.30% 135 52547 0.33% 136 58102 0.36% 137 63574 0.40% 138 70978 0.45% 139 78437 0.49% 140 87103 0.55% 141 96706 0.61% 142 109118 0.68% 143 124803 0.78% 144 148336 0.93% 145 181914 1.14% 146 233260 1.46% 147 328416 2.06% 148 497363 3.12% 149 956569 6.00% 150 3925588 24.64% 151 8161923 51.23% 15932128 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=38 prefix-density=0.18 prefix-fanout=2.4 sequence=GAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=333.74 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=19.9 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=7.49 fanout-score-rank=22 prefix-density=0.32 prefix-fanout=3.4 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.07 sequence-density-rank=36 fanout-score=33.97 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=9.7 sequence=GAGGCTGCTTTGAGAGAGGG SRR7169105 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:35:54 Started mapping on | Feb 10 21:35:55 Finished on | Feb 10 21:37:35 Mapping speed, Million of reads per hour | 573.56 Number of input reads | 15932128 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14884007 Uniquely mapped reads % | 93.42% Average mapped length | 296.00 Number of splices: Total | 14005772 Number of splices: Annotated (sjdb) | 13758043 Number of splices: GT/AG | 13792889 Number of splices: GC/AG | 169613 Number of splices: AT/AC | 12061 Number of splices: Non-canonical | 31209 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312235 % of reads mapped to multiple loci | 1.96% Number of reads mapped to too many loci | 72959 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.08% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 763752 763752 763752 N_multimapping 312235 312235 312235 N_noFeature 312517 14702316 394250 N_ambiguous 165008 1711 63709 UnstrandedReadsAssigned:14406482 PositiveStrandReadsAssigned:179980 NegativeStrandReadsAssigned:14426048 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169105 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169105-trimmed-pair1.fastq SRR7169105-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,932,128 reads, 14,374,265 reads pseudoaligned [quant] estimated average fragment length: 275.741 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52401 SRR7169105.ke.tsv 34699 SRR7169105.se.tsv 87100 total ==> SRR7169105.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.26 448 14.9525 Potri.005G024800.1.v4.1 1035 760.259 83 6.35205 Potri.004G059700.1.v4.1 961 686.291 2 0.169558 Potri.007G009000.2.v4.1 1416 1141.26 0 0 Potri.003G141000.2.v4.1 2943 2668.26 242 5.27698 Potri.016G087400.1.v4.1 270 59.9491 1447.01 1404.39 Potri.015G069301.1.v4.1 564 295.128 0 0 Potri.010G195200.1.v4.1 1773 1498.26 138.912 5.39448 Potri.012G127500.1.v4.1 977 702.265 9922 822.046 ==> SRR7169105.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2220 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 367 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169105 completed mapping pipeline successfully