Starting /dee2/code/volunteer_pipeline.sh SRR7169106 current disk space = 3057055657984 free memory = 1287089552 SRR7169106 SRAfilesize 2022bdd3d2c5284b1e337b15792e5d47 SRR7169106.sra SRR7169106.sra file validated SRR7169106 is paired end SRR7169106 is conventional basespace SRR7169106 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169106_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.65425 34.0 33.0 34.0 32.0 34.0 2 33.29575 34.0 33.0 34.0 32.0 34.0 3 33.31075 34.0 33.0 34.0 33.0 34.0 4 33.4275 34.0 33.0 34.0 33.0 34.0 5 33.41575 34.0 33.0 34.0 33.0 34.0 6 37.0635 38.0 37.0 38.0 36.0 38.0 7 37.30575 38.0 38.0 38.0 37.0 38.0 8 37.373 38.0 38.0 38.0 37.0 38.0 9 37.383 38.0 38.0 38.0 37.0 38.0 10-14 37.1037 38.0 38.0 38.0 36.0 38.0 15-19 37.084950000000006 38.0 38.0 38.0 36.2 38.0 20-24 37.34325 38.0 38.0 38.0 36.8 38.0 25-29 37.191649999999996 38.0 38.0 38.0 36.2 38.0 30-34 37.1979 38.0 38.0 38.0 36.6 38.0 35-39 37.21645 38.0 38.0 38.0 36.2 38.0 40-44 37.01604999999999 38.0 38.0 38.0 35.8 38.0 45-49 36.74849999999999 38.0 38.0 38.0 34.6 38.0 50-54 36.65955 38.0 38.0 38.0 34.2 38.0 55-59 36.1973 38.0 37.0 38.0 33.0 38.0 60-64 36.493050000000004 38.0 37.4 38.0 34.0 38.0 65-69 36.1721 38.0 37.2 38.0 32.6 38.0 70-74 36.146 38.0 37.0 38.0 32.8 38.0 75-79 36.12375 38.0 37.0 38.0 32.6 38.0 80-84 36.13985 38.0 37.0 38.0 33.0 38.0 85-89 35.8081 38.0 36.6 38.0 31.4 38.0 90-94 35.5628 38.0 36.4 38.0 29.8 38.0 95-99 35.699000000000005 38.0 36.4 38.0 31.0 38.0 100-104 35.1401 38.0 35.6 38.0 28.4 38.0 105-109 34.43095 38.0 34.8 38.0 23.4 38.0 110-114 34.7069 38.0 34.8 38.0 26.0 38.0 115-119 34.868399999999994 38.0 35.2 38.0 27.6 38.0 120-124 34.526300000000006 38.0 35.0 38.0 25.6 38.0 125-129 33.8618 38.0 34.0 38.0 21.4 38.0 130-134 34.025 38.0 34.0 38.0 23.0 38.0 135-139 33.42614999999999 38.0 34.0 38.0 19.0 38.0 140-144 32.45325 37.0 33.0 38.0 14.2 38.0 145-149 31.9156 36.4 33.0 38.0 11.6 38.0 150-151 27.82375 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 2.0 15 1.0 16 3.0 17 3.0 18 3.0 19 6.0 20 5.0 21 9.0 22 11.0 23 7.0 24 21.0 25 16.0 26 27.0 27 47.0 28 55.0 29 74.0 30 81.0 31 86.0 32 106.0 33 170.0 34 250.0 35 449.0 36 913.0 37 1653.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.134152585765484 12.877624167946749 8.755760368663594 32.232462877624165 2 24.3 14.499999999999998 33.2 28.000000000000004 3 19.575 20.025000000000002 27.200000000000003 33.2 4 23.125 26.525 23.474999999999998 26.875 5 23.400000000000002 31.7 24.05 20.849999999999998 6 19.35 35.125 24.75 20.775 7 14.975 27.125 39.35 18.55 8 17.45 26.025 30.7 25.825 9 17.224999999999998 24.55 33.675 24.55 10-14 20.13 30.214999999999996 26.82 22.835 15-19 19.575 28.845 27.49 24.09 20-24 20.255000000000003 28.389999999999997 27.644999999999996 23.71 25-29 19.93 28.93 27.284999999999997 23.855 30-34 20.669999999999998 28.77 27.07 23.49 35-39 20.195 28.93 27.07 23.805 40-44 20.695 28.82 27.405 23.080000000000002 45-49 20.48 28.299999999999997 27.450000000000003 23.77 50-54 20.535 28.244999999999997 27.435 23.785 55-59 20.68 28.735 27.54 23.044999999999998 60-64 20.46 28.465 27.755000000000003 23.32 65-69 20.205000000000002 28.565 27.565 23.665 70-74 20.5330799619943 28.424263639545934 27.394109116367453 23.648547282092313 75-79 20.24101205060253 28.0114005700285 27.426371318565927 24.321216060803042 80-84 20.696034801740087 28.366418320916047 27.2213610680534 23.71618580929046 85-89 20.905 28.375 27.505000000000003 23.215 90-94 19.99199919991999 27.96779677967797 27.477747774777477 24.56245624562456 95-99 20.5 28.655 27.279999999999998 23.565 100-104 20.880000000000003 28.294999999999998 27.41 23.415 105-109 20.599999999999998 27.644999999999996 27.82 23.935000000000002 110-114 21.139227845569113 28.600720144028806 26.875375075015 23.384676935387077 115-119 20.7910395519776 28.616430821541076 27.02135106755338 23.571178558927947 120-124 21.358203730559584 27.57913687053058 27.109066359953992 23.95359303895584 125-129 20.673100965144773 28.31924788718308 27.6741511226684 23.33350002500375 130-134 21.02 27.97 27.51 23.5 135-139 20.845 27.865000000000002 27.295 23.995 140-144 20.76 28.21 27.675 23.355 145-149 21.071053552677636 27.76638831941597 27.336366818340917 23.826191309565477 150-151 19.977497187148394 28.066008251031377 28.34104263032879 23.615451931491435 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 1.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.5 24 2.5 25 3.0 26 4.5 27 7.0 28 10.5 29 13.5 30 19.5 31 24.0 32 28.0 33 38.5 34 39.0 35 51.5 36 86.5 37 117.5 38 128.0 39 144.5 40 172.0 41 206.5 42 237.5 43 251.5 44 280.0 45 283.0 46 246.5 47 243.0 48 251.0 49 222.5 50 182.5 51 155.0 52 136.0 53 110.0 54 85.5 55 63.5 56 40.0 57 25.5 58 21.0 59 15.0 60 9.0 61 6.0 62 6.0 63 6.5 64 5.0 65 2.5 66 3.0 67 3.0 68 2.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.015 75-79 0.005 80-84 0.005 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.02 115-119 0.005 120-124 0.015 125-129 0.015 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.8374999999999999 0.0 0.0 0.0 0.0 130-131 1.0 0.0 0.0 0.0 0.0 132-133 1.125 0.0 0.0 0.0 0.0 134-135 1.1875 0.0 0.0 0.0 0.0 136-137 1.2875 0.0 0.0 0.0 0.0 138-139 1.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTGGC 10 0.0068343505 144.975 2 ACCAACT 10 0.0068343505 144.975 7 >>END_MODULE SRR7169106 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169106_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77325 33.0 33.0 34.0 32.0 34.0 2 33.0215 34.0 33.0 34.0 32.0 34.0 3 32.97325 34.0 33.0 34.0 32.0 34.0 4 32.97025 34.0 33.0 34.0 32.0 34.0 5 32.9805 34.0 33.0 34.0 32.0 34.0 6 37.094 38.0 38.0 38.0 37.0 38.0 7 37.018 38.0 38.0 38.0 37.0 38.0 8 37.1665 38.0 38.0 38.0 37.0 38.0 9 36.8005 38.0 38.0 38.0 36.0 38.0 10-14 36.82555000000001 38.0 38.0 38.0 35.8 38.0 15-19 36.917950000000005 38.0 38.0 38.0 36.2 38.0 20-24 36.8131 38.0 38.0 38.0 35.8 38.0 25-29 36.9196 38.0 38.0 38.0 36.6 38.0 30-34 36.90925 38.0 38.0 38.0 36.2 38.0 35-39 36.5784 38.0 38.0 38.0 35.0 38.0 40-44 36.57615 38.0 38.0 38.0 35.0 38.0 45-49 36.83155 38.0 38.0 38.0 36.0 38.0 50-54 36.84949999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.71795 38.0 38.0 38.0 35.4 38.0 60-64 36.742399999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.6011 38.0 38.0 38.0 35.0 38.0 70-74 36.294000000000004 38.0 38.0 38.0 34.2 38.0 75-79 36.421749999999996 38.0 38.0 38.0 34.4 38.0 80-84 36.3502 38.0 38.0 38.0 34.0 38.0 85-89 36.063 38.0 38.0 38.0 32.8 38.0 90-94 36.0507 38.0 38.0 38.0 33.2 38.0 95-99 36.06865 38.0 38.0 38.0 33.6 38.0 100-104 36.044450000000005 38.0 38.0 38.0 33.4 38.0 105-109 35.77290000000001 38.0 37.4 38.0 31.8 38.0 110-114 35.445499999999996 38.0 37.0 38.0 30.2 38.0 115-119 35.24685000000001 38.0 36.6 38.0 29.2 38.0 120-124 35.384499999999996 38.0 36.8 38.0 30.2 38.0 125-129 35.158699999999996 38.0 36.0 38.0 29.8 38.0 130-134 34.50855 38.0 35.2 38.0 25.0 38.0 135-139 33.949650000000005 38.0 34.8 38.0 22.2 38.0 140-144 34.10795 38.0 35.0 38.0 23.8 38.0 145-149 33.61345 38.0 35.0 38.0 21.0 38.0 150-151 30.218000000000004 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 2.0 5 2.0 6 3.0 7 3.0 8 1.0 9 1.0 10 2.0 11 1.0 12 2.0 13 1.0 14 4.0 15 1.0 16 5.0 17 5.0 18 9.0 19 7.0 20 7.0 21 12.0 22 5.0 23 11.0 24 15.0 25 19.0 26 21.0 27 27.0 28 40.0 29 60.0 30 63.0 31 58.0 32 94.0 33 87.0 34 155.0 35 243.0 36 507.0 37 2515.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.647752950037656 23.299020838563898 12.302284710017574 23.75094150138087 2 26.775 26.950000000000003 28.999999999999996 17.275 3 20.4 28.275 30.8 20.525 4 22.7 33.7 23.625 19.975 5 22.875 36.425000000000004 22.55 18.15 6 20.65 37.65 22.95 18.75 7 20.0 23.65 37.275000000000006 19.075 8 22.15 25.650000000000002 27.625 24.575 9 22.575 23.575 29.775000000000002 24.075 10-14 22.996149807490372 29.04645232261613 26.271313565678284 21.68608430421521 15-19 23.086154307715386 28.081404070203508 27.481374068703435 21.35106755337767 20-24 23.27232723272327 28.352835283528353 27.35273527352735 21.02210221022102 25-29 22.944177671068427 28.19627851140456 27.96618647458984 20.893357342937176 30-34 23.505278430980137 28.2883874518437 27.19767849101916 21.008655626157 35-39 22.684536907381474 28.230646129225846 28.255651130226045 20.829165833166634 40-44 23.260238309802745 28.00640833083008 27.310503654751177 21.422849704616002 45-49 23.411705852926463 27.598799399699853 27.70885442721361 21.280640320160078 50-54 23.577683262446836 27.05529146860145 27.995996997748314 21.3710282712034 55-59 23.84 27.72 27.195000000000004 21.245 60-64 23.63299814898194 27.25499024463455 27.980389214067735 21.131622392315773 65-69 23.372011603481045 27.093127938381517 28.533560068020407 21.001300390117038 70-74 23.853578036705507 28.084212631894783 27.604140621093165 20.458068710306545 75-79 23.057681724948722 27.204962729501226 28.275551553354344 21.46180399219571 80-84 23.242079975977177 27.531154596867026 28.266853510835293 20.959911916320504 85-89 23.991199559978 27.801390069503473 27.36136806840342 20.846042302115105 90-94 23.36817886260191 27.90976841894663 27.659680888310913 21.06237183014055 95-99 23.524409763905563 27.355942376950782 28.26130452180872 20.858343337334933 100-104 24.507450745074507 27.377737773777376 27.37273727372737 20.742074207420742 105-109 23.780915189746672 27.33553619705617 27.670972263943128 21.212576349254032 110-114 23.71608769646611 27.59535489037942 28.065872459705677 20.622684953448793 115-119 23.788325914069926 27.51463012054219 27.934777172010207 20.76226679337768 120-124 23.66973394678936 27.145429085817163 27.885577115423082 21.299259851970394 125-129 23.303642914331466 28.442754203362693 27.381905524419537 20.87169735788631 130-134 23.822173215717722 27.726543704891743 27.275461106655975 21.175821972734564 135-139 23.351194351244427 27.552706695377836 27.908257799589364 21.187841153788373 140-144 23.969549757099216 27.295036810737717 27.755797065157513 20.979616367005562 145-149 24.10235865591667 27.883218989433622 27.402473834443384 20.61194852020632 150-151 23.8817190828217 27.327402581130183 28.41749154241323 20.373386793634882 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 0.5 25 0.5 26 1.5 27 1.0 28 2.0 29 5.0 30 11.0 31 13.0 32 15.5 33 24.5 34 33.5 35 51.5 36 77.0 37 92.0 38 107.0 39 149.0 40 200.5 41 240.5 42 269.5 43 282.5 44 288.5 45 292.5 46 294.0 47 294.0 48 268.5 49 215.0 50 165.0 51 136.5 52 114.5 53 86.5 54 71.5 55 59.5 56 37.5 57 23.0 58 18.5 59 13.5 60 10.5 61 9.0 62 6.5 63 5.5 64 2.5 65 1.5 66 1.0 67 0.0 68 0.5 69 1.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.005 20-24 0.01 25-29 0.04 30-34 0.065 35-39 0.02 40-44 0.13 45-49 0.05 50-54 0.075 55-59 0.0 60-64 0.055 65-69 0.03 70-74 0.015 75-79 0.055 80-84 0.095 85-89 0.005 90-94 0.034999999999999996 95-99 0.04 100-104 0.01 105-109 0.13 110-114 0.11 115-119 0.034999999999999996 120-124 0.02 125-129 0.08 130-134 0.24 135-139 0.155 140-144 0.165 145-149 0.155 150-151 0.2375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62330487192365 99.175 2 0.30135610246107486 0.6 3 0.07533902561526871 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.675 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.9750000000000001 0.0 0.0 0.0 0.0 132-133 1.1 0.0 0.0 0.0 0.0 134-135 1.1625 0.0 0.0 0.0 0.0 136-137 1.2625000000000002 0.0 0.0 0.0 0.0 138-139 1.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACGG 10 0.006832588 144.9875 3 >>END_MODULE Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982616 spots for SRR7169106.sra Written 982616 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra Read 982615 spots for SRR7169106.sra Written 982615 spots for SRR7169106.sra SRR ids: ['SRR7169106.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9igbcuay SRR7169106.sra spots: 19652301 blocks: [[1, 982615], [982616, 1965230], [1965231, 2947845], [2947846, 3930460], [3930461, 4913075], [4913076, 5895690], [5895691, 6878305], [6878306, 7860920], [7860921, 8843535], [8843536, 9826150], [9826151, 10808765], [10808766, 11791380], [11791381, 12773995], [12773996, 13756610], [13756611, 14739225], [14739226, 15721840], [15721841, 16704455], [16704456, 17687070], [17687071, 18669685], [18669686, 19652301]] SRR7169106 file size 6637819 SRR7169106 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169106 SRR7169106_1.fastq SRR7169106_2.fastq Input file: SRR7169106_1.fastq Paired file: SRR7169106_2.fastq trimmed: SRR7169106-trimmed-pair1.fastq, SRR7169106-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:02:18 2025 >> started Mon Feb 10 22:02:42 2025 >> done (24.216s) 19652301 read pairs processed; of these: 23488 ( 0.12%) short read pairs filtered out after trimming by size control 14366 ( 0.07%) empty read pairs filtered out after trimming by size control 19614447 (99.81%) read pairs available; of these: 9480962 (48.34%) trimmed read pairs available after processing 10133485 (51.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 8 0.00% 21 8 0.00% 22 2 0.00% 23 5 0.00% 24 6 0.00% 25 5 0.00% 26 9 0.00% 27 10 0.00% 28 9 0.00% 29 7 0.00% 30 15 0.00% 31 9 0.00% 32 10 0.00% 33 9 0.00% 34 11 0.00% 35 9 0.00% 36 10 0.00% 37 18 0.00% 38 9 0.00% 39 14 0.00% 40 16 0.00% 41 20 0.00% 42 18 0.00% 43 27 0.00% 44 31 0.00% 45 19 0.00% 46 28 0.00% 47 42 0.00% 48 33 0.00% 49 37 0.00% 50 34 0.00% 51 29 0.00% 52 44 0.00% 53 35 0.00% 54 53 0.00% 55 69 0.00% 56 48 0.00% 57 58 0.00% 58 82 0.00% 59 79 0.00% 60 87 0.00% 61 98 0.00% 62 105 0.00% 63 136 0.00% 64 164 0.00% 65 184 0.00% 66 246 0.00% 67 232 0.00% 68 194 0.00% 69 239 0.00% 70 281 0.00% 71 279 0.00% 72 321 0.00% 73 372 0.00% 74 368 0.00% 75 371 0.00% 76 428 0.00% 77 552 0.00% 78 524 0.00% 79 577 0.00% 80 676 0.00% 81 814 0.00% 82 933 0.00% 83 1280 0.01% 84 2246 0.01% 85 2745 0.01% 86 2906 0.01% 87 3080 0.02% 88 3051 0.02% 89 3092 0.02% 90 3288 0.02% 91 3452 0.02% 92 3586 0.02% 93 3621 0.02% 94 3850 0.02% 95 4124 0.02% 96 4366 0.02% 97 4817 0.02% 98 4900 0.02% 99 5313 0.03% 100 5497 0.03% 101 6081 0.03% 102 6366 0.03% 103 6794 0.03% 104 7349 0.04% 105 7941 0.04% 106 8414 0.04% 107 8982 0.05% 108 9343 0.05% 109 9939 0.05% 110 10569 0.05% 111 11477 0.06% 112 12139 0.06% 113 12974 0.07% 114 13753 0.07% 115 14751 0.08% 116 15590 0.08% 117 16784 0.09% 118 17381 0.09% 119 18229 0.09% 120 19334 0.10% 121 20479 0.10% 122 21802 0.11% 123 23672 0.12% 124 25057 0.13% 125 27130 0.14% 126 28953 0.15% 127 31048 0.16% 128 33370 0.17% 129 35692 0.18% 130 38132 0.19% 131 41449 0.21% 132 45128 0.23% 133 49350 0.25% 134 53542 0.27% 135 58774 0.30% 136 64211 0.33% 137 71812 0.37% 138 80047 0.41% 139 88688 0.45% 140 99926 0.51% 141 113061 0.58% 142 133270 0.68% 143 150148 0.77% 144 183204 0.93% 145 226993 1.16% 146 294064 1.50% 147 402763 2.05% 148 614196 3.13% 149 1212777 6.18% 150 4903644 25.00% 151 10133485 51.66% 19614447 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=33 prefix-density=0.24 prefix-fanout=2.5 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.15 sequence-density-rank=5 fanout-score=82.10 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=18.1 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=37 prefix-density=0.21 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=53.50 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=13.1 sequence=TCAAGGAAGCTTTCAG SRR7169106 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:03:38 Started mapping on | Feb 10 22:03:38 Finished on | Feb 10 22:06:18 Mapping speed, Million of reads per hour | 441.33 Number of input reads | 19614447 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18294765 Uniquely mapped reads % | 93.27% Average mapped length | 296.58 Number of splices: Total | 17977012 Number of splices: Annotated (sjdb) | 17698187 Number of splices: GT/AG | 17726322 Number of splices: GC/AG | 202712 Number of splices: AT/AC | 14465 Number of splices: Non-canonical | 33513 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.02% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 339290 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 28588 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.81% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1004486 1004486 1004486 N_multimapping 339290 339290 339290 N_noFeature 365492 18092921 445292 N_ambiguous 200619 828 78035 UnstrandedReadsAssigned:17728654 PositiveStrandReadsAssigned:201016 NegativeStrandReadsAssigned:17771438 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169106 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169106-trimmed-pair1.fastq SRR7169106-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,614,447 reads, 17,654,125 reads pseudoaligned [quant] estimated average fragment length: 270.719 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 SRR7169106.ke.tsv 34699 SRR7169106.se.tsv 87100 total ==> SRR7169106.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.28 354 10.8439 Potri.005G024800.1.v4.1 1035 765.281 25 1.7495 Potri.004G059700.1.v4.1 961 691.311 8 0.619742 Potri.007G009000.2.v4.1 1416 1146.28 0 0 Potri.003G141000.2.v4.1 2943 2673.28 328.091 6.57272 Potri.016G087400.1.v4.1 270 62.0477 1254 1082.35 Potri.015G069301.1.v4.1 564 300.242 0 0 Potri.010G195200.1.v4.1 1773 1503.28 25 0.890625 Potri.012G127500.1.v4.1 977 707.305 3986 301.804 ==> SRR7169106.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1571 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 302 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169106 completed mapping pipeline successfully