Starting /dee2/code/volunteer_pipeline.sh SRR7169107 current disk space = 3057224781824 free memory = 1511271932 SRR7169107 SRAfilesize b4a3ac5d25bdd5a643c22fae8872d9d2 SRR7169107.sra SRR7169107.sra file validated SRR7169107 is paired end SRR7169107 is conventional basespace SRR7169107 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169107_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93175 34.0 33.0 34.0 33.0 34.0 2 33.39525 34.0 33.0 34.0 33.0 34.0 3 33.4525 34.0 34.0 34.0 33.0 34.0 4 33.4805 34.0 34.0 34.0 33.0 34.0 5 33.3685 34.0 34.0 34.0 33.0 34.0 6 36.88875 38.0 37.0 38.0 35.0 38.0 7 37.2585 38.0 38.0 38.0 36.0 38.0 8 37.38425 38.0 38.0 38.0 37.0 38.0 9 37.43225 38.0 38.0 38.0 37.0 38.0 10-14 37.396950000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.3227 38.0 38.0 38.0 37.0 38.0 20-24 37.26715 38.0 38.0 38.0 36.8 38.0 25-29 37.2484 38.0 38.0 38.0 36.8 38.0 30-34 37.229949999999995 38.0 38.0 38.0 36.4 38.0 35-39 37.12775 38.0 38.0 38.0 36.2 38.0 40-44 36.7736 38.0 38.0 38.0 34.8 38.0 45-49 36.599599999999995 38.0 38.0 38.0 34.0 38.0 50-54 36.4245 38.0 37.2 38.0 33.8 38.0 55-59 36.38955 38.0 37.0 38.0 33.8 38.0 60-64 36.3014 38.0 37.0 38.0 33.8 38.0 65-69 36.204899999999995 38.0 37.0 38.0 33.0 38.0 70-74 36.127449999999996 38.0 37.0 38.0 32.6 38.0 75-79 36.01335 38.0 37.0 38.0 32.8 38.0 80-84 35.92505 38.0 37.0 38.0 32.0 38.0 85-89 35.654250000000005 38.0 36.4 38.0 30.0 38.0 90-94 35.4699 38.0 36.0 38.0 29.0 38.0 95-99 35.3512 38.0 36.0 38.0 29.0 38.0 100-104 35.0427 38.0 35.8 38.0 28.6 38.0 105-109 34.70485 38.0 35.0 38.0 26.4 38.0 110-114 34.481649999999995 38.0 34.8 38.0 25.8 38.0 115-119 34.18035 38.0 34.0 38.0 24.0 38.0 120-124 33.9548 38.0 34.0 38.0 22.6 38.0 125-129 33.48565 38.0 34.0 38.0 18.2 38.0 130-134 33.07295 37.8 33.4 38.0 16.2 38.0 135-139 32.676100000000005 37.2 33.0 38.0 15.0 38.0 140-144 32.04845 36.4 32.2 38.0 14.0 38.0 145-149 31.05665 36.0 31.0 38.0 11.2 38.0 150-151 27.153125000000003 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 2.0 13 1.0 14 0.0 15 4.0 16 5.0 17 3.0 18 10.0 19 6.0 20 9.0 21 15.0 22 18.0 23 16.0 24 13.0 25 18.0 26 39.0 27 37.0 28 42.0 29 69.0 30 57.0 31 94.0 32 109.0 33 185.0 34 276.0 35 501.0 36 1066.0 37 1402.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.244224422442244 13.582127443513581 9.900990099009901 34.27265803503427 2 24.05 13.750000000000002 32.725 29.475 3 20.325 18.525 27.925 33.225 4 24.15 25.474999999999998 23.025000000000002 27.35 5 23.325000000000003 31.825 23.575 21.275 6 21.525 33.800000000000004 23.7 20.974999999999998 7 15.950000000000001 28.199999999999996 38.75 17.1 8 17.575 27.650000000000002 30.225 24.55 9 18.2 25.724999999999998 32.525 23.549999999999997 10-14 19.68 30.14 26.765 23.415 15-19 20.465 28.605000000000004 27.495000000000005 23.435 20-24 20.4 29.12 27.445000000000004 23.035 25-29 20.49 28.99 26.974999999999998 23.544999999999998 30-34 19.564999999999998 29.799999999999997 26.825 23.810000000000002 35-39 20.11 29.044999999999998 26.740000000000002 24.104999999999997 40-44 19.939999999999998 29.15 27.33 23.580000000000002 45-49 20.455000000000002 28.355000000000004 27.034999999999997 24.154999999999998 50-54 20.0 28.835 27.445000000000004 23.72 55-59 20.515 28.475 27.089999999999996 23.919999999999998 60-64 20.435 28.375 27.22 23.97 65-69 20.135 29.049999999999997 27.034999999999997 23.78 70-74 20.39 28.22 27.185 24.205 75-79 20.31 28.235 27.435 24.02 80-84 20.23 28.000000000000004 27.47 24.3 85-89 20.665 28.355000000000004 27.224999999999998 23.755000000000003 90-94 20.465 28.53 26.855 24.15 95-99 20.580000000000002 28.205000000000002 27.1 24.115000000000002 100-104 20.41 28.265 27.21 24.115000000000002 105-109 20.669999999999998 27.675 27.68 23.974999999999998 110-114 21.13 27.92 27.415 23.535 115-119 21.04 27.455000000000002 27.389999999999997 24.115000000000002 120-124 20.815 28.444999999999997 27.150000000000002 23.59 125-129 20.785 27.775 27.229999999999997 24.21 130-134 21.175 27.67 27.29 23.865 135-139 20.65603280164008 27.961398069903492 27.50637531876594 23.876193809690484 140-144 20.635 27.884999999999998 27.245 24.235 145-149 21.33 27.500000000000004 27.235 23.935000000000002 150-151 20.7 28.787499999999998 26.75 23.7625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 1.5 18 0.5 19 1.5 20 1.5 21 0.5 22 1.0 23 1.5 24 1.0 25 2.5 26 5.5 27 6.0 28 7.5 29 11.5 30 20.0 31 28.5 32 42.0 33 48.5 34 53.0 35 65.0 36 76.5 37 92.0 38 123.0 39 151.0 40 163.5 41 189.5 42 212.5 43 243.5 44 268.0 45 248.0 46 252.0 47 276.5 48 258.0 49 233.5 50 197.0 51 156.0 52 123.0 53 96.0 54 85.0 55 69.5 56 46.5 57 33.0 58 27.5 59 22.5 60 16.0 61 6.5 62 5.5 63 7.0 64 4.5 65 3.5 66 4.0 67 2.0 68 1.0 69 1.0 70 2.0 71 1.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.725 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.9625 0.0 0.0 0.0 0.0 132-133 1.0625 0.0 0.0 0.0 0.0 134-135 1.1 0.0 0.0 0.0 0.0 136-137 1.275 0.0 0.0 0.0 0.0 138-139 1.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169107 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169107_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.771 33.0 33.0 34.0 32.0 34.0 2 32.86675 34.0 33.0 34.0 32.0 34.0 3 32.943 34.0 33.0 34.0 32.0 34.0 4 32.80325 34.0 33.0 34.0 32.0 34.0 5 32.90325 34.0 33.0 34.0 32.0 34.0 6 36.98075 38.0 38.0 38.0 37.0 38.0 7 37.015 38.0 38.0 38.0 37.0 38.0 8 36.9335 38.0 38.0 38.0 37.0 38.0 9 36.97125 38.0 38.0 38.0 37.0 38.0 10-14 36.9395 38.0 38.0 38.0 36.4 38.0 15-19 36.8073 38.0 38.0 38.0 36.0 38.0 20-24 36.84765 38.0 38.0 38.0 36.2 38.0 25-29 36.83069999999999 38.0 38.0 38.0 36.6 38.0 30-34 36.810950000000005 38.0 38.0 38.0 36.2 38.0 35-39 36.73735 38.0 38.0 38.0 36.0 38.0 40-44 36.646699999999996 38.0 38.0 38.0 35.8 38.0 45-49 36.70605 38.0 38.0 38.0 36.0 38.0 50-54 36.658849999999994 38.0 38.0 38.0 36.0 38.0 55-59 36.74785 38.0 38.0 38.0 36.0 38.0 60-64 36.677049999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.58390000000001 38.0 38.0 38.0 35.6 38.0 70-74 36.508300000000006 38.0 38.0 38.0 35.2 38.0 75-79 36.382450000000006 38.0 38.0 38.0 34.8 38.0 80-84 36.3404 38.0 38.0 38.0 34.2 38.0 85-89 36.18965 38.0 38.0 38.0 34.0 38.0 90-94 36.194250000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.0535 38.0 38.0 38.0 33.8 38.0 100-104 35.87585 38.0 38.0 38.0 33.2 38.0 105-109 35.725100000000005 38.0 38.0 38.0 32.6 38.0 110-114 35.673899999999996 38.0 37.8 38.0 32.6 38.0 115-119 35.40225 38.0 37.0 38.0 30.8 38.0 120-124 35.2657 38.0 37.0 38.0 31.0 38.0 125-129 34.91645 38.0 36.2 38.0 28.0 38.0 130-134 34.6956 38.0 36.0 38.0 27.8 38.0 135-139 34.458999999999996 38.0 36.0 38.0 25.2 38.0 140-144 34.06375 38.0 35.4 38.0 22.6 38.0 145-149 33.223349999999996 38.0 35.0 38.0 14.0 38.0 150-151 29.830750000000002 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 9.0 4 2.0 5 5.0 6 2.0 7 2.0 8 3.0 9 1.0 10 1.0 11 3.0 12 4.0 13 6.0 14 5.0 15 4.0 16 4.0 17 8.0 18 5.0 19 4.0 20 6.0 21 9.0 22 8.0 23 11.0 24 17.0 25 10.0 26 29.0 27 32.0 28 37.0 29 32.0 30 40.0 31 52.0 32 76.0 33 80.0 34 138.0 35 216.0 36 479.0 37 2644.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.35 22.25 15.024999999999999 25.374999999999996 2 28.825 27.0 26.924999999999997 17.25 3 19.5 28.95 30.775000000000002 20.775 4 23.175 33.875 23.875 19.075 5 24.7 35.525 21.275 18.5 6 21.55 38.2 21.825 18.425 7 21.075 22.1 36.825 20.0 8 23.974999999999998 25.95 25.174999999999997 24.9 9 22.025 25.674999999999997 29.975 22.325 10-14 24.4 28.895 25.575 21.13 15-19 24.42 27.805000000000003 26.810000000000002 20.965 20-24 24.279999999999998 27.965 27.0 20.755000000000003 25-29 23.849999999999998 27.889999999999997 26.735 21.525 30-34 23.369999999999997 28.384999999999998 26.590000000000003 21.654999999999998 35-39 23.32 27.944999999999997 27.1 21.634999999999998 40-44 23.685000000000002 28.21 27.139999999999997 20.965 45-49 24.065 27.67 27.229999999999997 21.035 50-54 23.61 27.815 27.3 21.275 55-59 24.355 27.700000000000003 27.13 20.815 60-64 23.080000000000002 27.744999999999997 27.79 21.385 65-69 24.103077307980985 27.935951963972975 26.83512634475857 21.125844383287465 70-74 23.605687393611696 27.901271653149095 27.025132672474218 21.467908280764995 75-79 23.48165965123271 28.18200040088194 27.370214471838043 20.966125476047303 80-84 24.235 27.04 27.875 20.849999999999998 85-89 23.79 27.16 27.3 21.75 90-94 23.995 27.884999999999998 27.12 21.0 95-99 24.22 27.245 27.29 21.245 100-104 24.215 27.750000000000004 27.295 20.74 105-109 24.34 27.72 27.07 20.87 110-114 24.44 27.884999999999998 26.889999999999997 20.785 115-119 24.565 27.700000000000003 26.945000000000004 20.79 120-124 24.060000000000002 27.450000000000003 27.195000000000004 21.295 125-129 24.404999999999998 28.04 26.779999999999998 20.775 130-134 24.285 28.065 26.674999999999997 20.974999999999998 135-139 24.495 27.74 27.08 20.685000000000002 140-144 24.245 28.175 27.115000000000002 20.465 145-149 24.65368399919695 28.367797630997792 26.801847018670948 20.17667135113431 150-151 24.637681159420293 26.906112161310645 27.952110901071205 20.504095778197858 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 1.0 23 1.0 24 0.0 25 1.5 26 2.5 27 2.0 28 1.5 29 6.0 30 8.5 31 7.0 32 14.0 33 22.5 34 28.5 35 37.5 36 52.0 37 71.5 38 92.5 39 137.5 40 193.5 41 221.0 42 252.0 43 272.5 44 288.0 45 311.0 46 295.0 47 263.5 48 257.0 49 232.5 50 185.5 51 163.0 52 142.0 53 114.0 54 87.0 55 63.5 56 48.0 57 31.5 58 19.0 59 17.5 60 14.0 61 8.0 62 6.0 63 6.0 64 5.5 65 4.0 66 1.5 67 1.0 68 1.0 69 1.5 70 2.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.075 70-74 0.13 75-79 0.22 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.38 150-151 0.8125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.025 0.0 118-119 0.425 0.0 0.0 0.025 0.0 120-121 0.4625 0.0 0.0 0.025 0.0 122-123 0.55 0.0 0.0 0.025 0.0 124-125 0.575 0.0 0.0 0.025 0.0 126-127 0.675 0.0 0.0 0.025 0.0 128-129 0.75 0.0 0.0 0.025 0.0 130-131 0.8875 0.0 0.0 0.025 0.0 132-133 1.0125 0.0 0.0 0.025 0.0 134-135 1.0499999999999998 0.0 0.0 0.025 0.0 136-137 1.2374999999999998 0.0 0.0 0.025 0.0 138-139 1.375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATAACA 10 0.006830828 145.0 2 ATAACAT 10 0.006830828 145.0 3 >>END_MODULE Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818300 spots for SRR7169107.sra Written 818300 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra Read 818297 spots for SRR7169107.sra Written 818297 spots for SRR7169107.sra SRR ids: ['SRR7169107.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_06r1zis5 SRR7169107.sra spots: 16365943 blocks: [[1, 818297], [818298, 1636594], [1636595, 2454891], [2454892, 3273188], [3273189, 4091485], [4091486, 4909782], [4909783, 5728079], [5728080, 6546376], [6546377, 7364673], [7364674, 8182970], [8182971, 9001267], [9001268, 9819564], [9819565, 10637861], [10637862, 11456158], [11456159, 12274455], [12274456, 13092752], [13092753, 13911049], [13911050, 14729346], [14729347, 15547643], [15547644, 16365943]] SRR7169107 file size 5524180 SRR7169107 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169107 SRR7169107_1.fastq SRR7169107_2.fastq Input file: SRR7169107_1.fastq Paired file: SRR7169107_2.fastq trimmed: SRR7169107-trimmed-pair1.fastq, SRR7169107-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:15:49 2025 >> started Mon Feb 10 22:16:09 2025 >> done (20.206s) 16365943 read pairs processed; of these: 26725 ( 0.16%) short read pairs filtered out after trimming by size control 19332 ( 0.12%) empty read pairs filtered out after trimming by size control 16319886 (99.72%) read pairs available; of these: 7812366 (47.87%) trimmed read pairs available after processing 8507520 (52.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 4 0.00% 21 9 0.00% 22 6 0.00% 23 7 0.00% 24 9 0.00% 25 3 0.00% 26 8 0.00% 27 13 0.00% 28 8 0.00% 29 10 0.00% 30 19 0.00% 31 5 0.00% 32 6 0.00% 33 5 0.00% 34 10 0.00% 35 13 0.00% 36 18 0.00% 37 13 0.00% 38 11 0.00% 39 17 0.00% 40 28 0.00% 41 21 0.00% 42 24 0.00% 43 30 0.00% 44 19 0.00% 45 19 0.00% 46 27 0.00% 47 34 0.00% 48 43 0.00% 49 36 0.00% 50 42 0.00% 51 52 0.00% 52 54 0.00% 53 58 0.00% 54 62 0.00% 55 72 0.00% 56 73 0.00% 57 75 0.00% 58 98 0.00% 59 97 0.00% 60 112 0.00% 61 102 0.00% 62 121 0.00% 63 126 0.00% 64 140 0.00% 65 155 0.00% 66 174 0.00% 67 198 0.00% 68 215 0.00% 69 257 0.00% 70 277 0.00% 71 320 0.00% 72 325 0.00% 73 367 0.00% 74 412 0.00% 75 427 0.00% 76 489 0.00% 77 541 0.00% 78 628 0.00% 79 696 0.00% 80 715 0.00% 81 858 0.01% 82 1024 0.01% 83 1135 0.01% 84 2312 0.01% 85 3044 0.02% 86 2915 0.02% 87 3142 0.02% 88 3089 0.02% 89 3092 0.02% 90 3233 0.02% 91 3374 0.02% 92 3709 0.02% 93 3740 0.02% 94 3975 0.02% 95 4378 0.03% 96 4448 0.03% 97 4817 0.03% 98 4970 0.03% 99 5286 0.03% 100 5513 0.03% 101 5882 0.04% 102 6344 0.04% 103 6623 0.04% 104 7043 0.04% 105 7578 0.05% 106 8027 0.05% 107 8413 0.05% 108 9099 0.06% 109 9611 0.06% 110 10125 0.06% 111 10884 0.07% 112 11259 0.07% 113 12161 0.07% 114 12900 0.08% 115 13593 0.08% 116 14412 0.09% 117 15320 0.09% 118 16326 0.10% 119 17124 0.10% 120 18087 0.11% 121 19376 0.12% 122 20064 0.12% 123 21804 0.13% 124 23521 0.14% 125 24766 0.15% 126 27180 0.17% 127 28828 0.18% 128 30435 0.19% 129 32644 0.20% 130 34933 0.21% 131 37774 0.23% 132 40485 0.25% 133 44444 0.27% 134 47546 0.29% 135 51756 0.32% 136 56197 0.34% 137 62213 0.38% 138 69429 0.43% 139 77725 0.48% 140 85692 0.53% 141 95082 0.58% 142 106811 0.65% 143 122300 0.75% 144 145467 0.89% 145 178632 1.09% 146 228680 1.40% 147 323472 1.98% 148 490238 3.00% 149 952353 5.84% 150 4035687 24.73% 151 8507520 52.13% 16319886 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=33 prefix-density=0.24 prefix-fanout=1.9 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=445.16 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=19.9 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=6.44 fanout-score-rank=20 prefix-density=0.33 prefix-fanout=4.4 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGAT criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=144.60 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=13.8 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGAAGTTACCTGGGTACCACCCCAAGACTGAAGAAGAGAA SRR7169107 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:16:53 Started mapping on | Feb 10 22:16:54 Finished on | Feb 10 22:18:30 Mapping speed, Million of reads per hour | 612.00 Number of input reads | 16319886 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15325845 Uniquely mapped reads % | 93.91% Average mapped length | 296.24 Number of splices: Total | 14556005 Number of splices: Annotated (sjdb) | 14330441 Number of splices: GT/AG | 14346753 Number of splices: GC/AG | 169185 Number of splices: AT/AC | 11911 Number of splices: Non-canonical | 28156 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283805 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 17214 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.22% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 734483 734483 734483 N_multimapping 283805 283805 283805 N_noFeature 251847 15151168 324641 N_ambiguous 163737 729 61436 UnstrandedReadsAssigned:14910261 PositiveStrandReadsAssigned:173948 NegativeStrandReadsAssigned:14939768 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169107 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169107-trimmed-pair1.fastq SRR7169107-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,319,886 reads, 14,815,880 reads pseudoaligned [quant] estimated average fragment length: 270.715 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR7169107.ke.tsv 34699 SRR7169107.se.tsv 87100 total ==> SRR7169107.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.29 293 9.06645 Potri.005G024800.1.v4.1 1035 765.285 43 3.03967 Potri.004G059700.1.v4.1 961 691.319 2 0.156507 Potri.007G009000.2.v4.1 1416 1146.29 0 0 Potri.003G141000.2.v4.1 2943 2673.29 226.058 4.57464 Potri.016G087400.1.v4.1 270 60.6931 1853.56 1652.15 Potri.015G069301.1.v4.1 564 298.978 0 0 Potri.010G195200.1.v4.1 1773 1503.29 32 1.15157 Potri.012G127500.1.v4.1 977 707.299 7659 585.802 ==> SRR7169107.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1016 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 296 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169107 completed mapping pipeline successfully