Starting /dee2/code/volunteer_pipeline.sh SRR7169108 current disk space = 3056986460160 free memory = 1413080748 SRR7169108 SRAfilesize 5ef598c0d6525880fb01b1a8f8af88c6 SRR7169108.sra SRR7169108.sra file validated SRR7169108 is paired end SRR7169108 is conventional basespace SRR7169108 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169108_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.683 34.0 33.0 34.0 32.0 34.0 2 33.2795 34.0 33.0 34.0 32.0 34.0 3 33.29 34.0 33.0 34.0 33.0 34.0 4 33.39225 34.0 33.0 34.0 33.0 34.0 5 33.31625 34.0 33.0 34.0 33.0 34.0 6 36.94925 38.0 37.0 38.0 35.0 38.0 7 37.186 38.0 38.0 38.0 36.0 38.0 8 37.362 38.0 38.0 38.0 37.0 38.0 9 37.34975 38.0 38.0 38.0 37.0 38.0 10-14 37.03405 38.0 38.0 38.0 35.8 38.0 15-19 37.03060000000001 38.0 38.0 38.0 35.8 38.0 20-24 37.2697 38.0 38.0 38.0 36.8 38.0 25-29 37.10575 38.0 38.0 38.0 36.0 38.0 30-34 37.1714 38.0 38.0 38.0 36.4 38.0 35-39 37.1496 38.0 38.0 38.0 36.2 38.0 40-44 36.937400000000004 38.0 38.0 38.0 35.6 38.0 45-49 36.71545 38.0 38.0 38.0 34.4 38.0 50-54 36.536150000000006 38.0 37.8 38.0 34.0 38.0 55-59 36.206450000000004 38.0 37.0 38.0 33.2 38.0 60-64 36.4454 38.0 37.4 38.0 33.8 38.0 65-69 36.20565 38.0 37.2 38.0 33.0 38.0 70-74 36.030100000000004 38.0 37.0 38.0 32.2 38.0 75-79 36.03 38.0 37.0 38.0 32.6 38.0 80-84 36.0496 38.0 37.0 38.0 32.8 38.0 85-89 35.719800000000006 38.0 36.4 38.0 30.2 38.0 90-94 35.546299999999995 38.0 36.2 38.0 29.8 38.0 95-99 35.63035 38.0 36.2 38.0 30.2 38.0 100-104 35.039649999999995 38.0 35.6 38.0 27.8 38.0 105-109 34.33015 38.0 34.6 38.0 23.6 38.0 110-114 34.6712 38.0 34.6 38.0 26.0 38.0 115-119 34.8006 38.0 35.0 38.0 27.2 38.0 120-124 34.43665 38.0 34.6 38.0 25.2 38.0 125-129 33.757850000000005 38.0 34.0 38.0 21.0 38.0 130-134 33.9996 38.0 34.0 38.0 23.2 38.0 135-139 33.420750000000005 38.0 34.0 38.0 19.0 38.0 140-144 32.32395 36.6 32.2 38.0 14.2 38.0 145-149 31.870299999999997 36.0 32.6 38.0 11.6 38.0 150-151 27.753500000000003 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 0.0 13 2.0 14 1.0 15 0.0 16 2.0 17 5.0 18 2.0 19 2.0 20 4.0 21 5.0 22 14.0 23 19.0 24 23.0 25 22.0 26 27.0 27 41.0 28 45.0 29 60.0 30 73.0 31 97.0 32 139.0 33 176.0 34 265.0 35 450.0 36 976.0 37 1546.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.265644955300125 12.056194125159642 9.731800766283524 33.946360153256705 2 23.65 13.450000000000001 34.625 28.275 3 19.975 18.575 26.775 34.675 4 23.1 26.05 23.875 26.974999999999998 5 23.849999999999998 29.799999999999997 24.275 22.075 6 19.575 35.675000000000004 24.15 20.599999999999998 7 16.075 26.825 39.5 17.599999999999998 8 17.625 28.349999999999998 30.349999999999998 23.674999999999997 9 18.05 24.275 33.95 23.724999999999998 10-14 19.634999999999998 29.67 27.415 23.28 15-19 19.814999999999998 28.455000000000002 27.810000000000002 23.919999999999998 20-24 20.01 28.58 27.584999999999997 23.825 25-29 19.93 29.28 27.145000000000003 23.645 30-34 20.095 28.02 27.889999999999997 23.995 35-39 19.63 28.735 27.67 23.965 40-44 19.915 29.26 27.450000000000003 23.375 45-49 20.11 28.78 27.295 23.815 50-54 20.455000000000002 28.744999999999997 27.495000000000005 23.305 55-59 20.385 28.615000000000002 27.055 23.945 60-64 20.165 28.575 27.705000000000002 23.555 65-69 20.275000000000002 27.955000000000002 27.76 24.01 70-74 20.332199319591755 28.452071242745646 27.276365819491694 23.9393636181709 75-79 20.004000800160032 28.110622124424882 27.825565113022606 24.059811962392477 80-84 20.060030015007506 28.179089544772385 27.788894447223612 23.971985992996498 85-89 20.625 28.24 27.694999999999997 23.44 90-94 20.218087234893957 28.22128851540616 27.73609443777511 23.82452981192477 95-99 20.380000000000003 28.52 27.560000000000002 23.54 100-104 20.603090463569533 28.594289143371505 27.754163124468672 23.04845726859029 105-109 21.154999999999998 28.139999999999997 27.384999999999998 23.32 110-114 20.609121824364873 28.360672134426885 27.390478095619127 23.63972794558912 115-119 20.68223878357425 28.39993997899265 27.529635372380334 23.38818586505277 120-124 20.412247348409046 28.086852111266758 27.351410846507907 24.14948969381629 125-129 20.817490494296578 28.251951170702423 27.316389833900338 23.61416850110066 130-134 20.974999999999998 28.21 27.465 23.35 135-139 20.945 27.685 27.689999999999998 23.68 140-144 21.39 27.485 27.794999999999998 23.330000000000002 145-149 20.854170834166833 27.955591118223644 27.4004800960192 23.789757951590317 150-151 20.99799899949975 27.97648824412206 27.738869434717362 23.28664332166083 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 3.5 26 4.5 27 6.5 28 7.0 29 10.5 30 16.5 31 20.5 32 25.5 33 32.5 34 52.5 35 67.5 36 80.5 37 107.5 38 141.0 39 158.0 40 180.5 41 220.5 42 234.0 43 256.0 44 291.0 45 284.0 46 260.0 47 250.5 48 228.0 49 223.5 50 193.5 51 138.0 52 123.0 53 103.5 54 79.0 55 58.5 56 38.0 57 24.0 58 16.5 59 11.0 60 10.0 61 8.5 62 7.5 63 5.5 64 2.0 65 3.5 66 3.0 67 3.0 68 3.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.06 75-79 0.02 80-84 0.05 85-89 0.0 90-94 0.04 95-99 0.0 100-104 0.015 105-109 0.0 110-114 0.02 115-119 0.034999999999999996 120-124 0.06 125-129 0.06 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.175 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.225 0.0 0.0 0.0 0.0 124-125 0.2625 0.0 0.0 0.0 0.0 126-127 0.35 0.0 0.0 0.0 0.0 128-129 0.4375 0.0 0.0 0.0 0.0 130-131 0.475 0.0 0.0 0.0 0.0 132-133 0.5375000000000001 0.0 0.0 0.0 0.0 134-135 0.55 0.0 0.0 0.0 0.0 136-137 0.65 0.0 0.0 0.0 0.0 138-139 0.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAGGC 10 0.006832588 144.9875 8 >>END_MODULE SRR7169108 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169108_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.722 33.0 33.0 34.0 32.0 34.0 2 33.00375 34.0 33.0 34.0 32.0 34.0 3 32.99475 34.0 33.0 34.0 32.0 34.0 4 32.94775 34.0 33.0 34.0 32.0 34.0 5 32.9745 34.0 33.0 34.0 32.0 34.0 6 37.00675 38.0 38.0 38.0 37.0 38.0 7 36.984 38.0 38.0 38.0 36.0 38.0 8 37.119 38.0 38.0 38.0 37.0 38.0 9 36.77075 38.0 38.0 38.0 36.0 38.0 10-14 36.88205000000001 38.0 38.0 38.0 36.0 38.0 15-19 36.907500000000006 38.0 38.0 38.0 36.2 38.0 20-24 36.82075 38.0 38.0 38.0 36.0 38.0 25-29 36.947649999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.94015 38.0 38.0 38.0 36.0 38.0 35-39 36.6316 38.0 38.0 38.0 35.2 38.0 40-44 36.62935 38.0 38.0 38.0 35.0 38.0 45-49 36.881600000000006 38.0 38.0 38.0 35.8 38.0 50-54 36.93795 38.0 38.0 38.0 36.0 38.0 55-59 36.657349999999994 38.0 38.0 38.0 35.0 38.0 60-64 36.74505 38.0 38.0 38.0 35.6 38.0 65-69 36.6512 38.0 38.0 38.0 35.0 38.0 70-74 36.277049999999996 38.0 38.0 38.0 33.8 38.0 75-79 36.36465 38.0 38.0 38.0 34.0 38.0 80-84 36.402 38.0 38.0 38.0 34.0 38.0 85-89 36.03725000000001 38.0 37.8 38.0 32.8 38.0 90-94 36.09385 38.0 38.0 38.0 33.4 38.0 95-99 36.096000000000004 38.0 38.0 38.0 33.4 38.0 100-104 36.14685 38.0 38.0 38.0 33.4 38.0 105-109 35.7274 38.0 37.2 38.0 31.8 38.0 110-114 35.44945 38.0 37.0 38.0 29.4 38.0 115-119 35.109 38.0 36.2 38.0 27.6 38.0 120-124 35.34985 38.0 36.2 38.0 30.4 38.0 125-129 35.1824 38.0 36.0 38.0 29.0 38.0 130-134 34.49395 38.0 35.2 38.0 24.4 38.0 135-139 33.94135 38.0 34.8 38.0 22.2 38.0 140-144 34.06830000000001 38.0 35.0 38.0 22.6 38.0 145-149 33.7507 38.0 35.0 38.0 21.8 38.0 150-151 30.170125000000002 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 1.0 4 5.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 2.0 11 1.0 12 1.0 13 1.0 14 5.0 15 4.0 16 6.0 17 5.0 18 6.0 19 7.0 20 5.0 21 6.0 22 8.0 23 10.0 24 15.0 25 18.0 26 28.0 27 44.0 28 37.0 29 48.0 30 62.0 31 61.0 32 81.0 33 124.0 34 152.0 35 243.0 36 513.0 37 2489.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.88944723618091 23.115577889447238 13.442211055276381 25.552763819095475 2 27.55 25.85 29.5 17.1 3 20.9 28.275 31.0 19.825 4 22.95 35.15 23.65 18.25 5 24.375 35.925000000000004 21.725 17.974999999999998 6 21.224999999999998 38.224999999999994 22.75 17.8 7 20.225 23.025000000000002 37.325 19.425 8 20.225 25.124999999999996 27.55 27.1 9 21.55 24.55 30.075000000000003 23.825 10-14 22.948031811133898 29.510328615015258 26.654329015155305 20.887310558695543 15-19 22.934586917383477 27.875575115023004 27.89057811562313 21.299259851970394 20-24 22.894157663065226 27.721088435374146 28.146258503401363 21.238495398159262 25-29 22.997247935951965 28.381285964473356 27.47560670502877 21.14585939454591 30-34 22.76365819491695 27.6115669401641 28.23694216529918 21.38783269961977 35-39 22.77163305139883 27.70632100495471 27.68129723237075 21.84074871127571 40-44 22.621014166291236 28.492766681683936 27.77193772838765 21.11428142363718 45-49 23.258606885508406 27.602081665332268 28.02742193755004 21.111889511609288 50-54 23.359527503879075 27.35372140747785 27.85424695930727 21.432504129335804 55-59 23.248487273090966 27.734160124018604 27.909186377956697 21.10816622493374 60-64 23.01456237802132 27.813641595356053 27.833658609818347 21.338137416804283 65-69 23.038823293976385 27.326395837502503 28.036822093255953 21.59795877526516 70-74 22.898739243546128 27.746647988793278 27.816690014008405 21.537922753652193 75-79 22.889878420973634 27.943163055986393 28.298393956071443 20.86856456696853 80-84 23.289453926622954 27.578957905801094 28.024425646929274 21.10716252064668 85-89 22.99304756664833 28.33491722102736 27.80473165607963 20.867303556244686 90-94 23.743995196156924 27.962369895916733 27.667133706965576 20.626501200960767 95-99 23.61861861861862 28.24824824824825 27.217217217217215 20.915915915915917 100-104 23.46938775510204 28.106242496998803 27.531012404961984 20.893357342937176 105-109 24.032637533163136 27.45657506132052 27.86204134754968 20.64874605796666 110-114 23.71608769646611 28.125938532385625 27.62538792671939 20.532585844428873 115-119 23.79903923138511 27.306845476381103 27.712169735788635 21.181945556445157 120-124 23.45876701361089 27.311849479583667 28.157526020816654 21.07185748598879 125-129 23.4714300010007 27.7644351045732 28.074652256579608 20.689482637846492 130-134 23.851970554359255 27.33236516600731 27.898242275527068 20.917422004106363 135-139 23.71490064567796 27.038390309825317 28.439861854947697 20.80684718954903 140-144 23.66721729989488 28.117334935175453 27.09115482805226 21.12429293687741 145-149 24.07008760951189 27.764705882352942 27.219023779724655 20.946182728410513 150-151 24.054595542198847 27.28524918607563 27.62334084648134 21.036814425244177 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 0.0 21 1.0 22 2.0 23 2.0 24 1.0 25 0.0 26 2.0 27 3.0 28 2.0 29 5.0 30 10.5 31 12.5 32 19.0 33 29.5 34 40.0 35 50.0 36 67.5 37 101.0 38 137.0 39 163.5 40 205.0 41 248.5 42 266.5 43 281.5 44 307.5 45 296.0 46 265.0 47 252.0 48 237.0 49 211.5 50 180.5 51 145.5 52 117.0 53 93.0 54 63.5 55 49.5 56 38.5 57 29.5 58 19.5 59 12.5 60 10.0 61 6.5 62 3.0 63 1.5 64 1.0 65 1.0 66 2.5 67 2.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.034999999999999996 15-19 0.02 20-24 0.04 25-29 0.075 30-34 0.06 35-39 0.095 40-44 0.11499999999999999 45-49 0.08 50-54 0.105 55-59 0.015 60-64 0.08499999999999999 65-69 0.06 70-74 0.06 75-79 0.065 80-84 0.105 85-89 0.034999999999999996 90-94 0.08 95-99 0.1 100-104 0.04 105-109 0.11499999999999999 110-114 0.11 115-119 0.08 120-124 0.08 125-129 0.06999999999999999 130-134 0.155 135-139 0.105 140-144 0.11499999999999999 145-149 0.125 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67361285463218 99.25 2 0.2761737383881496 0.5499999999999999 3 0.0 0.0 4 0.05021340697966357 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.0875 0.0 0.0 0.0 0.0 116-117 0.125 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.2 0.0 0.0 0.0 0.0 122-123 0.2 0.0 0.0 0.0 0.0 124-125 0.23750000000000002 0.0 0.0 0.0 0.0 126-127 0.36250000000000004 0.0 0.0 0.0 0.0 128-129 0.4625 0.0 0.0 0.0 0.0 130-131 0.5 0.0 0.0 0.0 0.0 132-133 0.5625 0.0 0.0 0.0 0.0 134-135 0.575 0.0 0.0 0.0 0.0 136-137 0.675 0.0 0.0 0.0 0.0 138-139 0.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947836 spots for SRR7169108.sra Written 947836 spots for SRR7169108.sra Read 947853 spots for SRR7169108.sra Written 947853 spots for SRR7169108.sra SRR ids: ['SRR7169108.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t_8ektei SRR7169108.sra spots: 18956737 blocks: [[1, 947836], [947837, 1895672], [1895673, 2843508], [2843509, 3791344], [3791345, 4739180], [4739181, 5687016], [5687017, 6634852], [6634853, 7582688], [7582689, 8530524], [8530525, 9478360], [9478361, 10426196], [10426197, 11374032], [11374033, 12321868], [12321869, 13269704], [13269705, 14217540], [14217541, 15165376], [15165377, 16113212], [16113213, 17061048], [17061049, 18008884], [18008885, 18956737]] SRR7169108 file size 6402115 SRR7169108 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169108 SRR7169108_1.fastq SRR7169108_2.fastq Input file: SRR7169108_1.fastq Paired file: SRR7169108_2.fastq trimmed: SRR7169108-trimmed-pair1.fastq, SRR7169108-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:37:42 2025 >> started Mon Feb 10 21:38:18 2025 >> done (36.239s) 18956737 read pairs processed; of these: 19218 ( 0.10%) short read pairs filtered out after trimming by size control 16591 ( 0.09%) empty read pairs filtered out after trimming by size control 18920928 (99.81%) read pairs available; of these: 9184455 (48.54%) trimmed read pairs available after processing 9736473 (51.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 4 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 2 0.00% 25 5 0.00% 26 6 0.00% 27 5 0.00% 28 6 0.00% 29 8 0.00% 30 14 0.00% 31 11 0.00% 32 10 0.00% 33 8 0.00% 34 5 0.00% 35 4 0.00% 36 10 0.00% 37 11 0.00% 38 12 0.00% 39 14 0.00% 40 10 0.00% 41 10 0.00% 42 14 0.00% 43 22 0.00% 44 29 0.00% 45 24 0.00% 46 19 0.00% 47 39 0.00% 48 33 0.00% 49 23 0.00% 50 26 0.00% 51 34 0.00% 52 36 0.00% 53 48 0.00% 54 35 0.00% 55 42 0.00% 56 49 0.00% 57 63 0.00% 58 88 0.00% 59 83 0.00% 60 73 0.00% 61 83 0.00% 62 97 0.00% 63 150 0.00% 64 167 0.00% 65 163 0.00% 66 249 0.00% 67 168 0.00% 68 160 0.00% 69 215 0.00% 70 227 0.00% 71 257 0.00% 72 293 0.00% 73 312 0.00% 74 327 0.00% 75 323 0.00% 76 368 0.00% 77 463 0.00% 78 435 0.00% 79 577 0.00% 80 627 0.00% 81 763 0.00% 82 758 0.00% 83 1037 0.01% 84 1957 0.01% 85 2385 0.01% 86 2492 0.01% 87 2504 0.01% 88 2552 0.01% 89 2565 0.01% 90 2754 0.01% 91 2856 0.02% 92 2952 0.02% 93 3093 0.02% 94 3284 0.02% 95 3440 0.02% 96 3718 0.02% 97 3972 0.02% 98 4290 0.02% 99 4552 0.02% 100 4687 0.02% 101 4955 0.03% 102 5509 0.03% 103 5842 0.03% 104 6124 0.03% 105 6612 0.03% 106 7132 0.04% 107 7699 0.04% 108 8022 0.04% 109 8537 0.05% 110 9080 0.05% 111 10051 0.05% 112 10600 0.06% 113 11249 0.06% 114 11924 0.06% 115 12744 0.07% 116 13519 0.07% 117 14623 0.08% 118 15418 0.08% 119 16072 0.08% 120 17237 0.09% 121 18403 0.10% 122 19514 0.10% 123 21240 0.11% 124 22626 0.12% 125 24374 0.13% 126 26242 0.14% 127 28530 0.15% 128 30469 0.16% 129 32994 0.17% 130 35854 0.19% 131 38762 0.20% 132 41818 0.22% 133 46131 0.24% 134 49877 0.26% 135 54885 0.29% 136 60866 0.32% 137 67476 0.36% 138 75007 0.40% 139 84126 0.44% 140 94607 0.50% 141 108656 0.57% 142 127985 0.68% 143 145782 0.77% 144 177147 0.94% 145 222037 1.17% 146 288340 1.52% 147 397139 2.10% 148 609860 3.22% 149 1195803 6.32% 150 4771730 25.22% 151 9736473 51.46% 18920928 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=43 prefix-density=0.15 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=266.88 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=29.1 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=36 prefix-density=0.32 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=20 fanout-score=252.30 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=30.0 sequence=AAGAAGAAGAAA SRR7169108 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:39:20 Started mapping on | Feb 10 21:39:20 Finished on | Feb 10 21:42:01 Mapping speed, Million of reads per hour | 423.08 Number of input reads | 18920928 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18010537 Uniquely mapped reads % | 95.19% Average mapped length | 296.79 Number of splices: Total | 17630723 Number of splices: Annotated (sjdb) | 17355212 Number of splices: GT/AG | 17380339 Number of splices: GC/AG | 205352 Number of splices: AT/AC | 13984 Number of splices: Non-canonical | 31048 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324606 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 18889 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.96% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 605646 605646 605646 N_multimapping 324606 324606 324606 N_noFeature 391032 17831614 473394 N_ambiguous 166672 1027 69373 UnstrandedReadsAssigned:17452833 PositiveStrandReadsAssigned:177896 NegativeStrandReadsAssigned:17467770 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169108 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169108-trimmed-pair1.fastq SRR7169108-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,920,928 reads, 17,329,436 reads pseudoaligned [quant] estimated average fragment length: 278.468 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR7169108.ke.tsv 34699 SRR7169108.se.tsv 87100 total ==> SRR7169108.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.53 400 12.8797 Potri.005G024800.1.v4.1 1035 757.532 33 2.44141 Potri.004G059700.1.v4.1 961 683.578 3 0.245958 Potri.007G009000.2.v4.1 1416 1138.53 0 0 Potri.003G141000.2.v4.1 2943 2665.53 384.18 8.07752 Potri.016G087400.1.v4.1 270 58.4077 1473 1413.38 Potri.015G069301.1.v4.1 564 292.976 0 0 Potri.010G195200.1.v4.1 1773 1495.53 47 1.76129 Potri.012G127500.1.v4.1 977 699.552 4528 362.756 ==> SRR7169108.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1809 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 245 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169108 completed mapping pipeline successfully