Starting /dee2/code/volunteer_pipeline.sh SRR7169109 current disk space = 3057343221760 free memory = 1513487524 SRR7169109 SRAfilesize 1e1863d4f4a57a45166f110592bb2530 SRR7169109.sra SRR7169109.sra file validated SRR7169109 is paired end SRR7169109 is conventional basespace SRR7169109 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169109_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.14 34.0 33.0 34.0 33.0 34.0 2 33.472 34.0 34.0 34.0 33.0 34.0 3 33.5165 34.0 34.0 34.0 33.0 34.0 4 33.47875 34.0 34.0 34.0 33.0 34.0 5 33.51475 34.0 34.0 34.0 33.0 34.0 6 37.19925 38.0 38.0 38.0 36.0 38.0 7 37.40325 38.0 38.0 38.0 37.0 38.0 8 37.5105 38.0 38.0 38.0 37.0 38.0 9 37.603 38.0 38.0 38.0 38.0 38.0 10-14 37.50505 38.0 38.0 38.0 37.4 38.0 15-19 37.459250000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.4314 38.0 38.0 38.0 37.0 38.0 25-29 37.382099999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.234300000000005 38.0 38.0 38.0 36.8 38.0 35-39 37.144149999999996 38.0 38.0 38.0 36.6 38.0 40-44 36.754149999999996 38.0 38.0 38.0 34.6 38.0 45-49 36.54225 38.0 38.0 38.0 34.0 38.0 50-54 36.44355 38.0 37.8 38.0 34.0 38.0 55-59 36.3041 38.0 37.0 38.0 33.4 38.0 60-64 36.24735 38.0 37.0 38.0 33.0 38.0 65-69 36.084500000000006 38.0 37.0 38.0 33.0 38.0 70-74 36.022200000000005 38.0 37.0 38.0 32.8 38.0 75-79 35.7237 38.0 37.0 38.0 30.6 38.0 80-84 35.7297 38.0 36.8 38.0 31.0 38.0 85-89 35.4935 38.0 36.2 38.0 29.0 38.0 90-94 35.076800000000006 38.0 36.0 38.0 28.4 38.0 95-99 35.145599999999995 38.0 36.0 38.0 29.0 38.0 100-104 34.75335 38.0 35.4 38.0 27.2 38.0 105-109 34.6 38.0 35.0 38.0 26.6 38.0 110-114 34.060199999999995 38.0 34.2 38.0 23.4 38.0 115-119 33.9625 38.0 34.0 38.0 23.0 38.0 120-124 33.547700000000006 38.0 34.0 38.0 18.2 38.0 125-129 33.06765 37.8 33.4 38.0 16.2 38.0 130-134 32.60125 37.4 33.0 38.0 15.0 38.0 135-139 32.210950000000004 37.0 32.2 38.0 14.6 38.0 140-144 31.4706 36.0 31.0 38.0 13.8 38.0 145-149 30.40515 36.0 29.0 38.0 6.4 38.0 150-151 26.399875 34.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 4.0 14 8.0 15 8.0 16 4.0 17 10.0 18 12.0 19 14.0 20 8.0 21 8.0 22 11.0 23 21.0 24 24.0 25 22.0 26 35.0 27 39.0 28 44.0 29 50.0 30 62.0 31 81.0 32 116.0 33 192.0 34 281.0 35 518.0 36 1137.0 37 1286.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.21862348178138 14.827935222672064 9.7165991902834 32.23684210526316 2 26.700000000000003 13.175 29.825000000000003 30.3 3 20.075000000000003 18.2 27.275 34.449999999999996 4 23.549999999999997 24.25 24.15 28.050000000000004 5 22.85 29.825000000000003 23.474999999999998 23.849999999999998 6 21.425 33.900000000000006 24.125 20.549999999999997 7 15.775 30.025000000000002 37.55 16.650000000000002 8 17.724999999999998 30.049999999999997 29.775000000000002 22.45 9 16.975 27.35 31.35 24.325 10-14 19.255 32.14 26.69 21.915000000000003 15-19 19.18 30.145 27.189999999999998 23.485 20-24 19.040000000000003 29.82 27.694999999999997 23.445 25-29 19.115 30.03 27.189999999999998 23.665 30-34 19.535 30.080000000000002 27.295 23.09 35-39 19.509999999999998 29.549999999999997 27.63 23.31 40-44 19.89 29.625 27.155 23.330000000000002 45-49 20.330000000000002 29.220000000000002 26.495 23.955000000000002 50-54 19.535 30.04 27.045 23.380000000000003 55-59 19.775000000000002 29.470000000000002 26.775 23.98 60-64 19.744999999999997 29.470000000000002 27.134999999999998 23.65 65-69 19.580000000000002 29.354999999999997 27.439999999999998 23.625 70-74 19.775000000000002 29.865000000000002 26.795 23.565 75-79 20.65 29.4 26.150000000000002 23.799999999999997 80-84 19.96 28.96 27.55 23.53 85-89 20.405 29.330000000000002 27.095000000000002 23.169999999999998 90-94 20.31 28.98 26.974999999999998 23.735 95-99 20.419999999999998 28.54 27.339999999999996 23.7 100-104 20.088057237204183 29.594236253564816 26.77240206133987 23.54530444789113 105-109 20.7 28.470000000000002 27.025 23.805 110-114 20.583671221905192 28.55784151774541 27.346448415678033 23.51203884467137 115-119 20.655 28.060000000000002 27.665 23.62 120-124 20.22213327996798 28.056834100460275 27.606563938363017 24.114468681208727 125-129 20.606030301515077 28.491424571228563 27.026351317565876 23.876193809690484 130-134 20.68 28.67 26.5 24.15 135-139 20.605 28.970000000000002 26.705000000000002 23.72 140-144 21.205 28.499999999999996 26.83 23.465 145-149 21.07 29.01 26.790000000000003 23.13 150-151 21.0375 28.1 27.8875 22.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.5 21 2.0 22 1.0 23 2.5 24 4.0 25 5.0 26 7.0 27 12.0 28 16.5 29 25.5 30 33.0 31 39.0 32 52.0 33 61.0 34 67.0 35 87.0 36 98.5 37 105.5 38 134.5 39 166.5 40 190.5 41 201.5 42 219.0 43 236.0 44 236.0 45 241.0 46 239.0 47 220.5 48 222.0 49 213.5 50 179.0 51 140.5 52 114.5 53 105.5 54 81.0 55 55.5 56 43.0 57 32.5 58 26.5 59 21.5 60 11.5 61 8.0 62 11.0 63 8.5 64 3.0 65 1.5 66 3.5 67 3.5 68 2.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.065 105-109 0.0 110-114 0.11499999999999999 115-119 0.0 120-124 0.06 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.42500000000000004 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.85 0.0 0.0 0.0 0.0 130-131 0.9125000000000001 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.0875 0.0 0.0 0.0 0.0 136-137 1.2374999999999998 0.0 0.0 0.0 0.0 138-139 1.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169109 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169109_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91275 33.0 33.0 34.0 32.0 34.0 2 33.08775 34.0 33.0 34.0 32.0 34.0 3 33.0985 34.0 33.0 34.0 33.0 34.0 4 33.05225 34.0 33.0 34.0 33.0 34.0 5 33.07175 34.0 33.0 34.0 33.0 34.0 6 37.219 38.0 38.0 38.0 37.0 38.0 7 37.188 38.0 38.0 38.0 37.0 38.0 8 37.18525 38.0 38.0 38.0 37.0 38.0 9 37.16275 38.0 38.0 38.0 37.0 38.0 10-14 37.14895 38.0 38.0 38.0 37.0 38.0 15-19 37.158699999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.14 38.0 38.0 38.0 37.2 38.0 25-29 37.12885 38.0 38.0 38.0 37.0 38.0 30-34 37.09505 38.0 38.0 38.0 37.0 38.0 35-39 37.03735 38.0 38.0 38.0 37.0 38.0 40-44 37.001999999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.00755 38.0 38.0 38.0 37.0 38.0 50-54 36.860949999999995 38.0 38.0 38.0 36.6 38.0 55-59 36.751200000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.728300000000004 38.0 38.0 38.0 36.4 38.0 65-69 36.619299999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.50885000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.44155 38.0 38.0 38.0 35.6 38.0 80-84 36.51365 38.0 38.0 38.0 35.6 38.0 85-89 36.534000000000006 38.0 38.0 38.0 35.8 38.0 90-94 36.3868 38.0 38.0 38.0 35.2 38.0 95-99 36.274649999999994 38.0 38.0 38.0 34.6 38.0 100-104 36.093599999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.015 38.0 38.0 38.0 34.0 38.0 110-114 35.83655 38.0 38.0 38.0 33.6 38.0 115-119 35.70605 38.0 38.0 38.0 33.0 38.0 120-124 35.587450000000004 38.0 38.0 38.0 32.6 38.0 125-129 35.36905 38.0 37.2 38.0 31.0 38.0 130-134 35.11845 38.0 36.8 38.0 31.0 38.0 135-139 34.745050000000006 38.0 36.0 38.0 28.6 38.0 140-144 34.27335 38.0 35.8 38.0 24.2 38.0 145-149 33.789249999999996 38.0 35.4 38.0 19.0 38.0 150-151 30.561374999999998 36.5 30.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 2.0 4 4.0 5 2.0 6 1.0 7 2.0 8 5.0 9 2.0 10 5.0 11 3.0 12 6.0 13 11.0 14 5.0 15 4.0 16 1.0 17 7.0 18 9.0 19 5.0 20 6.0 21 6.0 22 8.0 23 10.0 24 12.0 25 12.0 26 12.0 27 24.0 28 25.0 29 42.0 30 45.0 31 35.0 32 57.0 33 74.0 34 98.0 35 160.0 36 400.0 37 2888.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.96990972918756 23.395185556670008 14.042126379137413 22.592778335005015 2 28.507126781695426 27.45686421605401 27.00675168792198 17.029257314328582 3 21.180295073768445 28.382095523880967 30.23255813953488 20.205051262815704 4 23.849999999999998 32.85 24.175 19.125 5 24.375 35.05 22.3 18.275 6 22.375 35.375 23.45 18.8 7 21.775 24.05 35.125 19.05 8 22.875 25.900000000000002 26.75 24.474999999999998 9 21.925 25.8 29.45 22.825 10-14 24.32 28.42 26.125 21.135 15-19 23.905 27.485 27.084999999999997 21.525 20-24 24.145 27.915 27.045 20.895 25-29 24.215 28.42 26.174999999999997 21.19 30-34 23.955000000000002 27.625 27.295 21.125 35-39 23.56 27.6 27.35 21.490000000000002 40-44 23.685000000000002 27.634999999999998 27.465 21.215 45-49 23.94 27.450000000000003 27.405 21.205 50-54 23.7465564738292 27.683446030553473 27.488104182319056 21.081893313298274 55-59 23.851554663991976 27.51755265797392 27.798395185556668 20.832497492477433 60-64 24.041549578482538 27.43376154154958 26.98213568847852 21.54255319148936 65-69 24.57729468599034 27.244363929146537 27.324879227053138 20.853462157809986 70-74 24.422176343219697 27.685180522684927 27.16652399415882 20.726119139936554 75-79 24.555661849856502 26.89189869593676 27.54141281909269 21.011026635114042 80-84 23.759345677153895 27.206583370966932 27.43238496663154 21.601685985247627 85-89 23.80785237928095 27.729027729027727 27.50338464624179 20.959735245449533 90-94 24.26780341023069 26.54964894684052 28.114343029087262 21.068204613841523 95-99 24.41825476429288 27.367101303911735 27.39719157472417 20.817452357071215 100-104 24.383149448345034 27.427281845536612 27.557673019057173 20.63189568706118 105-109 24.472192969259314 27.636527756882806 27.761897597913848 20.129381675944035 110-114 24.36308926780341 26.900702106318956 27.853560682046137 20.882647943831493 115-119 24.027081243731192 27.99899699097292 27.447342026078235 20.526579739217652 120-124 24.017051153460383 27.35707121364092 27.99899699097292 20.626880641925776 125-129 23.545636910732195 27.75827482447342 28.109327983951854 20.58676028084253 130-134 23.716148445336007 28.029087261785357 27.61283851554664 20.641925777331995 135-139 23.63270440251572 27.652830188679246 28.0251572327044 20.689308176100628 140-144 24.542936288088644 27.25761772853186 27.887182070007555 20.312263913371947 145-149 24.12470991827263 27.383715064070223 28.09000100897992 20.40157400867723 150-151 24.203741152679477 27.464610717896864 27.603640040444894 20.72800808897877 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 1.0 20 1.5 21 2.0 22 2.5 23 2.0 24 1.5 25 1.0 26 1.5 27 3.0 28 3.0 29 6.5 30 10.0 31 11.5 32 16.0 33 22.5 34 26.5 35 34.5 36 51.5 37 70.0 38 103.5 39 133.5 40 155.5 41 206.5 42 247.0 43 275.0 44 298.5 45 299.0 46 292.5 47 286.5 48 265.0 49 234.0 50 202.5 51 155.0 52 120.0 53 107.0 54 89.5 55 72.0 56 51.5 57 30.5 58 27.5 59 24.0 60 16.5 61 11.0 62 8.0 63 5.0 64 2.0 65 0.5 66 0.5 67 0.5 68 0.5 69 2.5 70 2.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.025 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.17500000000000002 55-59 0.3 60-64 0.36 65-69 0.64 70-74 0.705 75-79 0.695 80-84 0.35500000000000004 85-89 0.28500000000000003 90-94 0.3 95-99 0.3 100-104 0.3 105-109 0.295 110-114 0.3 115-119 0.3 120-124 0.3 125-129 0.3 130-134 0.3 135-139 0.625 140-144 0.7250000000000001 145-149 0.89 150-151 1.0999999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37106918238993 98.75 2 0.628930817610063 1.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.85 0.0 0.0 0.0 0.0 130-131 0.925 0.0 0.0 0.0 0.0 132-133 1.0 0.0 0.0 0.0 0.0 134-135 1.1124999999999998 0.0 0.0 0.0 0.0 136-137 1.2625000000000002 0.0 0.0 0.0 0.0 138-139 1.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra Read 658247 spots for SRR7169109.sra Written 658247 spots for SRR7169109.sra SRR ids: ['SRR7169109.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rr957q0a SRR7169109.sra spots: 13164940 blocks: [[1, 658247], [658248, 1316494], [1316495, 1974741], [1974742, 2632988], [2632989, 3291235], [3291236, 3949482], [3949483, 4607729], [4607730, 5265976], [5265977, 5924223], [5924224, 6582470], [6582471, 7240717], [7240718, 7898964], [7898965, 8557211], [8557212, 9215458], [9215459, 9873705], [9873706, 10531952], [10531953, 11190199], [11190200, 11848446], [11848447, 12506693], [12506694, 13164940]] SRR7169109 file size 4439465 SRR7169109 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169109 SRR7169109_1.fastq SRR7169109_2.fastq Input file: SRR7169109_1.fastq Paired file: SRR7169109_2.fastq trimmed: SRR7169109-trimmed-pair1.fastq, SRR7169109-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:21:27 2025 >> started Mon Feb 10 22:21:41 2025 >> done (13.586s) 13164940 read pairs processed; of these: 24848 ( 0.19%) short read pairs filtered out after trimming by size control 15374 ( 0.12%) empty read pairs filtered out after trimming by size control 13124718 (99.69%) read pairs available; of these: 6969479 (53.10%) trimmed read pairs available after processing 6155239 (46.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 8 0.00% 20 5 0.00% 21 6 0.00% 22 7 0.00% 23 11 0.00% 24 11 0.00% 25 7 0.00% 26 10 0.00% 27 20 0.00% 28 16 0.00% 29 4 0.00% 30 16 0.00% 31 14 0.00% 32 15 0.00% 33 19 0.00% 34 15 0.00% 35 22 0.00% 36 16 0.00% 37 22 0.00% 38 19 0.00% 39 20 0.00% 40 26 0.00% 41 31 0.00% 42 20 0.00% 43 40 0.00% 44 39 0.00% 45 38 0.00% 46 52 0.00% 47 57 0.00% 48 44 0.00% 49 60 0.00% 50 53 0.00% 51 58 0.00% 52 66 0.00% 53 57 0.00% 54 69 0.00% 55 75 0.00% 56 86 0.00% 57 94 0.00% 58 105 0.00% 59 104 0.00% 60 130 0.00% 61 137 0.00% 62 169 0.00% 63 134 0.00% 64 180 0.00% 65 202 0.00% 66 218 0.00% 67 229 0.00% 68 263 0.00% 69 280 0.00% 70 350 0.00% 71 404 0.00% 72 422 0.00% 73 456 0.00% 74 553 0.00% 75 680 0.01% 76 656 0.00% 77 499 0.00% 78 629 0.00% 79 1058 0.01% 80 1421 0.01% 81 844 0.01% 82 917 0.01% 83 1196 0.01% 84 2126 0.02% 85 2898 0.02% 86 3142 0.02% 87 3156 0.02% 88 2934 0.02% 89 3103 0.02% 90 3187 0.02% 91 3270 0.02% 92 3442 0.03% 93 3676 0.03% 94 3991 0.03% 95 4280 0.03% 96 4559 0.03% 97 5080 0.04% 98 6110 0.05% 99 7735 0.06% 100 8429 0.06% 101 6062 0.05% 102 5882 0.04% 103 6254 0.05% 104 6760 0.05% 105 7322 0.06% 106 7757 0.06% 107 7991 0.06% 108 8605 0.07% 109 8999 0.07% 110 9444 0.07% 111 10039 0.08% 112 10665 0.08% 113 11392 0.09% 114 11922 0.09% 115 12493 0.10% 116 13239 0.10% 117 13982 0.11% 118 14786 0.11% 119 15573 0.12% 120 16354 0.12% 121 17200 0.13% 122 18077 0.14% 123 19615 0.15% 124 21107 0.16% 125 22081 0.17% 126 23676 0.18% 127 25377 0.19% 128 26799 0.20% 129 29089 0.22% 130 30971 0.24% 131 33271 0.25% 132 35534 0.27% 133 39102 0.30% 134 41424 0.32% 135 45737 0.35% 136 49814 0.38% 137 55092 0.42% 138 61346 0.47% 139 69529 0.53% 140 76801 0.59% 141 87043 0.66% 142 100634 0.77% 143 117225 0.89% 144 143567 1.09% 145 180847 1.38% 146 231058 1.76% 147 320734 2.44% 148 499613 3.81% 149 924168 7.04% 150 3332816 25.39% 151 6155239 46.90% 13124718 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=40 prefix-density=0.22 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=260.73 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=18.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=39 prefix-density=0.22 prefix-fanout=2.3 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.13 sequence-density-rank=10 fanout-score=37.41 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=10.5 sequence=TCAAGGAAGCTTTCAG SRR7169109 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:22:23 Started mapping on | Feb 10 22:22:23 Finished on | Feb 10 22:24:01 Mapping speed, Million of reads per hour | 482.13 Number of input reads | 13124718 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12174623 Uniquely mapped reads % | 92.76% Average mapped length | 295.34 Number of splices: Total | 10713331 Number of splices: Annotated (sjdb) | 10534514 Number of splices: GT/AG | 10555042 Number of splices: GC/AG | 123298 Number of splices: AT/AC | 9503 Number of splices: Non-canonical | 25488 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 226068 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 24311 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.28% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 747251 747251 747251 N_multimapping 226068 226068 226068 N_noFeature 206203 12020033 265726 N_ambiguous 149426 718 54060 UnstrandedReadsAssigned:11818994 PositiveStrandReadsAssigned:153872 NegativeStrandReadsAssigned:11854837 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169109 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169109-trimmed-pair1.fastq SRR7169109-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,124,718 reads, 11,775,907 reads pseudoaligned [quant] estimated average fragment length: 263.599 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52401 SRR7169109.ke.tsv 34699 SRR7169109.se.tsv 87100 total ==> SRR7169109.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.4 166 6.21208 Potri.005G024800.1.v4.1 1035 772.401 33 2.80657 Potri.004G059700.1.v4.1 961 698.422 8 0.75245 Potri.007G009000.2.v4.1 1416 1153.4 0 0 Potri.003G141000.2.v4.1 2943 2680.4 238 5.83287 Potri.016G087400.1.v4.1 270 61.421 1321.41 1413.27 Potri.015G069301.1.v4.1 564 305.013 0 0 Potri.010G195200.1.v4.1 1773 1510.4 18 0.782863 Potri.012G127500.1.v4.1 977 714.401 5965 548.497 ==> SRR7169109.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 946 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 305 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169109 completed mapping pipeline successfully