Starting /dee2/code/volunteer_pipeline.sh SRR7169110 current disk space = 3057138343936 free memory = 1232568180 SRR7169110 SRAfilesize 1ff4d1f0f1de343608f3363ac366c3e1 SRR7169110.sra SRR7169110.sra file validated SRR7169110 is paired end SRR7169110 is conventional basespace SRR7169110 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169110_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.10475 34.0 33.0 34.0 33.0 34.0 2 33.50575 34.0 34.0 34.0 33.0 34.0 3 33.49825 34.0 34.0 34.0 33.0 34.0 4 33.53175 34.0 34.0 34.0 33.0 34.0 5 33.52225 34.0 34.0 34.0 33.0 34.0 6 37.24825 38.0 38.0 38.0 36.0 38.0 7 37.386 38.0 38.0 38.0 37.0 38.0 8 37.46025 38.0 38.0 38.0 37.0 38.0 9 37.497 38.0 38.0 38.0 38.0 38.0 10-14 37.529399999999995 38.0 38.0 38.0 37.8 38.0 15-19 37.47500000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.43735 38.0 38.0 38.0 37.0 38.0 25-29 37.40435000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.37335 38.0 38.0 38.0 37.0 38.0 35-39 37.28365 38.0 38.0 38.0 36.6 38.0 40-44 36.9148 38.0 38.0 38.0 35.2 38.0 45-49 36.79965 38.0 38.0 38.0 34.8 38.0 50-54 36.667449999999995 38.0 38.0 38.0 34.4 38.0 55-59 36.5142 38.0 38.0 38.0 34.0 38.0 60-64 36.533049999999996 38.0 37.8 38.0 34.0 38.0 65-69 36.44625 38.0 37.4 38.0 34.0 38.0 70-74 36.3558 38.0 37.2 38.0 33.8 38.0 75-79 36.18845 38.0 37.0 38.0 33.0 38.0 80-84 36.07045 38.0 37.0 38.0 33.0 38.0 85-89 35.92585 38.0 36.8 38.0 32.0 38.0 90-94 35.73010000000001 38.0 36.2 38.0 30.6 38.0 95-99 35.544399999999996 38.0 36.0 38.0 30.4 38.0 100-104 35.254650000000005 38.0 36.0 38.0 29.4 38.0 105-109 35.054500000000004 38.0 35.8 38.0 28.2 38.0 110-114 34.8676 38.0 35.2 38.0 27.2 38.0 115-119 34.60805 38.0 35.0 38.0 26.2 38.0 120-124 34.2333 38.0 34.6 38.0 23.0 38.0 125-129 34.02145 38.0 34.0 38.0 23.0 38.0 130-134 33.5535 38.0 34.0 38.0 19.8 38.0 135-139 33.02975 37.6 33.2 38.0 15.0 38.0 140-144 32.251850000000005 36.6 32.4 38.0 14.4 38.0 145-149 31.328999999999997 36.0 31.0 38.0 11.2 38.0 150-151 27.338875 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 4.0 14 3.0 15 5.0 16 0.0 17 5.0 18 6.0 19 5.0 20 7.0 21 8.0 22 13.0 23 14.0 24 11.0 25 24.0 26 26.0 27 35.0 28 42.0 29 66.0 30 44.0 31 90.0 32 95.0 33 163.0 34 253.0 35 399.0 36 1070.0 37 1610.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.46924829157175 12.984054669703873 9.06099721589471 31.485699822829666 2 26.075 11.799999999999999 30.975 31.15 3 19.375 17.925 27.450000000000003 35.25 4 22.0 24.224999999999998 25.6 28.175 5 23.400000000000002 27.825 25.575 23.200000000000003 6 21.85 31.724999999999998 24.075 22.35 7 16.825000000000003 28.775000000000002 38.15 16.25 8 17.0 29.15 29.725 24.125 9 17.224999999999998 27.800000000000004 31.525 23.45 10-14 19.785 30.564999999999998 27.41 22.24 15-19 19.355 29.86 27.384999999999998 23.400000000000002 20-24 19.794999999999998 29.935000000000002 26.924999999999997 23.345 25-29 19.814999999999998 28.735 27.435 24.015 30-34 19.689999999999998 29.665000000000003 27.22 23.425 35-39 19.845 29.525000000000002 27.284999999999997 23.345 40-44 20.315 29.125 27.075 23.485 45-49 19.650000000000002 29.665000000000003 27.015 23.669999999999998 50-54 20.225 29.235 27.189999999999998 23.35 55-59 19.7 29.065 26.889999999999997 24.345 60-64 20.21 28.585 27.27 23.935000000000002 65-69 19.835 29.330000000000002 26.87 23.965 70-74 20.445 28.985 27.01 23.56 75-79 20.87 28.26 26.985 23.885 80-84 20.19 27.944999999999997 27.235 24.63 85-89 20.27 28.63 27.384999999999998 23.715 90-94 20.669999999999998 28.58 26.905 23.845 95-99 20.215 28.499999999999996 27.275 24.01 100-104 20.68 28.89 27.145000000000003 23.285 105-109 20.655 28.675 26.619999999999997 24.05 110-114 20.665 28.09 27.505000000000003 23.74 115-119 20.9 28.035 26.919999999999998 24.145 120-124 20.69 28.144999999999996 27.46 23.705000000000002 125-129 20.630000000000003 27.63 27.810000000000002 23.93 130-134 20.875 27.825 28.044999999999998 23.255 135-139 21.11 28.32 26.705000000000002 23.865 140-144 20.9 27.725 27.38 23.995 145-149 20.79 27.665 27.12 24.425 150-151 20.775 27.237499999999997 27.55 24.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 2.0 21 2.0 22 2.0 23 3.0 24 3.5 25 5.0 26 6.5 27 10.0 28 17.0 29 17.5 30 19.0 31 30.0 32 43.0 33 52.0 34 59.0 35 73.5 36 87.5 37 97.5 38 114.5 39 146.5 40 156.5 41 189.0 42 231.0 43 254.5 44 273.5 45 265.5 46 262.5 47 242.5 48 221.0 49 206.5 50 175.5 51 147.0 52 126.5 53 105.5 54 82.5 55 70.0 56 59.0 57 35.5 58 24.0 59 18.0 60 9.5 61 7.5 62 7.5 63 8.0 64 6.5 65 5.5 66 4.0 67 1.5 68 3.0 69 3.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.6000000000000001 0.0 0.0 0.0 0.0 126-127 0.7625 0.0 0.0 0.0 0.0 128-129 0.9125000000000001 0.0 0.0 0.0 0.0 130-131 1.0 0.0 0.0 0.0 0.0 132-133 1.2125 0.0 0.0 0.0 0.0 134-135 1.3250000000000002 0.0 0.0 0.0 0.0 136-137 1.4874999999999998 0.0 0.0 0.0 0.0 138-139 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCTAAT 10 0.006830828 145.0 1 >>END_MODULE SRR7169110 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169110_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92875 33.0 33.0 34.0 32.0 34.0 2 33.033 34.0 33.0 34.0 32.0 34.0 3 32.96825 34.0 33.0 34.0 32.0 34.0 4 32.94975 34.0 33.0 34.0 32.0 34.0 5 32.94275 34.0 33.0 34.0 33.0 34.0 6 37.12075 38.0 38.0 38.0 37.0 38.0 7 37.0435 38.0 38.0 38.0 37.0 38.0 8 37.06775 38.0 38.0 38.0 37.0 38.0 9 37.04375 38.0 38.0 38.0 37.0 38.0 10-14 37.018550000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.024649999999994 38.0 38.0 38.0 37.0 38.0 20-24 36.997049999999994 38.0 38.0 38.0 37.0 38.0 25-29 36.9543 38.0 38.0 38.0 37.0 38.0 30-34 36.939 38.0 38.0 38.0 37.0 38.0 35-39 36.89999999999999 38.0 38.0 38.0 37.0 38.0 40-44 36.862 38.0 38.0 38.0 36.8 38.0 45-49 36.83299999999999 38.0 38.0 38.0 36.8 38.0 50-54 36.8069 38.0 38.0 38.0 36.2 38.0 55-59 36.76125 38.0 38.0 38.0 36.0 38.0 60-64 36.7822 38.0 38.0 38.0 36.0 38.0 65-69 36.665800000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.55655 38.0 38.0 38.0 36.0 38.0 75-79 36.486 38.0 38.0 38.0 35.4 38.0 80-84 36.497249999999994 38.0 38.0 38.0 35.2 38.0 85-89 36.448750000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.371249999999996 38.0 38.0 38.0 34.8 38.0 95-99 36.3136 38.0 38.0 38.0 34.4 38.0 100-104 36.0777 38.0 38.0 38.0 34.0 38.0 105-109 35.96865000000001 38.0 38.0 38.0 34.0 38.0 110-114 35.78905 38.0 38.0 38.0 33.0 38.0 115-119 35.681650000000005 38.0 38.0 38.0 32.2 38.0 120-124 35.536950000000004 38.0 37.6 38.0 31.0 38.0 125-129 35.4473 38.0 37.0 38.0 31.4 38.0 130-134 35.1762 38.0 36.8 38.0 30.2 38.0 135-139 34.7143 38.0 36.0 38.0 27.2 38.0 140-144 34.12925 38.0 35.4 38.0 23.4 38.0 145-149 33.53055 38.0 35.0 38.0 17.4 38.0 150-151 30.23975 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 9.0 4 6.0 5 3.0 6 4.0 7 2.0 8 3.0 9 4.0 10 0.0 11 2.0 12 0.0 13 3.0 14 6.0 15 4.0 16 2.0 17 5.0 18 7.0 19 7.0 20 1.0 21 6.0 22 9.0 23 10.0 24 16.0 25 14.0 26 21.0 27 17.0 28 32.0 29 29.0 30 49.0 31 48.0 32 71.0 33 91.0 34 103.0 35 181.0 36 395.0 37 2827.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.425 23.075000000000003 12.275 23.225 2 28.499999999999996 27.900000000000002 25.85 17.75 3 20.575 28.675 30.025000000000002 20.724999999999998 4 23.200000000000003 34.375 23.525 18.9 5 25.6 34.65 21.9 17.849999999999998 6 21.725 36.575 23.25 18.45 7 21.475 21.125 37.9 19.5 8 22.85 25.3 27.05 24.8 9 21.675 24.425 29.275000000000002 24.625 10-14 23.294999999999998 29.535 26.119999999999997 21.05 15-19 23.815 27.839999999999996 26.605 21.740000000000002 20-24 23.544999999999998 27.884999999999998 27.47 21.099999999999998 25-29 23.494999999999997 27.98 27.200000000000003 21.325 30-34 23.47 28.18 27.27 21.08 35-39 23.66 28.384999999999998 26.545 21.41 40-44 24.075 28.225 26.740000000000002 20.96 45-49 24.195 27.97 27.015 20.82 50-54 23.825 28.215 27.045 20.915 55-59 23.775 27.845 27.575 20.805 60-64 23.580000000000002 28.04 27.084999999999997 21.295 65-69 23.901608135864937 27.548720004007816 27.44852462301488 21.101147237112368 70-74 23.930166056288567 27.171022926804795 27.682737169517885 21.216073847388753 75-79 23.697655780404727 26.948507313163695 27.704868763774794 21.648968142656784 80-84 23.54 27.765 27.255000000000003 21.44 85-89 23.630000000000003 27.884999999999998 27.74 20.745 90-94 24.07 27.389999999999997 26.889999999999997 21.65 95-99 24.125 27.425 27.73 20.72 100-104 24.025 27.529999999999998 28.035 20.41 105-109 24.46 26.915 27.405 21.22 110-114 24.610000000000003 27.505000000000003 27.245 20.64 115-119 24.15 27.615000000000002 27.615000000000002 20.62 120-124 23.635 27.765 27.935 20.665 125-129 24.310000000000002 27.595 27.52 20.575 130-134 23.895 28.065 27.145000000000003 20.895 135-139 24.60945323452834 28.144402163028236 27.052874023633088 20.193270578810335 140-144 24.422574814219722 27.69632456316529 27.56075517172123 20.320345450893754 145-149 24.574221505593066 27.678121535825863 27.16416406328731 20.583492895293762 150-151 24.10003789314134 28.028293545534925 27.131489200454716 20.740179360869014 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 1.0 22 0.5 23 0.5 24 1.0 25 1.0 26 2.5 27 2.0 28 2.5 29 6.5 30 8.5 31 9.0 32 12.0 33 19.0 34 28.5 35 43.0 36 55.0 37 76.0 38 107.0 39 138.0 40 187.0 41 227.0 42 244.5 43 279.0 44 313.0 45 291.0 46 269.0 47 271.0 48 261.5 49 226.0 50 179.5 51 170.5 52 141.0 53 98.5 54 78.5 55 59.5 56 51.5 57 37.0 58 20.5 59 20.0 60 18.5 61 10.5 62 6.0 63 4.5 64 3.5 65 2.5 66 2.5 67 3.0 68 1.5 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.19499999999999998 70-74 0.335 75-79 0.18 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.13999999999999999 140-144 0.42 145-149 0.77 150-151 1.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.5125 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.6499999999999999 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.9624999999999999 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.2125 0.0 0.0 0.0 0.0 134-135 1.3250000000000002 0.0 0.0 0.0 0.0 136-137 1.475 0.0 0.0 0.0 0.0 138-139 1.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643089 spots for SRR7169110.sra Written 643089 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra Read 643081 spots for SRR7169110.sra Written 643081 spots for SRR7169110.sra SRR ids: ['SRR7169110.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fko7nc_9 SRR7169110.sra spots: 12861628 blocks: [[1, 643081], [643082, 1286162], [1286163, 1929243], [1929244, 2572324], [2572325, 3215405], [3215406, 3858486], [3858487, 4501567], [4501568, 5144648], [5144649, 5787729], [5787730, 6430810], [6430811, 7073891], [7073892, 7716972], [7716973, 8360053], [8360054, 9003134], [9003135, 9646215], [9646216, 10289296], [10289297, 10932377], [10932378, 11575458], [11575459, 12218539], [12218540, 12861628]] SRR7169110 file size 4336683 SRR7169110 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169110 SRR7169110_1.fastq SRR7169110_2.fastq Input file: SRR7169110_1.fastq Paired file: SRR7169110_2.fastq trimmed: SRR7169110-trimmed-pair1.fastq, SRR7169110-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:08:37 2025 >> started Mon Feb 10 22:08:51 2025 >> done (13.761s) 12861628 read pairs processed; of these: 19774 ( 0.15%) short read pairs filtered out after trimming by size control 16095 ( 0.13%) empty read pairs filtered out after trimming by size control 12825759 (99.72%) read pairs available; of these: 6686528 (52.13%) trimmed read pairs available after processing 6139231 (47.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 8 0.00% 21 7 0.00% 22 4 0.00% 23 1 0.00% 24 9 0.00% 25 6 0.00% 26 4 0.00% 27 5 0.00% 28 2 0.00% 29 5 0.00% 30 10 0.00% 31 10 0.00% 32 15 0.00% 33 11 0.00% 34 8 0.00% 35 11 0.00% 36 10 0.00% 37 16 0.00% 38 14 0.00% 39 11 0.00% 40 16 0.00% 41 15 0.00% 42 13 0.00% 43 22 0.00% 44 21 0.00% 45 25 0.00% 46 29 0.00% 47 27 0.00% 48 23 0.00% 49 23 0.00% 50 33 0.00% 51 40 0.00% 52 44 0.00% 53 57 0.00% 54 48 0.00% 55 50 0.00% 56 71 0.00% 57 59 0.00% 58 51 0.00% 59 87 0.00% 60 97 0.00% 61 84 0.00% 62 90 0.00% 63 101 0.00% 64 101 0.00% 65 138 0.00% 66 107 0.00% 67 159 0.00% 68 151 0.00% 69 177 0.00% 70 200 0.00% 71 244 0.00% 72 217 0.00% 73 283 0.00% 74 329 0.00% 75 341 0.00% 76 392 0.00% 77 432 0.00% 78 492 0.00% 79 557 0.00% 80 565 0.00% 81 680 0.01% 82 720 0.01% 83 960 0.01% 84 1714 0.01% 85 2208 0.02% 86 2259 0.02% 87 2381 0.02% 88 2466 0.02% 89 2357 0.02% 90 2600 0.02% 91 2734 0.02% 92 2775 0.02% 93 3018 0.02% 94 3216 0.03% 95 3204 0.02% 96 3600 0.03% 97 3947 0.03% 98 4214 0.03% 99 4440 0.03% 100 4784 0.04% 101 4959 0.04% 102 5289 0.04% 103 5586 0.04% 104 6123 0.05% 105 6434 0.05% 106 6931 0.05% 107 7494 0.06% 108 7761 0.06% 109 8192 0.06% 110 8668 0.07% 111 9087 0.07% 112 9726 0.08% 113 10503 0.08% 114 10859 0.08% 115 11495 0.09% 116 12191 0.10% 117 13107 0.10% 118 13900 0.11% 119 14510 0.11% 120 15383 0.12% 121 16261 0.13% 122 17487 0.14% 123 18492 0.14% 124 20050 0.16% 125 20961 0.16% 126 22898 0.18% 127 24310 0.19% 128 26039 0.20% 129 27613 0.22% 130 29729 0.23% 131 31871 0.25% 132 34886 0.27% 133 38124 0.30% 134 40778 0.32% 135 45272 0.35% 136 49124 0.38% 137 54409 0.42% 138 60846 0.47% 139 68536 0.53% 140 76146 0.59% 141 84579 0.66% 142 97407 0.76% 143 112573 0.88% 144 134598 1.05% 145 165488 1.29% 146 212689 1.66% 147 298961 2.33% 148 462693 3.61% 149 870920 6.79% 150 3274122 25.53% 151 6139231 47.87% 12825759 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=39 prefix-density=0.26 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=221.65 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=17.6 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=28 prefix-density=0.32 prefix-fanout=2.6 sequence=GTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=32 fanout-score=48.95 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=9.1 sequence=TTCTTCATTGCCCTCCAACCCTAGCTCAGTCACCAGCTGCAGCCCCAGCACCACC SRR7169110 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:09:40 Started mapping on | Feb 10 22:09:41 Finished on | Feb 10 22:11:05 Mapping speed, Million of reads per hour | 549.68 Number of input reads | 12825759 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11970879 Uniquely mapped reads % | 93.33% Average mapped length | 295.75 Number of splices: Total | 10786609 Number of splices: Annotated (sjdb) | 10610245 Number of splices: GT/AG | 10634469 Number of splices: GC/AG | 120318 Number of splices: AT/AC | 8707 Number of splices: Non-canonical | 23115 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234251 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 17144 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.67% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 639941 639941 639941 N_multimapping 234251 234251 234251 N_noFeature 225069 11826031 279687 N_ambiguous 141056 746 50357 UnstrandedReadsAssigned:11604754 PositiveStrandReadsAssigned:144102 NegativeStrandReadsAssigned:11640835 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169110 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169110-trimmed-pair1.fastq SRR7169110-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,825,759 reads, 11,576,260 reads pseudoaligned [quant] estimated average fragment length: 265.194 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52401 SRR7169110.ke.tsv 34699 SRR7169110.se.tsv 87100 total ==> SRR7169110.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.81 181 7.10123 Potri.005G024800.1.v4.1 1035 770.806 33 2.94582 Potri.004G059700.1.v4.1 961 696.824 3 0.296234 Potri.007G009000.2.v4.1 1416 1151.81 0 0 Potri.003G141000.2.v4.1 2943 2678.81 208.034 5.34355 Potri.016G087400.1.v4.1 270 61.8727 1294.01 1439.05 Potri.015G069301.1.v4.1 564 304.019 0 0 Potri.010G195200.1.v4.1 1773 1508.81 4 0.182416 Potri.012G127500.1.v4.1 977 712.824 3576 345.185 ==> SRR7169110.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1067 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 197 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169110 completed mapping pipeline successfully