Starting /dee2/code/volunteer_pipeline.sh SRR7169111 current disk space = 3057003413504 free memory = 1438404632 SRR7169111 SRAfilesize 3e9e19e2c69585271adad11f2dc63814 SRR7169111.sra SRR7169111.sra file validated SRR7169111 is paired end SRR7169111 is conventional basespace SRR7169111 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169111_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.014 34.0 33.0 34.0 32.0 34.0 2 33.22 34.0 33.0 34.0 32.0 34.0 3 33.29025 34.0 33.0 34.0 32.0 34.0 4 33.39025 34.0 33.0 34.0 33.0 34.0 5 33.3325 34.0 33.0 34.0 33.0 34.0 6 37.1045 38.0 37.0 38.0 36.0 38.0 7 35.60175 38.0 37.0 38.0 29.0 38.0 8 36.09425 38.0 37.0 38.0 31.0 38.0 9 37.15875 38.0 38.0 38.0 36.0 38.0 10-14 37.3815 38.0 38.0 38.0 36.8 38.0 15-19 37.103249999999996 38.0 38.0 38.0 36.2 38.0 20-24 37.3467 38.0 38.0 38.0 37.0 38.0 25-29 37.26825 38.0 38.0 38.0 36.6 38.0 30-34 37.29565 38.0 38.0 38.0 37.0 38.0 35-39 37.3754 38.0 38.0 38.0 37.0 38.0 40-44 36.82875 38.0 37.8 38.0 34.8 38.0 45-49 36.721599999999995 38.0 38.0 38.0 34.8 38.0 50-54 36.4191 38.0 37.4 38.0 33.2 38.0 55-59 36.367200000000004 38.0 37.6 38.0 33.6 38.0 60-64 36.4778 38.0 37.8 38.0 33.4 38.0 65-69 36.396699999999996 38.0 37.2 38.0 34.0 38.0 70-74 36.1308 38.0 37.0 38.0 32.6 38.0 75-79 36.428900000000006 38.0 37.0 38.0 33.8 38.0 80-84 36.2213 38.0 37.0 38.0 33.2 38.0 85-89 35.94435 38.0 36.8 38.0 31.8 38.0 90-94 35.803549999999994 38.0 36.6 38.0 31.0 38.0 95-99 35.69734999999999 38.0 36.6 38.0 30.8 38.0 100-104 35.14145 38.0 35.8 38.0 28.2 38.0 105-109 34.65715 38.0 34.6 38.0 25.8 38.0 110-114 34.6169 38.0 34.6 38.0 25.8 38.0 115-119 34.67895 38.0 34.8 38.0 26.6 38.0 120-124 34.2157 38.0 34.2 38.0 23.6 38.0 125-129 33.7337 38.0 34.0 38.0 21.8 38.0 130-134 33.56325 38.0 33.6 38.0 21.8 38.0 135-139 33.125800000000005 37.8 32.4 38.0 19.0 38.0 140-144 31.890800000000002 36.0 31.4 38.0 13.8 38.0 145-149 30.412599999999998 36.0 30.0 38.0 8.6 38.0 150-151 25.461125 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 1.0 17 1.0 18 4.0 19 5.0 20 5.0 21 5.0 22 12.0 23 8.0 24 12.0 25 22.0 26 29.0 27 39.0 28 57.0 29 60.0 30 87.0 31 95.0 32 140.0 33 183.0 34 300.0 35 521.0 36 1063.0 37 1346.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.647828362114076 13.57927786499215 9.654631083202512 34.11826268969126 2 23.45 13.15 33.650000000000006 29.75 3 19.05 19.2 26.174999999999997 35.575 4 21.8 28.1 23.05 27.05 5 23.35 30.5 24.55 21.6 6 19.1 35.199999999999996 24.125 21.575 7 14.85 27.0 39.975 18.175 8 17.724999999999998 25.650000000000002 31.324999999999996 25.3 9 17.575 24.675 34.300000000000004 23.45 10-14 20.145 29.68 27.455000000000002 22.720000000000002 15-19 20.04 28.994999999999997 27.72 23.244999999999997 20-24 20.409081816363273 29.190838167633526 26.845369073814762 23.554710942188436 25-29 19.88 29.794999999999998 26.55 23.775 30-34 20.115028757189297 29.152288072018006 27.156789197299325 23.575893973493372 35-39 19.91497874468617 28.89722430607652 27.081770442610654 24.10602650662666 40-44 19.89693816289774 28.877326395837503 27.971783069841905 23.253952371422855 45-49 20.69 28.325 27.595 23.39 50-54 19.930996549827494 29.031451572578632 27.771388569428474 23.266163308165407 55-59 20.26 28.715000000000003 26.905 24.12 60-64 20.31101555077754 28.891444572228615 27.04135206760338 23.756187809390468 65-69 20.07 28.51 27.99 23.43 70-74 20.19903980796159 28.785757151430285 26.925385077015402 24.08981796359272 75-79 19.93 28.15 27.855 24.065 80-84 20.29 28.845 27.345000000000002 23.52 85-89 20.39101955097755 28.24641232061603 27.83639181959098 23.52617630881544 90-94 20.498199279711883 28.13625450180072 27.526010404161667 23.83953581432573 95-99 20.855 28.27 27.165 23.71 100-104 20.825 29.035 26.99 23.150000000000002 105-109 20.3 28.48 26.96 24.26 110-114 20.169999999999998 28.425 27.935 23.47 115-119 20.925 28.025 27.605 23.445 120-124 20.715 28.255000000000003 27.195000000000004 23.835 125-129 20.919999999999998 27.88 27.825 23.375 130-134 20.74 28.285 27.295 23.68 135-139 20.52423590615777 28.172677704967235 27.632434595568007 23.670651793306988 140-144 20.85104255212761 27.43637181859093 27.951397569878495 23.761188059402972 145-149 21.532536387735707 28.254889211223926 26.74936227679688 23.463212124243483 150-151 21.099999999999998 27.525 27.3375 24.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 2.5 25 3.5 26 4.5 27 5.0 28 8.0 29 16.5 30 21.0 31 20.5 32 31.0 33 44.0 34 51.0 35 68.5 36 88.5 37 101.0 38 123.5 39 161.5 40 187.5 41 204.0 42 239.5 43 251.0 44 264.0 45 283.0 46 261.0 47 261.0 48 252.5 49 210.5 50 181.0 51 147.0 52 122.0 53 108.0 54 77.0 55 51.0 56 37.0 57 25.0 58 22.0 59 17.0 60 11.0 61 9.0 62 8.5 63 5.5 64 1.5 65 2.5 66 2.0 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.02 25-29 0.0 30-34 0.025 35-39 0.025 40-44 0.06 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.005 65-69 0.0 70-74 0.02 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.04 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.045 140-144 0.005 145-149 0.034999999999999996 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.2125 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.8374999999999999 0.0 0.0 0.0 0.0 130-131 0.8875 0.0 0.0 0.0 0.0 132-133 1.05 0.0 0.0 0.0 0.0 134-135 1.1 0.0 0.0 0.0 0.0 136-137 1.2000000000000002 0.0 0.0 0.0 0.0 138-139 1.3624999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATCGA 10 0.0060887975 150.61038 1 GGAGGCT 10 0.006836113 144.9625 3 >>END_MODULE SRR7169111 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169111_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.836 33.0 33.0 34.0 32.0 34.0 2 32.9365 34.0 33.0 34.0 32.0 34.0 3 32.926 34.0 33.0 34.0 32.0 34.0 4 32.85075 34.0 33.0 34.0 32.0 34.0 5 32.98125 34.0 33.0 34.0 32.0 34.0 6 36.91975 38.0 38.0 38.0 36.0 38.0 7 36.91275 38.0 38.0 38.0 36.0 38.0 8 36.39325 38.0 38.0 38.0 34.0 38.0 9 36.8675 38.0 38.0 38.0 36.0 38.0 10-14 36.85095 38.0 38.0 38.0 36.2 38.0 15-19 36.9324 38.0 38.0 38.0 36.0 38.0 20-24 36.84375 38.0 38.0 38.0 36.0 38.0 25-29 36.9219 38.0 38.0 38.0 36.0 38.0 30-34 36.89905 38.0 38.0 38.0 36.2 38.0 35-39 36.61985 38.0 38.0 38.0 35.2 38.0 40-44 36.620999999999995 38.0 38.0 38.0 35.4 38.0 45-49 36.847449999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.824600000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.650800000000004 38.0 38.0 38.0 35.4 38.0 60-64 36.577999999999996 38.0 38.0 38.0 34.8 38.0 65-69 36.54164999999999 38.0 38.0 38.0 34.8 38.0 70-74 36.39765 38.0 38.0 38.0 34.2 38.0 75-79 36.31665 38.0 38.0 38.0 34.0 38.0 80-84 36.08335 38.0 38.0 38.0 33.4 38.0 85-89 35.75105 38.0 37.0 38.0 31.0 38.0 90-94 35.861000000000004 38.0 37.4 38.0 31.8 38.0 95-99 36.01745 38.0 37.8 38.0 33.4 38.0 100-104 35.83265 38.0 37.4 38.0 32.8 38.0 105-109 35.56745 38.0 37.0 38.0 31.0 38.0 110-114 35.1541 38.0 36.4 38.0 28.4 38.0 115-119 35.02715 38.0 36.2 38.0 27.8 38.0 120-124 35.1725 38.0 36.0 38.0 29.0 38.0 125-129 34.33630000000001 38.0 35.0 38.0 24.8 38.0 130-134 34.00775 38.0 35.0 38.0 22.6 38.0 135-139 33.539 38.0 34.0 38.0 18.6 38.0 140-144 33.458450000000006 38.0 34.0 38.0 19.8 38.0 145-149 32.4011 38.0 33.2 38.0 11.0 38.0 150-151 28.225 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 4.0 4 0.0 5 0.0 6 2.0 7 1.0 8 1.0 9 3.0 10 2.0 11 2.0 12 0.0 13 2.0 14 7.0 15 3.0 16 7.0 17 9.0 18 7.0 19 12.0 20 8.0 21 11.0 22 17.0 23 16.0 24 8.0 25 21.0 26 16.0 27 33.0 28 47.0 29 52.0 30 62.0 31 78.0 32 72.0 33 127.0 34 164.0 35 277.0 36 618.0 37 2301.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.43435858964741 21.530382595648913 13.42835708927232 27.60690172543136 2 28.232058014503625 26.70667666916729 27.906976744186046 17.154288572143038 3 19.85 30.0 31.225 18.925 4 23.075000000000003 33.75 23.525 19.650000000000002 5 24.925 35.9 21.65 17.525 6 21.099999999999998 38.45 22.875 17.575 7 19.650000000000002 23.200000000000003 37.0 20.150000000000002 8 21.55 25.775 27.175 25.5 9 20.474999999999998 25.5 30.75 23.275000000000002 10-14 22.73 29.215000000000003 26.015 22.040000000000003 15-19 23.62 27.96 27.415 21.005 20-24 23.044999999999998 28.720000000000002 27.245 20.990000000000002 25-29 23.09 28.58 26.884999999999998 21.445 30-34 22.985 28.365000000000002 27.54 21.11 35-39 23.080000000000002 28.375 27.500000000000004 21.044999999999998 40-44 23.03 27.955000000000002 27.744999999999997 21.27 45-49 22.975 27.975 27.694999999999997 21.355 50-54 23.01 28.365000000000002 27.450000000000003 21.175 55-59 23.3 27.6 27.85 21.25 60-64 23.599999999999998 27.575 27.67 21.154999999999998 65-69 23.995 27.92 27.32 20.765 70-74 23.39 28.16 27.485 20.965 75-79 23.22 27.72 28.199999999999996 20.86 80-84 23.825 27.905 27.439999999999998 20.830000000000002 85-89 23.895 27.944999999999997 27.605 20.555 90-94 24.0 28.305000000000003 26.735 20.96 95-99 23.735 27.955000000000002 27.92 20.39 100-104 24.115000000000002 28.185 27.195000000000004 20.505000000000003 105-109 23.34 27.52 28.275 20.865000000000002 110-114 23.189999999999998 28.255000000000003 27.694999999999997 20.86 115-119 24.095 27.560000000000002 27.805000000000003 20.54 120-124 23.765 28.139999999999997 27.425 20.669999999999998 125-129 24.288643296494474 27.539130869630448 27.33410011501725 20.838125718857828 130-134 23.93 28.125 27.35 20.595 135-139 23.84 27.665 27.99 20.505000000000003 140-144 23.97 27.779999999999998 27.500000000000004 20.75 145-149 23.645 28.27 27.605 20.48 150-151 24.5375 27.187499999999996 27.35 20.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 2.0 25 3.0 26 1.0 27 2.0 28 3.5 29 4.5 30 6.5 31 8.0 32 16.5 33 27.5 34 41.5 35 59.5 36 70.0 37 99.0 38 131.0 39 164.0 40 217.0 41 229.0 42 246.0 43 278.0 44 282.5 45 277.5 46 274.0 47 281.0 48 263.0 49 219.0 50 171.0 51 134.5 52 119.5 53 96.0 54 71.5 55 59.5 56 39.0 57 29.0 58 25.0 59 15.5 60 9.5 61 4.0 62 3.0 63 4.0 64 1.5 65 1.5 66 2.0 67 0.5 68 0.5 69 2.0 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.015 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.42500000000000004 0.0 0.0 0.0 0.0 118-119 0.45 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.6000000000000001 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.7875000000000001 0.0 0.0 0.0 0.0 128-129 0.8374999999999999 0.0 0.0 0.0 0.0 130-131 0.8875 0.0 0.0 0.0 0.0 132-133 1.05 0.0 0.0 0.0 0.0 134-135 1.0875 0.0 0.0 0.0 0.0 136-137 1.1749999999999998 0.0 0.0 0.0 0.0 138-139 1.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTCA 10 0.006830828 145.0 4 >>END_MODULE Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085972 spots for SRR7169111.sra Written 1085972 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra Read 1085961 spots for SRR7169111.sra Written 1085961 spots for SRR7169111.sra SRR ids: ['SRR7169111.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q029ohje SRR7169111.sra spots: 21719231 blocks: [[1, 1085961], [1085962, 2171922], [2171923, 3257883], [3257884, 4343844], [4343845, 5429805], [5429806, 6515766], [6515767, 7601727], [7601728, 8687688], [8687689, 9773649], [9773650, 10859610], [10859611, 11945571], [11945572, 13031532], [13031533, 14117493], [14117494, 15203454], [15203455, 16289415], [16289416, 17375376], [17375377, 18461337], [18461338, 19547298], [19547299, 20633259], [20633260, 21719231]] SRR7169111 file size 7338234 SRR7169111 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169111 SRR7169111_1.fastq SRR7169111_2.fastq Input file: SRR7169111_1.fastq Paired file: SRR7169111_2.fastq trimmed: SRR7169111-trimmed-pair1.fastq, SRR7169111-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:52:44 2025 >> started Mon Feb 10 21:53:09 2025 >> done (24.923s) 21719231 read pairs processed; of these: 32122 ( 0.15%) short read pairs filtered out after trimming by size control 37028 ( 0.17%) empty read pairs filtered out after trimming by size control 21650081 (99.68%) read pairs available; of these: 10652257 (49.20%) trimmed read pairs available after processing 10997824 (50.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 9 0.00% 21 2 0.00% 22 8 0.00% 23 5 0.00% 24 5 0.00% 25 11 0.00% 26 7 0.00% 27 8 0.00% 28 5 0.00% 29 4 0.00% 30 7 0.00% 31 8 0.00% 32 17 0.00% 33 5 0.00% 34 16 0.00% 35 6 0.00% 36 9 0.00% 37 4 0.00% 38 17 0.00% 39 12 0.00% 40 13 0.00% 41 12 0.00% 42 29 0.00% 43 17 0.00% 44 27 0.00% 45 24 0.00% 46 25 0.00% 47 40 0.00% 48 18 0.00% 49 27 0.00% 50 35 0.00% 51 46 0.00% 52 39 0.00% 53 47 0.00% 54 55 0.00% 55 53 0.00% 56 49 0.00% 57 62 0.00% 58 60 0.00% 59 89 0.00% 60 76 0.00% 61 86 0.00% 62 109 0.00% 63 140 0.00% 64 123 0.00% 65 156 0.00% 66 159 0.00% 67 168 0.00% 68 207 0.00% 69 230 0.00% 70 260 0.00% 71 255 0.00% 72 285 0.00% 73 319 0.00% 74 326 0.00% 75 368 0.00% 76 465 0.00% 77 471 0.00% 78 592 0.00% 79 619 0.00% 80 736 0.00% 81 877 0.00% 82 945 0.00% 83 1198 0.01% 84 2497 0.01% 85 3306 0.02% 86 3408 0.02% 87 3650 0.02% 88 3881 0.02% 89 3885 0.02% 90 3781 0.02% 91 3882 0.02% 92 4112 0.02% 93 4131 0.02% 94 4294 0.02% 95 4699 0.02% 96 4766 0.02% 97 5182 0.02% 98 5493 0.03% 99 5822 0.03% 100 6104 0.03% 101 6496 0.03% 102 6871 0.03% 103 7438 0.03% 104 7802 0.04% 105 8495 0.04% 106 8964 0.04% 107 9716 0.04% 108 10398 0.05% 109 10808 0.05% 110 11454 0.05% 111 12179 0.06% 112 12782 0.06% 113 13754 0.06% 114 14658 0.07% 115 15767 0.07% 116 16608 0.08% 117 17677 0.08% 118 18510 0.09% 119 19854 0.09% 120 20569 0.10% 121 21814 0.10% 122 22992 0.11% 123 24791 0.11% 124 26701 0.12% 125 28771 0.13% 126 30869 0.14% 127 33099 0.15% 128 35716 0.16% 129 38300 0.18% 130 41144 0.19% 131 44252 0.20% 132 47717 0.22% 133 51928 0.24% 134 56568 0.26% 135 62163 0.29% 136 67987 0.31% 137 75644 0.35% 138 83774 0.39% 139 92844 0.43% 140 103053 0.48% 141 117203 0.54% 142 137044 0.63% 143 157588 0.73% 144 192645 0.89% 145 238506 1.10% 146 308611 1.43% 147 432138 2.00% 148 672599 3.11% 149 1321092 6.10% 150 5750896 26.56% 151 10997824 50.80% 21650081 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=43 prefix-density=0.19 prefix-fanout=2.0 sequence=GTTTATAAGGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=237.75 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.1 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=37 prefix-density=0.26 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=61.73 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=13.9 sequence=TGTTGGTGGTGG SRR7169111 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:53:57 Started mapping on | Feb 10 21:53:58 Finished on | Feb 10 21:56:26 Mapping speed, Million of reads per hour | 526.62 Number of input reads | 21650081 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20246127 Uniquely mapped reads % | 93.52% Average mapped length | 296.76 Number of splices: Total | 19487776 Number of splices: Annotated (sjdb) | 19184706 Number of splices: GT/AG | 19213248 Number of splices: GC/AG | 221882 Number of splices: AT/AC | 15563 Number of splices: Non-canonical | 37083 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 372223 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 45883 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.51% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1059130 1059130 1059130 N_multimapping 372223 372223 372223 N_noFeature 378841 20014580 472536 N_ambiguous 215987 1223 77211 UnstrandedReadsAssigned:19651299 PositiveStrandReadsAssigned:230324 NegativeStrandReadsAssigned:19696380 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169111 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169111-trimmed-pair1.fastq SRR7169111-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,650,081 reads, 19,561,965 reads pseudoaligned [quant] estimated average fragment length: 278.551 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52401 SRR7169111.ke.tsv 34699 SRR7169111.se.tsv 87100 total ==> SRR7169111.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.45 220 5.59106 Potri.005G024800.1.v4.1 1035 757.449 59 3.44533 Potri.004G059700.1.v4.1 961 683.515 7 0.452984 Potri.007G009000.2.v4.1 1416 1138.45 0 0 Potri.003G141000.2.v4.1 2943 2665.45 326 5.40978 Potri.016G087400.1.v4.1 270 59.3243 2058.57 1534.85 Potri.015G069301.1.v4.1 564 293.59 0 0 Potri.010G195200.1.v4.1 1773 1495.45 32 0.946479 Potri.012G127500.1.v4.1 977 699.499 6941 438.902 ==> SRR7169111.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1563 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 341 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169111 completed mapping pipeline successfully