Starting /dee2/code/volunteer_pipeline.sh SRR7169112 current disk space = 3057473490944 free memory = 1475282108 SRR7169112 SRAfilesize 150f2d7f69cd5255807d062094002907 SRR7169112.sra SRR7169112.sra file validated SRR7169112 is paired end SRR7169112 is conventional basespace SRR7169112 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169112_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.957 34.0 34.0 34.0 33.0 34.0 2 33.44875 34.0 34.0 34.0 33.0 34.0 3 33.53425 34.0 34.0 34.0 33.0 34.0 4 33.53225 34.0 34.0 34.0 33.0 34.0 5 33.51725 34.0 34.0 34.0 33.0 34.0 6 37.31075 38.0 38.0 38.0 36.0 38.0 7 37.48525 38.0 38.0 38.0 37.0 38.0 8 37.5325 38.0 38.0 38.0 38.0 38.0 9 37.5755 38.0 38.0 38.0 38.0 38.0 10-14 37.545249999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.51255 38.0 38.0 38.0 38.0 38.0 20-24 37.522000000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.4744 38.0 38.0 38.0 37.8 38.0 30-34 37.38355 38.0 38.0 38.0 37.8 38.0 35-39 37.311449999999994 38.0 38.0 38.0 37.0 38.0 40-44 36.9795 38.0 38.0 38.0 36.0 38.0 45-49 36.855399999999996 38.0 38.0 38.0 35.6 38.0 50-54 36.77120000000001 38.0 38.0 38.0 35.2 38.0 55-59 36.69805 38.0 38.0 38.0 34.6 38.0 60-64 36.765499999999996 38.0 38.0 38.0 35.0 38.0 65-69 36.535849999999996 38.0 38.0 38.0 34.2 38.0 70-74 36.476800000000004 38.0 38.0 38.0 34.0 38.0 75-79 36.314949999999996 38.0 37.8 38.0 33.6 38.0 80-84 36.260149999999996 38.0 38.0 38.0 33.8 38.0 85-89 36.0045 38.0 37.2 38.0 33.0 38.0 90-94 35.694599999999994 38.0 37.0 38.0 31.0 38.0 95-99 35.767999999999994 38.0 37.0 38.0 31.6 38.0 100-104 35.30345 38.0 36.2 38.0 29.2 38.0 105-109 35.21545 38.0 36.0 38.0 28.8 38.0 110-114 34.75785 38.0 35.4 38.0 27.2 38.0 115-119 34.74249999999999 38.0 35.2 38.0 27.0 38.0 120-124 34.47865 38.0 35.0 38.0 25.6 38.0 125-129 33.8489 38.0 34.8 38.0 21.0 38.0 130-134 33.373749999999994 38.0 34.0 38.0 17.4 38.0 135-139 32.934799999999996 38.0 33.6 38.0 14.8 38.0 140-144 32.44270000000001 38.0 33.0 38.0 14.0 38.0 145-149 31.313499999999998 36.2 31.8 38.0 9.0 38.0 150-151 27.451999999999998 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 4.0 11 0.0 12 2.0 13 2.0 14 3.0 15 8.0 16 3.0 17 6.0 18 7.0 19 10.0 20 6.0 21 15.0 22 12.0 23 12.0 24 22.0 25 36.0 26 31.0 27 32.0 28 31.0 29 44.0 30 44.0 31 59.0 32 94.0 33 112.0 34 210.0 35 393.0 36 944.0 37 1856.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.125541125541126 14.871403106697223 10.16042780748663 33.84262796027502 2 23.175 14.825 33.300000000000004 28.7 3 19.675 19.775000000000002 26.775 33.775 4 21.775 26.25 23.799999999999997 28.175 5 22.1 31.424999999999997 23.9 22.575 6 20.549999999999997 34.4 25.575 19.475 7 14.85 27.6 39.825 17.724999999999998 8 17.05 29.349999999999998 29.4 24.2 9 16.85 26.6 33.15 23.400000000000002 10-14 19.53 30.735 27.93 21.805 15-19 19.34 29.43 27.855 23.375 20-24 19.75 29.054999999999996 27.925 23.27 25-29 19.625 29.645 27.355 23.375 30-34 19.259999999999998 29.345 28.12 23.275000000000002 35-39 19.965 29.09 27.634999999999998 23.31 40-44 19.45 29.049999999999997 27.860000000000003 23.64 45-49 19.82 28.71 27.915 23.555 50-54 19.785 29.044999999999998 27.560000000000002 23.61 55-59 20.155 28.810000000000002 27.61 23.425 60-64 20.415 29.04 26.795 23.75 65-69 20.200000000000003 29.080000000000002 27.525 23.195 70-74 20.155 29.035 27.405 23.405 75-79 20.61 28.375 27.29 23.724999999999998 80-84 19.655 29.74 27.015 23.59 85-89 20.474999999999998 29.134999999999998 26.86 23.53 90-94 20.485 29.145 26.740000000000002 23.630000000000003 95-99 20.78 28.765 26.590000000000003 23.865 100-104 20.37037037037037 28.313313313313316 27.832832832832832 23.483483483483482 105-109 20.47 28.32 27.6 23.61 110-114 20.374636882700592 28.553541019733547 27.055995191826103 24.015826905739758 115-119 20.445 28.825 27.07 23.66 120-124 20.55747385277486 28.15393084121503 27.083020567482357 24.205574738527748 125-129 20.122012201220123 29.117911791179118 27.13271327132713 23.62736273627363 130-134 20.565 28.38 27.37 23.685000000000002 135-139 20.52 28.449999999999996 27.22 23.810000000000002 140-144 20.7 28.49 27.334999999999997 23.474999999999998 145-149 21.060000000000002 28.475 27.189999999999998 23.275000000000002 150-151 20.7375 27.987499999999997 27.375 23.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 1.0 20 1.5 21 1.5 22 1.5 23 1.0 24 2.5 25 6.0 26 10.5 27 11.0 28 12.5 29 18.5 30 27.0 31 35.5 32 40.5 33 56.0 34 63.5 35 78.0 36 102.0 37 133.0 38 151.0 39 155.0 40 190.0 41 215.5 42 209.0 43 217.5 44 252.0 45 250.5 46 242.0 47 245.0 48 226.0 49 199.0 50 170.0 51 143.0 52 123.5 53 105.5 54 79.0 55 52.5 56 38.0 57 32.0 58 23.5 59 17.5 60 15.0 61 10.0 62 9.5 63 7.5 64 3.0 65 1.5 66 0.5 67 0.5 68 2.5 69 2.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.1 105-109 0.0 110-114 0.16999999999999998 115-119 0.0 120-124 0.08499999999999999 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32007051120625 98.6 2 0.6295643414756988 1.25 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.025 0.0 0.0 0.025 0.0 94-95 0.05 0.0 0.0 0.025 0.0 96-97 0.0625 0.0 0.0 0.025 0.0 98-99 0.075 0.0 0.0 0.025 0.0 100-101 0.075 0.0 0.0 0.025 0.0 102-103 0.1 0.0 0.0 0.025 0.0 104-105 0.1375 0.0 0.0 0.025 0.0 106-107 0.175 0.0 0.0 0.025 0.0 108-109 0.1875 0.0 0.0 0.025 0.0 110-111 0.23750000000000002 0.0 0.0 0.025 0.0 112-113 0.3375 0.0 0.0 0.025 0.0 114-115 0.42500000000000004 0.0 0.0 0.025 0.0 116-117 0.475 0.0 0.0 0.025 0.0 118-119 0.6 0.0 0.0 0.025 0.0 120-121 0.7 0.0 0.0 0.025 0.0 122-123 0.75 0.0 0.0 0.025 0.0 124-125 0.775 0.0 0.0 0.025 0.0 126-127 0.8375 0.0 0.0 0.025 0.0 128-129 0.9875 0.0 0.0 0.025 0.0 130-131 1.0750000000000002 0.0 0.0 0.025 0.0 132-133 1.325 0.0 0.0 0.025 0.0 134-135 1.475 0.0 0.0 0.025 0.0 136-137 1.575 0.0 0.0 0.025 0.0 138-139 1.9625000000000001 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAAAT 10 0.0068343505 144.975 7 AAAATAC 10 0.0068343505 144.975 9 >>END_MODULE SRR7169112 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169112_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8745 33.0 33.0 34.0 32.0 34.0 2 33.00875 34.0 33.0 34.0 32.0 34.0 3 33.05375 34.0 33.0 34.0 33.0 34.0 4 33.08475 34.0 33.0 34.0 33.0 34.0 5 33.074 34.0 33.0 34.0 33.0 34.0 6 37.17775 38.0 38.0 38.0 37.0 38.0 7 37.2075 38.0 38.0 38.0 37.0 38.0 8 37.224 38.0 38.0 38.0 37.0 38.0 9 37.20975 38.0 38.0 38.0 37.0 38.0 10-14 37.16805000000001 38.0 38.0 38.0 37.2 38.0 15-19 37.154849999999996 38.0 38.0 38.0 37.2 38.0 20-24 37.1649 38.0 38.0 38.0 37.0 38.0 25-29 37.129650000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.102050000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.09615 38.0 38.0 38.0 37.0 38.0 40-44 37.037549999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.023199999999996 38.0 38.0 38.0 37.0 38.0 50-54 36.8883 38.0 38.0 38.0 36.8 38.0 55-59 36.80525 38.0 38.0 38.0 36.6 38.0 60-64 36.77165 38.0 38.0 38.0 36.4 38.0 65-69 36.593149999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.55055 38.0 38.0 38.0 36.0 38.0 75-79 36.464 38.0 38.0 38.0 35.6 38.0 80-84 36.58290000000001 38.0 38.0 38.0 35.6 38.0 85-89 36.545049999999996 38.0 38.0 38.0 35.8 38.0 90-94 36.4714 38.0 38.0 38.0 35.2 38.0 95-99 36.3703 38.0 38.0 38.0 34.6 38.0 100-104 36.2342 38.0 38.0 38.0 34.0 38.0 105-109 36.093900000000005 38.0 38.0 38.0 34.0 38.0 110-114 35.953050000000005 38.0 38.0 38.0 34.0 38.0 115-119 35.8037 38.0 38.0 38.0 33.0 38.0 120-124 35.6718 38.0 38.0 38.0 32.8 38.0 125-129 35.4269 38.0 37.4 38.0 31.0 38.0 130-134 35.269000000000005 38.0 37.4 38.0 30.6 38.0 135-139 34.780950000000004 38.0 36.0 38.0 28.2 38.0 140-144 34.3424 38.0 36.0 38.0 26.2 38.0 145-149 33.65605000000001 38.0 35.6 38.0 19.0 38.0 150-151 30.34275 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 4.0 4 4.0 5 1.0 6 2.0 7 1.0 8 2.0 9 1.0 10 0.0 11 7.0 12 7.0 13 11.0 14 3.0 15 5.0 16 3.0 17 2.0 18 3.0 19 5.0 20 15.0 21 11.0 22 9.0 23 10.0 24 13.0 25 18.0 26 24.0 27 22.0 28 28.0 29 40.0 30 43.0 31 46.0 32 60.0 33 67.0 34 99.0 35 151.0 36 346.0 37 2933.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.48430831031885 23.62540798393171 14.285714285714285 24.604569420035148 2 27.077077077077078 28.853853853853856 27.37737737737738 16.691691691691695 3 21.17117117117117 30.28028028028028 29.72972972972973 18.81881881881882 4 23.5 34.849999999999994 22.925 18.725 5 23.936968484242122 35.042521260630316 22.236118059029515 18.78439219609805 6 21.45 38.275 23.025000000000002 17.25 7 19.75 22.5 37.6 20.150000000000002 8 23.525 26.125 25.674999999999997 24.675 9 21.15 25.55 30.599999999999998 22.7 10-14 23.69 28.53 26.075 21.705 15-19 24.13 27.860000000000003 27.139999999999997 20.87 20-24 23.445 28.505000000000003 27.065 20.985 25-29 23.919999999999998 28.215 26.865 21.0 30-34 23.74 27.865000000000002 27.36 21.035 35-39 24.044999999999998 28.395 26.36 21.2 40-44 23.525 28.58 26.939999999999998 20.955 45-49 23.185 27.73 27.625 21.46 50-54 23.760589503233245 27.625444884455362 27.961301318361826 20.65266429394957 55-59 23.88651770022596 27.55711775043937 27.331157419030884 21.22520713030379 60-64 24.33274692133702 27.04699673284745 28.112591103292285 20.507665242523245 65-69 24.10033816181295 27.350729319133904 27.507192247514254 21.041740271538888 70-74 23.78787878787879 27.53030303030303 27.873737373737374 20.80808080808081 75-79 24.092125864942673 27.663013283499165 27.445830597504923 20.799030254053235 80-84 23.826751080293437 27.826349110642145 27.660536629484472 20.686363179579942 85-89 24.283203615365302 27.31609339693698 27.773035400451924 20.627667587245796 90-94 23.740898819984935 27.76299271905599 27.63745920160683 20.858649259352248 95-99 23.560130554858148 27.02485563645493 28.556364549334674 20.858649259352248 100-104 24.544313331659552 27.150389153904094 27.76299271905599 20.542304795380367 105-109 23.464725081596786 27.98393170976651 27.773035400451924 20.778307808184785 110-114 23.248807431584233 27.049962339944766 28.536279186542806 21.164951041928195 115-119 24.17273412001004 27.677629927190562 27.90861159929701 20.241024353502386 120-124 23.8061762490585 27.632437860908865 27.808184785337687 20.753201104694956 125-129 24.042179261862916 27.46171227717801 27.451669595782075 21.044438865177 130-134 23.620386643233743 27.627416520210897 27.893547577203115 20.858649259352248 135-139 23.63828928787573 27.783941900342953 27.758725035303613 20.81904377647771 140-144 23.98464336229541 27.97534855526369 27.66720549605981 20.372802586381088 145-149 24.375791339579642 27.571537097999492 27.885540643200812 20.167130919220057 150-151 24.86342269089061 26.29907254478465 28.598653284207852 20.238851480116885 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 2.0 17 3.0 18 2.5 19 1.0 20 1.0 21 2.5 22 3.0 23 2.0 24 1.5 25 1.0 26 4.0 27 6.0 28 5.0 29 7.5 30 9.5 31 12.5 32 21.0 33 30.5 34 38.5 35 48.0 36 63.5 37 87.0 38 113.0 39 153.5 40 183.5 41 192.0 42 248.5 43 280.0 44 264.5 45 281.0 46 287.0 47 285.5 48 263.5 49 223.5 50 186.5 51 149.0 52 134.5 53 109.5 54 78.0 55 57.0 56 39.5 57 31.0 58 22.5 59 18.5 60 17.0 61 8.0 62 4.0 63 5.5 64 2.5 65 1.5 66 1.5 67 0.0 68 1.0 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.1 3 0.1 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.255 55-59 0.42500000000000004 60-64 0.525 65-69 0.935 70-74 1.0 75-79 1.005 80-84 0.49 85-89 0.42500000000000004 90-94 0.42500000000000004 95-99 0.42500000000000004 100-104 0.42500000000000004 105-109 0.42500000000000004 110-114 0.42500000000000004 115-119 0.42500000000000004 120-124 0.42500000000000004 125-129 0.42500000000000004 130-134 0.42500000000000004 135-139 0.86 140-144 1.02 145-149 1.275 150-151 1.6125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.65 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.8374999999999999 0.0 0.0 0.0 0.0 126-127 0.9125 0.0 0.0 0.0 0.0 128-129 1.0750000000000002 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.4625 0.0 0.0 0.0 0.0 134-135 1.6 0.0 0.0 0.0 0.0 136-137 1.7125 0.0 0.0 0.0 0.0 138-139 2.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATGAC 10 0.006830828 145.0 5 GGAAAAT 20 3.5877043E-4 108.75 1 >>END_MODULE Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778992 spots for SRR7169112.sra Written 778992 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra Read 778990 spots for SRR7169112.sra Written 778990 spots for SRR7169112.sra SRR ids: ['SRR7169112.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qsasydo2 SRR7169112.sra spots: 15579802 blocks: [[1, 778990], [778991, 1557980], [1557981, 2336970], [2336971, 3115960], [3115961, 3894950], [3894951, 4673940], [4673941, 5452930], [5452931, 6231920], [6231921, 7010910], [7010911, 7789900], [7789901, 8568890], [8568891, 9347880], [9347881, 10126870], [10126871, 10905860], [10905861, 11684850], [11684851, 12463840], [12463841, 13242830], [13242831, 14021820], [14021821, 14800810], [14800811, 15579802]] SRR7169112 file size 5257783 SRR7169112 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169112 SRR7169112_1.fastq SRR7169112_2.fastq Input file: SRR7169112_1.fastq Paired file: SRR7169112_2.fastq trimmed: SRR7169112-trimmed-pair1.fastq, SRR7169112-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:37:16 2025 >> started Mon Feb 10 22:37:33 2025 >> done (16.872s) 15579802 read pairs processed; of these: 16461 ( 0.11%) short read pairs filtered out after trimming by size control 12209 ( 0.08%) empty read pairs filtered out after trimming by size control 15551132 (99.82%) read pairs available; of these: 7963795 (51.21%) trimmed read pairs available after processing 7587337 (48.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 5 0.00% 21 3 0.00% 22 11 0.00% 23 7 0.00% 24 7 0.00% 25 7 0.00% 26 9 0.00% 27 16 0.00% 28 12 0.00% 29 11 0.00% 30 14 0.00% 31 12 0.00% 32 13 0.00% 33 10 0.00% 34 10 0.00% 35 18 0.00% 36 16 0.00% 37 14 0.00% 38 19 0.00% 39 18 0.00% 40 22 0.00% 41 20 0.00% 42 32 0.00% 43 33 0.00% 44 24 0.00% 45 19 0.00% 46 39 0.00% 47 44 0.00% 48 37 0.00% 49 51 0.00% 50 51 0.00% 51 58 0.00% 52 62 0.00% 53 58 0.00% 54 51 0.00% 55 70 0.00% 56 86 0.00% 57 81 0.00% 58 112 0.00% 59 98 0.00% 60 107 0.00% 61 153 0.00% 62 152 0.00% 63 143 0.00% 64 166 0.00% 65 190 0.00% 66 237 0.00% 67 245 0.00% 68 274 0.00% 69 298 0.00% 70 316 0.00% 71 403 0.00% 72 435 0.00% 73 534 0.00% 74 674 0.00% 75 922 0.01% 76 702 0.00% 77 465 0.00% 78 716 0.00% 79 1252 0.01% 80 1892 0.01% 81 792 0.01% 82 907 0.01% 83 1188 0.01% 84 1939 0.01% 85 2689 0.02% 86 3219 0.02% 87 3133 0.02% 88 2780 0.02% 89 3058 0.02% 90 3278 0.02% 91 3398 0.02% 92 3667 0.02% 93 3883 0.02% 94 4039 0.03% 95 4438 0.03% 96 4793 0.03% 97 5386 0.03% 98 6232 0.04% 99 7697 0.05% 100 8688 0.06% 101 6306 0.04% 102 6110 0.04% 103 6703 0.04% 104 7168 0.05% 105 7581 0.05% 106 8440 0.05% 107 8900 0.06% 108 9670 0.06% 109 10195 0.07% 110 10417 0.07% 111 11187 0.07% 112 11794 0.08% 113 12658 0.08% 114 13103 0.08% 115 14008 0.09% 116 15096 0.10% 117 15645 0.10% 118 16721 0.11% 119 17298 0.11% 120 18330 0.12% 121 19347 0.12% 122 20518 0.13% 123 21821 0.14% 124 23547 0.15% 125 25336 0.16% 126 26444 0.17% 127 28411 0.18% 128 30070 0.19% 129 32043 0.21% 130 34285 0.22% 131 36427 0.23% 132 39394 0.25% 133 42232 0.27% 134 45596 0.29% 135 50184 0.32% 136 55192 0.35% 137 60294 0.39% 138 66591 0.43% 139 74577 0.48% 140 82157 0.53% 141 91949 0.59% 142 106138 0.68% 143 124302 0.80% 144 150550 0.97% 145 187234 1.20% 146 239963 1.54% 147 336256 2.16% 148 535068 3.44% 149 1015818 6.53% 150 4047945 26.03% 151 7587337 48.79% 15551132 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=36 prefix-density=0.27 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=39 fanout-score=229.48 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=18.7 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=42 prefix-density=0.28 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=46.72 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=10.7 sequence=TCAAGGAAGCTTTCAG SRR7169112 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:38:17 Started mapping on | Feb 10 22:38:17 Finished on | Feb 10 22:40:43 Mapping speed, Million of reads per hour | 383.45 Number of input reads | 15551132 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14268849 Uniquely mapped reads % | 91.75% Average mapped length | 295.87 Number of splices: Total | 12487494 Number of splices: Annotated (sjdb) | 12267968 Number of splices: GT/AG | 12307045 Number of splices: GC/AG | 139148 Number of splices: AT/AC | 11173 Number of splices: Non-canonical | 30128 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 267420 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 20018 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.36% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1031243 1031243 1031243 N_multimapping 267420 267420 267420 N_noFeature 306361 14073650 370915 N_ambiguous 190540 878 59348 UnstrandedReadsAssigned:13771948 PositiveStrandReadsAssigned:194321 NegativeStrandReadsAssigned:13838586 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169112 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169112-trimmed-pair1.fastq SRR7169112-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,551,132 reads, 13,776,645 reads pseudoaligned [quant] estimated average fragment length: 260.452 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,078 rounds 52401 SRR7169112.ke.tsv 34699 SRR7169112.se.tsv 87100 total ==> SRR7169112.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.55 277 9.32292 Potri.005G024800.1.v4.1 1035 775.548 59 4.50267 Potri.004G059700.1.v4.1 961 701.569 1 0.0843638 Potri.007G009000.2.v4.1 1416 1156.55 0 0 Potri.003G141000.2.v4.1 2943 2683.55 199 4.38905 Potri.016G087400.1.v4.1 270 62.9055 1464 1377.46 Potri.015G069301.1.v4.1 564 308.396 0 0 Potri.010G195200.1.v4.1 1773 1513.55 23 0.899411 Potri.012G127500.1.v4.1 977 717.553 4919 405.741 ==> SRR7169112.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1354 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 261 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169112 completed mapping pipeline successfully