Starting /dee2/code/volunteer_pipeline.sh SRR7169113 current disk space = 3057016139776 free memory = 1417087140 SRR7169113 SRAfilesize d33e1d75022c988748b3062ca929a4b5 SRR7169113.sra SRR7169113.sra file validated SRR7169113 is paired end SRR7169113 is conventional basespace SRR7169113 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169113_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.894 34.0 33.0 34.0 33.0 34.0 2 33.312 34.0 33.0 34.0 33.0 34.0 3 33.341 34.0 33.0 34.0 33.0 34.0 4 33.43925 34.0 34.0 34.0 33.0 34.0 5 33.49025 34.0 34.0 34.0 33.0 34.0 6 36.853 38.0 37.0 38.0 35.0 38.0 7 37.2475 38.0 38.0 38.0 36.0 38.0 8 37.38 38.0 38.0 38.0 37.0 38.0 9 37.39975 38.0 38.0 38.0 37.0 38.0 10-14 37.440200000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.36875 38.0 38.0 38.0 37.0 38.0 20-24 37.3014 38.0 38.0 38.0 37.0 38.0 25-29 37.27655 38.0 38.0 38.0 36.8 38.0 30-34 37.2308 38.0 38.0 38.0 36.6 38.0 35-39 37.09555 38.0 38.0 38.0 36.4 38.0 40-44 36.76265 38.0 38.0 38.0 34.6 38.0 45-49 36.63525 38.0 38.0 38.0 34.0 38.0 50-54 36.50915 38.0 38.0 38.0 34.0 38.0 55-59 36.390100000000004 38.0 37.2 38.0 33.6 38.0 60-64 36.23465 38.0 37.0 38.0 33.4 38.0 65-69 36.140499999999996 38.0 37.0 38.0 33.0 38.0 70-74 36.06235 38.0 37.0 38.0 33.0 38.0 75-79 35.9269 38.0 37.0 38.0 31.4 38.0 80-84 35.7245 38.0 36.4 38.0 31.0 38.0 85-89 35.49595000000001 38.0 36.0 38.0 29.4 38.0 90-94 35.30585 38.0 36.0 38.0 29.0 38.0 95-99 35.262 38.0 36.0 38.0 29.0 38.0 100-104 35.017250000000004 38.0 35.8 38.0 28.2 38.0 105-109 34.830949999999994 38.0 35.2 38.0 27.4 38.0 110-114 34.421350000000004 38.0 34.6 38.0 25.4 38.0 115-119 34.1168 38.0 34.2 38.0 23.6 38.0 120-124 33.6723 38.0 34.0 38.0 21.8 38.0 125-129 33.3776 38.0 34.0 38.0 17.4 38.0 130-134 32.9374 38.0 33.2 38.0 15.0 38.0 135-139 32.397949999999994 36.8 32.6 38.0 14.6 38.0 140-144 31.765650000000004 36.0 31.0 38.0 14.0 38.0 145-149 30.812850000000005 36.0 31.0 38.0 8.8 38.0 150-151 26.43575 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 2.0 13 4.0 14 2.0 15 3.0 16 5.0 17 6.0 18 8.0 19 12.0 20 7.0 21 9.0 22 11.0 23 17.0 24 29.0 25 22.0 26 33.0 27 37.0 28 52.0 29 53.0 30 66.0 31 100.0 32 128.0 33 173.0 34 288.0 35 476.0 36 1049.0 37 1405.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.89438943894389 14.445290682914443 9.85021579080985 31.81010408733181 2 25.424999999999997 14.374999999999998 30.0 30.2 3 19.2 18.975 27.950000000000003 33.875 4 22.400000000000002 27.450000000000003 23.775 26.375 5 22.35 31.85 23.125 22.675 6 20.175 35.4 23.95 20.474999999999998 7 14.75 29.099999999999998 38.45 17.7 8 16.075 28.375 30.575000000000003 24.975 9 17.05 26.525 33.85 22.575 10-14 19.325 31.04 26.715 22.919999999999998 15-19 19.185 30.06 27.325 23.43 20-24 19.395 28.845 28.03 23.73 25-29 19.535 30.470000000000002 26.465 23.53 30-34 19.7 30.325000000000003 26.525 23.45 35-39 19.96 29.775000000000002 27.07 23.195 40-44 19.56 29.565 27.305 23.57 45-49 19.49 29.13 27.474999999999998 23.905 50-54 19.365 29.215000000000003 27.55 23.87 55-59 19.855 29.235 27.495000000000005 23.415 60-64 19.71 29.67 26.900000000000002 23.72 65-69 19.645000000000003 28.78 27.125 24.45 70-74 19.7 28.925 27.765 23.61 75-79 19.665 29.375 26.924999999999997 24.035 80-84 19.885 29.110000000000003 26.900000000000002 24.104999999999997 85-89 19.8 28.970000000000002 26.88 24.349999999999998 90-94 20.294999999999998 28.58 26.640000000000004 24.485 95-99 20.7 28.794999999999998 26.939999999999998 23.565 100-104 20.375 28.310000000000002 27.105 24.21 105-109 20.205000000000002 28.744999999999997 27.425 23.625 110-114 20.244999999999997 28.64 27.05 24.065 115-119 20.44 28.689999999999998 26.97 23.9 120-124 20.51 27.839999999999996 27.66 23.990000000000002 125-129 20.985 27.875 27.134999999999998 24.005000000000003 130-134 20.28 28.084999999999997 27.37 24.265 135-139 20.775 28.165000000000003 26.790000000000003 24.27 140-144 21.01 27.439999999999998 27.560000000000002 23.990000000000002 145-149 21.18 28.249999999999996 26.805 23.765 150-151 21.5375 27.3375 26.987499999999997 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 2.0 20 2.0 21 1.5 22 2.0 23 2.5 24 2.0 25 2.0 26 3.5 27 10.0 28 17.0 29 20.0 30 26.5 31 35.0 32 49.5 33 57.0 34 58.0 35 68.5 36 93.5 37 113.0 38 132.0 39 161.0 40 183.5 41 208.5 42 233.0 43 250.5 44 250.5 45 250.0 46 252.5 47 246.5 48 225.5 49 200.5 50 172.0 51 132.5 52 114.0 53 107.0 54 83.0 55 57.5 56 37.0 57 28.0 58 25.0 59 18.5 60 14.5 61 10.0 62 9.5 63 6.5 64 3.5 65 5.0 66 3.5 67 0.5 68 1.0 69 2.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.07500000000000001 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.725 0.0 0.0 0.0 0.0 130-131 0.7875 0.0 0.0 0.0 0.0 132-133 0.95 0.0 0.0 0.0 0.0 134-135 1.1125 0.0 0.0 0.0 0.0 136-137 1.3125 0.0 0.0 0.0 0.0 138-139 1.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 190 0.0021833153 7.630263 130-134 >>END_MODULE SRR7169113 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169113_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72025 33.0 33.0 34.0 32.0 34.0 2 32.75925 34.0 33.0 34.0 32.0 34.0 3 32.81 34.0 33.0 34.0 32.0 34.0 4 32.7225 34.0 33.0 34.0 32.0 34.0 5 32.689 34.0 33.0 34.0 32.0 34.0 6 36.80475 38.0 38.0 38.0 36.0 38.0 7 36.8445 38.0 38.0 38.0 36.0 38.0 8 36.7935 38.0 38.0 38.0 36.0 38.0 9 36.83 38.0 38.0 38.0 36.0 38.0 10-14 36.849149999999995 38.0 38.0 38.0 36.6 38.0 15-19 36.76215 38.0 38.0 38.0 36.2 38.0 20-24 36.74490000000001 38.0 38.0 38.0 36.0 38.0 25-29 36.756350000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.7836 38.0 38.0 38.0 36.0 38.0 35-39 36.67405 38.0 38.0 38.0 36.0 38.0 40-44 36.620999999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.59875 38.0 38.0 38.0 36.0 38.0 50-54 36.6124 38.0 38.0 38.0 36.0 38.0 55-59 36.5403 38.0 38.0 38.0 35.4 38.0 60-64 36.5247 38.0 38.0 38.0 35.4 38.0 65-69 36.360699999999994 38.0 38.0 38.0 35.0 38.0 70-74 36.3112 38.0 38.0 38.0 34.8 38.0 75-79 36.2399 38.0 38.0 38.0 34.4 38.0 80-84 36.30575 38.0 38.0 38.0 34.2 38.0 85-89 36.2298 38.0 38.0 38.0 34.0 38.0 90-94 36.09585 38.0 38.0 38.0 34.0 38.0 95-99 35.85510000000001 38.0 38.0 38.0 33.2 38.0 100-104 35.70605 38.0 38.0 38.0 32.4 38.0 105-109 35.61495 38.0 38.0 38.0 31.4 38.0 110-114 35.4424 38.0 37.6 38.0 31.0 38.0 115-119 35.2925 38.0 37.0 38.0 31.0 38.0 120-124 35.034000000000006 38.0 37.0 38.0 28.4 38.0 125-129 34.9108 38.0 36.6 38.0 28.0 38.0 130-134 34.58410000000001 38.0 36.0 38.0 26.4 38.0 135-139 34.14235 38.0 35.8 38.0 22.8 38.0 140-144 33.82905 38.0 35.0 38.0 21.8 38.0 145-149 33.03425 38.0 35.0 38.0 11.4 38.0 150-151 29.483125 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 5.0 4 4.0 5 4.0 6 3.0 7 2.0 8 4.0 9 2.0 10 3.0 11 3.0 12 2.0 13 9.0 14 4.0 15 6.0 16 8.0 17 9.0 18 10.0 19 7.0 20 3.0 21 12.0 22 11.0 23 13.0 24 17.0 25 33.0 26 26.0 27 26.0 28 27.0 29 33.0 30 44.0 31 56.0 32 86.0 33 90.0 34 108.0 35 196.0 36 420.0 37 2697.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.300000000000004 23.225 13.925 22.55 2 29.849999999999998 26.174999999999997 25.924999999999997 18.05 3 21.9 29.575000000000003 29.15 19.375 4 24.45 33.0 22.625 19.925 5 25.224999999999998 35.0 21.425 18.35 6 22.725 36.35 22.775000000000002 18.15 7 20.625 22.875 36.449999999999996 20.05 8 23.5 25.75 25.825 24.925 9 21.775 26.075 28.4 23.75 10-14 23.955000000000002 28.910000000000004 26.064999999999998 21.07 15-19 23.905 27.825 26.97 21.3 20-24 24.065 28.294999999999998 27.0 20.64 25-29 23.78 27.955000000000002 26.945000000000004 21.32 30-34 23.73 27.735 27.045 21.490000000000002 35-39 23.990000000000002 28.605000000000004 26.375 21.029999999999998 40-44 24.37 27.794999999999998 26.950000000000003 20.885 45-49 23.71 28.134999999999998 27.355 20.8 50-54 24.03 27.575 27.32 21.075 55-59 24.39 27.37 27.26 20.979999999999997 60-64 24.015 28.02 27.185 20.78 65-69 23.80235766240281 28.041133684474538 27.203411086029593 20.953097567093053 70-74 24.661178596526454 27.221162533882143 27.37676940066258 20.74088946892882 75-79 24.549696452762028 27.529978425568206 27.213887913300887 20.70643720836887 80-84 23.893584037605642 27.154073110966642 27.604140621093165 21.34820223033455 85-89 24.19 27.54 27.584999999999997 20.685000000000002 90-94 23.715 27.58 27.38 21.325 95-99 23.79 27.750000000000004 27.825 20.635 100-104 24.13 27.36 28.105000000000004 20.405 105-109 23.665 27.265 28.560000000000002 20.51 110-114 24.145 27.33 27.505000000000003 21.02 115-119 24.495 27.22 28.03 20.255000000000003 120-124 23.925 27.115000000000002 28.53 20.43 125-129 24.169999999999998 27.735 27.54 20.555 130-134 24.185000000000002 26.950000000000003 28.060000000000002 20.805 135-139 24.474789915966387 27.601040416166466 27.831132452981194 20.093037214885953 140-144 24.10978113887915 27.315069865277707 28.171482946862326 20.403666048980817 145-149 24.053496907838504 27.618281462114737 28.09593242495852 20.23228920508824 150-151 23.742911153119092 27.687460617517328 28.48141146817895 20.088216761184626 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 2.0 26 3.0 27 2.5 28 4.0 29 6.0 30 5.5 31 7.0 32 12.5 33 22.5 34 36.5 35 48.5 36 63.0 37 73.5 38 95.5 39 140.5 40 180.0 41 213.0 42 244.0 43 280.5 44 290.0 45 280.5 46 281.5 47 269.0 48 257.5 49 236.5 50 200.5 51 168.5 52 128.5 53 106.0 54 87.5 55 65.0 56 48.0 57 32.0 58 30.5 59 21.5 60 11.5 61 6.5 62 4.5 63 4.5 64 4.0 65 4.5 66 4.0 67 3.0 68 2.0 69 2.5 70 1.5 71 0.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.325 70-74 0.38999999999999996 75-79 0.345 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.04 140-144 0.165 145-149 0.555 150-151 0.8125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.07500000000000001 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.7625 0.0 0.0 0.0 0.0 130-131 0.8125 0.0 0.0 0.0 0.0 132-133 0.9875 0.0 0.0 0.0 0.0 134-135 1.1875 0.0 0.0 0.0 0.0 136-137 1.4 0.0 0.0 0.0 0.0 138-139 1.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGCTGT 10 0.006830828 145.0 4 >>END_MODULE Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882346 spots for SRR7169113.sra Written 882346 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra Read 882339 spots for SRR7169113.sra Written 882339 spots for SRR7169113.sra SRR ids: ['SRR7169113.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7a9gdjr0 SRR7169113.sra spots: 17646787 blocks: [[1, 882339], [882340, 1764678], [1764679, 2647017], [2647018, 3529356], [3529357, 4411695], [4411696, 5294034], [5294035, 6176373], [6176374, 7058712], [7058713, 7941051], [7941052, 8823390], [8823391, 9705729], [9705730, 10588068], [10588069, 11470407], [11470408, 12352746], [12352747, 13235085], [13235086, 14117424], [14117425, 14999763], [14999764, 15882102], [15882103, 16764441], [16764442, 17646787]] SRR7169113 file size 5958216 SRR7169113 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169113 SRR7169113_1.fastq SRR7169113_2.fastq Input file: SRR7169113_1.fastq Paired file: SRR7169113_2.fastq trimmed: SRR7169113-trimmed-pair1.fastq, SRR7169113-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:56:33 2025 >> started Mon Feb 10 21:57:04 2025 >> done (31.285s) 17646787 read pairs processed; of these: 33904 ( 0.19%) short read pairs filtered out after trimming by size control 21757 ( 0.12%) empty read pairs filtered out after trimming by size control 17591126 (99.68%) read pairs available; of these: 8700012 (49.46%) trimmed read pairs available after processing 8891114 (50.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 9 0.00% 21 6 0.00% 22 4 0.00% 23 6 0.00% 24 9 0.00% 25 12 0.00% 26 10 0.00% 27 25 0.00% 28 8 0.00% 29 13 0.00% 30 24 0.00% 31 8 0.00% 32 14 0.00% 33 16 0.00% 34 16 0.00% 35 22 0.00% 36 18 0.00% 37 19 0.00% 38 24 0.00% 39 20 0.00% 40 28 0.00% 41 41 0.00% 42 30 0.00% 43 29 0.00% 44 31 0.00% 45 41 0.00% 46 45 0.00% 47 41 0.00% 48 46 0.00% 49 51 0.00% 50 55 0.00% 51 55 0.00% 52 65 0.00% 53 72 0.00% 54 84 0.00% 55 103 0.00% 56 96 0.00% 57 101 0.00% 58 105 0.00% 59 108 0.00% 60 121 0.00% 61 136 0.00% 62 142 0.00% 63 165 0.00% 64 208 0.00% 65 211 0.00% 66 247 0.00% 67 263 0.00% 68 243 0.00% 69 322 0.00% 70 395 0.00% 71 399 0.00% 72 452 0.00% 73 430 0.00% 74 493 0.00% 75 543 0.00% 76 619 0.00% 77 664 0.00% 78 769 0.00% 79 854 0.00% 80 960 0.01% 81 1112 0.01% 82 1227 0.01% 83 1523 0.01% 84 2831 0.02% 85 3628 0.02% 86 3800 0.02% 87 3879 0.02% 88 4069 0.02% 89 4032 0.02% 90 4107 0.02% 91 4328 0.02% 92 4590 0.03% 93 4809 0.03% 94 5097 0.03% 95 5346 0.03% 96 5715 0.03% 97 6108 0.03% 98 6478 0.04% 99 6891 0.04% 100 7270 0.04% 101 7497 0.04% 102 8061 0.05% 103 8648 0.05% 104 9397 0.05% 105 9696 0.06% 106 10509 0.06% 107 10974 0.06% 108 11725 0.07% 109 12389 0.07% 110 12958 0.07% 111 13835 0.08% 112 14781 0.08% 113 15839 0.09% 114 16328 0.09% 115 17559 0.10% 116 18742 0.11% 117 19792 0.11% 118 20522 0.12% 119 21848 0.12% 120 22973 0.13% 121 24347 0.14% 122 25706 0.15% 123 27892 0.16% 124 29448 0.17% 125 31226 0.18% 126 33627 0.19% 127 35615 0.20% 128 37695 0.21% 129 40196 0.23% 130 43320 0.25% 131 46493 0.26% 132 49527 0.28% 133 53618 0.30% 134 57488 0.33% 135 61922 0.35% 136 68073 0.39% 137 73413 0.42% 138 82050 0.47% 139 90604 0.52% 140 100022 0.57% 141 109046 0.62% 142 123683 0.70% 143 141110 0.80% 144 166080 0.94% 145 202619 1.15% 146 258755 1.47% 147 355079 2.02% 148 554146 3.15% 149 1069579 6.08% 150 4326559 24.60% 151 8891114 50.54% 17591126 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=39 prefix-density=0.24 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=314.56 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=19.1 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=44 prefix-density=0.25 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=153.17 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=14.1 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169113 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:58:05 Started mapping on | Feb 10 21:58:06 Finished on | Feb 10 22:01:11 Mapping speed, Million of reads per hour | 342.31 Number of input reads | 17591126 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16328584 Uniquely mapped reads % | 92.82% Average mapped length | 295.60 Number of splices: Total | 14271421 Number of splices: Annotated (sjdb) | 14025228 Number of splices: GT/AG | 14062815 Number of splices: GC/AG | 162845 Number of splices: AT/AC | 12812 Number of splices: Non-canonical | 32949 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 342682 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 30459 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.01% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 949941 949941 949941 N_multimapping 342682 342682 342682 N_noFeature 314099 16122498 394448 N_ambiguous 191008 786 64849 UnstrandedReadsAssigned:15823477 PositiveStrandReadsAssigned:205300 NegativeStrandReadsAssigned:15869287 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169113 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169113-trimmed-pair1.fastq SRR7169113-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,591,126 reads, 15,800,389 reads pseudoaligned [quant] estimated average fragment length: 257.768 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR7169113.ke.tsv 34699 SRR7169113.se.tsv 87100 total ==> SRR7169113.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.23 268 7.21167 Potri.005G024800.1.v4.1 1035 778.232 89 5.41999 Potri.004G059700.1.v4.1 961 704.248 6 0.403779 Potri.007G009000.2.v4.1 1416 1159.23 0 0 Potri.003G141000.2.v4.1 2943 2686.23 221.031 3.89966 Potri.016G087400.1.v4.1 270 63.7207 2043.18 1519.65 Potri.015G069301.1.v4.1 564 310.759 0 0 Potri.010G195200.1.v4.1 1773 1516.23 17 0.531375 Potri.012G127500.1.v4.1 977 720.232 7793 512.802 ==> SRR7169113.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1285 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 346 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169113 completed mapping pipeline successfully