Starting /dee2/code/volunteer_pipeline.sh SRR7169114 current disk space = 3057527103488 free memory = 1484230888 SRR7169114 SRAfilesize 46f15847a40d25a5a3df80cded6994be SRR7169114.sra SRR7169114.sra file validated SRR7169114 is paired end SRR7169114 is conventional basespace SRR7169114 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169114_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93775 34.0 33.0 34.0 33.0 34.0 2 33.3745 34.0 33.0 34.0 33.0 34.0 3 33.4455 34.0 34.0 34.0 33.0 34.0 4 33.40625 34.0 34.0 34.0 33.0 34.0 5 33.40525 34.0 34.0 34.0 33.0 34.0 6 36.91425 38.0 37.0 38.0 35.0 38.0 7 37.34425 38.0 38.0 38.0 37.0 38.0 8 37.50075 38.0 38.0 38.0 37.0 38.0 9 37.5195 38.0 38.0 38.0 37.0 38.0 10-14 37.44135 38.0 38.0 38.0 37.2 38.0 15-19 37.39575 38.0 38.0 38.0 37.0 38.0 20-24 37.363 38.0 38.0 38.0 37.0 38.0 25-29 37.36155 38.0 38.0 38.0 37.0 38.0 30-34 37.31570000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.2166 38.0 38.0 38.0 36.6 38.0 40-44 36.9371 38.0 38.0 38.0 35.8 38.0 45-49 36.8393 38.0 38.0 38.0 35.2 38.0 50-54 36.73895 38.0 38.0 38.0 34.4 38.0 55-59 36.6258 38.0 38.0 38.0 34.2 38.0 60-64 36.588100000000004 38.0 38.0 38.0 34.0 38.0 65-69 36.4902 38.0 38.0 38.0 34.0 38.0 70-74 36.4173 38.0 38.0 38.0 33.8 38.0 75-79 36.2522 38.0 37.2 38.0 33.6 38.0 80-84 36.11495 38.0 37.0 38.0 33.0 38.0 85-89 35.95285 38.0 37.0 38.0 31.8 38.0 90-94 35.823949999999996 38.0 37.0 38.0 31.4 38.0 95-99 35.61325 38.0 36.8 38.0 30.4 38.0 100-104 35.355199999999996 38.0 36.2 38.0 29.4 38.0 105-109 35.202799999999996 38.0 36.0 38.0 29.0 38.0 110-114 35.0035 38.0 35.8 38.0 28.0 38.0 115-119 34.738099999999996 38.0 35.0 38.0 27.2 38.0 120-124 34.53490000000001 38.0 35.0 38.0 26.0 38.0 125-129 34.141949999999994 38.0 34.6 38.0 24.2 38.0 130-134 33.7975 38.0 34.0 38.0 22.6 38.0 135-139 33.282349999999994 38.0 33.8 38.0 15.0 38.0 140-144 32.79955 38.0 33.6 38.0 14.8 38.0 145-149 31.8913 37.8 33.0 38.0 11.4 38.0 150-151 27.937625 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 2.0 11 0.0 12 2.0 13 0.0 14 1.0 15 3.0 16 3.0 17 3.0 18 9.0 19 9.0 20 9.0 21 10.0 22 8.0 23 10.0 24 20.0 25 26.0 26 31.0 27 38.0 28 51.0 29 58.0 30 60.0 31 61.0 32 105.0 33 142.0 34 187.0 35 391.0 36 847.0 37 1913.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.43346007604563 15.05703422053232 9.581749049429659 32.9277566539924 2 25.825 14.149999999999999 30.425 29.599999999999998 3 19.775000000000002 18.45 26.075 35.699999999999996 4 23.45 24.55 24.8 27.200000000000003 5 22.95 29.65 25.2 22.2 6 21.325 34.449999999999996 24.15 20.075000000000003 7 15.7 29.825000000000003 36.925000000000004 17.549999999999997 8 17.9 28.225 29.5 24.375 9 15.925 25.35 35.525 23.200000000000003 10-14 19.82 30.404999999999998 27.275 22.5 15-19 19.64 29.220000000000002 27.265 23.875 20-24 19.84 29.235 27.325 23.599999999999998 25-29 20.064999999999998 29.735 26.805 23.395 30-34 19.755 29.715000000000003 27.04 23.49 35-39 19.99 29.935000000000002 26.865 23.21 40-44 19.655 29.235 27.26 23.849999999999998 45-49 19.965 29.235 26.8 24.0 50-54 19.89 29.265 27.185 23.66 55-59 20.055 28.439999999999998 27.105 24.4 60-64 19.97 29.275000000000002 27.150000000000002 23.605 65-69 19.845 28.67 27.55 23.935000000000002 70-74 19.975 28.715000000000003 27.375 23.935000000000002 75-79 20.115 28.945 26.845000000000002 24.095 80-84 20.599999999999998 28.83 27.375 23.195 85-89 20.525 28.88 26.6 23.995 90-94 20.085 28.185 27.55 24.18 95-99 20.75 28.02 27.495000000000005 23.735 100-104 20.36 28.294999999999998 26.985 24.36 105-109 20.445 28.62 27.555000000000003 23.380000000000003 110-114 20.669999999999998 28.189999999999998 27.555000000000003 23.585 115-119 20.46 28.315 27.195000000000004 24.03 120-124 20.7 28.375 26.96 23.965 125-129 20.78 27.955000000000002 27.49 23.775 130-134 20.985 28.115000000000002 27.125 23.775 135-139 20.585 28.29 26.825 24.3 140-144 20.805 27.860000000000003 27.33 24.005000000000003 145-149 20.87 28.449999999999996 26.834999999999997 23.845 150-151 20.1 27.200000000000003 27.750000000000004 24.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 1.5 21 1.0 22 2.5 23 3.5 24 3.5 25 5.0 26 5.0 27 6.5 28 11.5 29 15.5 30 20.5 31 30.5 32 38.0 33 46.0 34 58.5 35 72.0 36 83.5 37 103.5 38 130.5 39 158.0 40 189.0 41 199.0 42 219.5 43 258.5 44 255.5 45 247.5 46 259.0 47 246.5 48 233.0 49 212.5 50 178.5 51 154.5 52 130.0 53 110.0 54 83.0 55 53.0 56 44.0 57 32.5 58 20.0 59 18.0 60 13.0 61 7.5 62 5.0 63 5.5 64 6.0 65 6.5 66 3.5 67 1.5 68 2.5 69 2.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0125 0.0 0.0 0.0 104-105 0.15 0.025 0.0 0.0 0.0 106-107 0.2625 0.025 0.0 0.0 0.0 108-109 0.35 0.025 0.0 0.0 0.0 110-111 0.375 0.025 0.0 0.0 0.0 112-113 0.3875 0.025 0.0 0.0 0.0 114-115 0.4375 0.025 0.0 0.0 0.0 116-117 0.5125 0.025 0.0 0.0 0.0 118-119 0.575 0.025 0.0 0.0 0.0 120-121 0.65 0.025 0.0 0.0 0.0 122-123 0.725 0.025 0.0 0.0 0.0 124-125 0.8625 0.025 0.0 0.0 0.0 126-127 0.9125 0.025 0.0 0.0 0.0 128-129 0.9874999999999999 0.025 0.0 0.0 0.0 130-131 1.0750000000000002 0.025 0.0 0.0 0.0 132-133 1.1375 0.025 0.0 0.0 0.0 134-135 1.25 0.025 0.0 0.0 0.0 136-137 1.3375 0.025 0.0 0.0 0.0 138-139 1.4625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATAAT 10 0.0068343505 144.975 9 ACAATAA 10 0.0068343505 144.975 8 >>END_MODULE SRR7169114 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169114_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6985 33.0 33.0 34.0 32.0 34.0 2 32.72425 33.0 33.0 34.0 32.0 34.0 3 32.81275 34.0 33.0 34.0 32.0 34.0 4 32.76 34.0 33.0 34.0 32.0 34.0 5 32.7515 34.0 33.0 34.0 32.0 34.0 6 36.8595 38.0 38.0 38.0 36.0 38.0 7 36.93975 38.0 38.0 38.0 37.0 38.0 8 36.974 38.0 38.0 38.0 37.0 38.0 9 36.8515 38.0 38.0 38.0 36.0 38.0 10-14 36.804 38.0 38.0 38.0 36.0 38.0 15-19 36.74395 38.0 38.0 38.0 36.0 38.0 20-24 36.7731 38.0 38.0 38.0 36.0 38.0 25-29 36.717 38.0 38.0 38.0 36.0 38.0 30-34 36.709649999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.653499999999994 38.0 38.0 38.0 36.0 38.0 40-44 36.60925 38.0 38.0 38.0 35.8 38.0 45-49 36.62325 38.0 38.0 38.0 35.8 38.0 50-54 36.5826 38.0 38.0 38.0 35.6 38.0 55-59 36.643299999999996 38.0 38.0 38.0 35.6 38.0 60-64 36.525400000000005 38.0 38.0 38.0 35.2 38.0 65-69 36.45805 38.0 38.0 38.0 34.8 38.0 70-74 36.43735 38.0 38.0 38.0 35.0 38.0 75-79 36.31395 38.0 38.0 38.0 34.2 38.0 80-84 36.247249999999994 38.0 38.0 38.0 34.2 38.0 85-89 36.138850000000005 38.0 38.0 38.0 33.8 38.0 90-94 36.0868 38.0 38.0 38.0 33.8 38.0 95-99 35.88185 38.0 38.0 38.0 33.0 38.0 100-104 35.696299999999994 38.0 38.0 38.0 32.0 38.0 105-109 35.56855 38.0 37.6 38.0 31.4 38.0 110-114 35.471349999999994 38.0 37.2 38.0 30.8 38.0 115-119 35.2263 38.0 37.0 38.0 29.2 38.0 120-124 35.2158 38.0 37.0 38.0 29.2 38.0 125-129 34.8515 38.0 36.2 38.0 27.6 38.0 130-134 34.62875 38.0 36.0 38.0 27.0 38.0 135-139 34.359 38.0 35.8 38.0 24.0 38.0 140-144 33.97165 38.0 35.2 38.0 22.2 38.0 145-149 33.119099999999996 38.0 35.0 38.0 13.8 38.0 150-151 29.9 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 16.0 4 0.0 5 2.0 6 4.0 7 1.0 8 1.0 9 2.0 10 2.0 11 3.0 12 2.0 13 3.0 14 4.0 15 4.0 16 2.0 17 10.0 18 9.0 19 11.0 20 7.0 21 18.0 22 9.0 23 13.0 24 13.0 25 19.0 26 30.0 27 35.0 28 37.0 29 41.0 30 48.0 31 62.0 32 73.0 33 77.0 34 135.0 35 209.0 36 437.0 37 2650.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.275 23.125 13.750000000000002 24.85 2 31.025000000000002 24.85 26.174999999999997 17.95 3 22.125 27.425 30.4 20.05 4 22.975 33.775 23.275000000000002 19.975 5 24.224999999999998 35.075 22.1 18.6 6 22.775000000000002 36.075 21.875 19.275000000000002 7 21.075 22.75 37.025000000000006 19.15 8 23.474999999999998 25.95 26.35 24.224999999999998 9 21.9 25.424999999999997 29.799999999999997 22.875 10-14 24.085 28.34 26.419999999999998 21.154999999999998 15-19 23.455000000000002 28.07 26.540000000000003 21.935 20-24 24.005000000000003 28.025 27.155 20.815 25-29 23.549999999999997 28.4 26.884999999999998 21.165 30-34 23.78 28.29 26.474999999999998 21.455 35-39 23.5 28.4 26.740000000000002 21.36 40-44 23.71 28.24 27.075 20.974999999999998 45-49 23.880000000000003 27.665 27.445000000000004 21.01 50-54 23.41 28.34 27.245 21.005 55-59 23.845 28.110000000000003 26.939999999999998 21.105 60-64 24.215 27.365000000000002 27.634999999999998 20.785 65-69 23.582074622386717 27.47324197259178 27.38821646493948 21.556466940082025 70-74 23.666833416708354 27.213606803401703 28.424212106053027 20.69534767383692 75-79 23.737045010764533 27.02648575577029 27.737445551494517 21.499023681970662 80-84 23.599999999999998 27.415 27.939999999999998 21.044999999999998 85-89 23.995 27.400000000000002 28.000000000000004 20.605 90-94 24.195 27.295 27.994999999999997 20.515 95-99 23.755000000000003 28.375 27.24 20.630000000000003 100-104 24.295 27.325 27.62 20.76 105-109 23.86 27.455000000000002 27.825 20.86 110-114 24.15 28.1 27.245 20.505000000000003 115-119 24.395 27.58 27.500000000000004 20.525 120-124 24.34 27.675 27.815 20.169999999999998 125-129 23.915 27.73 27.955000000000002 20.4 130-134 23.974999999999998 27.794999999999998 27.91 20.32 135-139 23.75 27.694999999999997 28.060000000000002 20.495 140-144 24.615000000000002 27.189999999999998 27.810000000000002 20.385 145-149 24.155557782900672 27.964317931241855 27.56339581036384 20.316728475493637 150-151 24.805129494593913 26.87955745536837 27.84762383706311 20.467689212974605 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.0 26 1.5 27 2.0 28 4.0 29 7.5 30 7.5 31 8.0 32 13.0 33 25.5 34 30.5 35 37.0 36 60.0 37 92.5 38 120.0 39 145.0 40 180.5 41 219.0 42 255.5 43 264.0 44 277.0 45 291.0 46 292.5 47 280.0 48 255.0 49 232.5 50 189.5 51 153.0 52 126.0 53 114.5 54 95.0 55 59.5 56 40.0 57 32.5 58 26.0 59 16.0 60 12.0 61 9.5 62 6.0 63 3.5 64 1.5 65 1.5 66 1.0 67 1.5 68 3.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.03 70-74 0.05 75-79 0.135 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.22999999999999998 150-151 0.575 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.85 0.0 0.0 0.0 0.0 126-127 0.9125 0.0 0.0 0.0 0.0 128-129 0.975 0.0 0.0 0.0 0.0 130-131 1.0499999999999998 0.0 0.0 0.0 0.0 132-133 1.1125 0.0 0.0 0.0 0.0 134-135 1.225 0.0 0.0 0.0 0.0 136-137 1.3125 0.0 0.0 0.0 0.0 138-139 1.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786176 spots for SRR7169114.sra Written 786176 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra Read 786169 spots for SRR7169114.sra Written 786169 spots for SRR7169114.sra SRR ids: ['SRR7169114.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w60rorj4 SRR7169114.sra spots: 15723387 blocks: [[1, 786169], [786170, 1572338], [1572339, 2358507], [2358508, 3144676], [3144677, 3930845], [3930846, 4717014], [4717015, 5503183], [5503184, 6289352], [6289353, 7075521], [7075522, 7861690], [7861691, 8647859], [8647860, 9434028], [9434029, 10220197], [10220198, 11006366], [11006367, 11792535], [11792536, 12578704], [12578705, 13364873], [13364874, 14151042], [14151043, 14937211], [14937212, 15723387]] SRR7169114 file size 5306439 SRR7169114 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169114 SRR7169114_1.fastq SRR7169114_2.fastq Input file: SRR7169114_1.fastq Paired file: SRR7169114_2.fastq trimmed: SRR7169114-trimmed-pair1.fastq, SRR7169114-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:40:01 2025 >> started Mon Feb 10 22:40:19 2025 >> done (18.251s) 15723387 read pairs processed; of these: 20992 ( 0.13%) short read pairs filtered out after trimming by size control 25307 ( 0.16%) empty read pairs filtered out after trimming by size control 15677088 (99.71%) read pairs available; of these: 6973523 (44.48%) trimmed read pairs available after processing 8703565 (55.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 10 0.00% 20 0 0.00% 21 4 0.00% 22 5 0.00% 23 6 0.00% 24 6 0.00% 25 5 0.00% 26 4 0.00% 27 14 0.00% 28 2 0.00% 29 3 0.00% 30 10 0.00% 31 8 0.00% 32 7 0.00% 33 8 0.00% 34 14 0.00% 35 10 0.00% 36 13 0.00% 37 17 0.00% 38 17 0.00% 39 16 0.00% 40 16 0.00% 41 10 0.00% 42 14 0.00% 43 32 0.00% 44 13 0.00% 45 31 0.00% 46 23 0.00% 47 33 0.00% 48 32 0.00% 49 32 0.00% 50 43 0.00% 51 56 0.00% 52 60 0.00% 53 42 0.00% 54 58 0.00% 55 47 0.00% 56 65 0.00% 57 61 0.00% 58 68 0.00% 59 77 0.00% 60 100 0.00% 61 114 0.00% 62 117 0.00% 63 123 0.00% 64 153 0.00% 65 137 0.00% 66 167 0.00% 67 188 0.00% 68 197 0.00% 69 241 0.00% 70 265 0.00% 71 276 0.00% 72 326 0.00% 73 313 0.00% 74 351 0.00% 75 409 0.00% 76 471 0.00% 77 511 0.00% 78 552 0.00% 79 593 0.00% 80 757 0.00% 81 780 0.00% 82 938 0.01% 83 1131 0.01% 84 2038 0.01% 85 2683 0.02% 86 2622 0.02% 87 2799 0.02% 88 2954 0.02% 89 2916 0.02% 90 2994 0.02% 91 3022 0.02% 92 3239 0.02% 93 3459 0.02% 94 3611 0.02% 95 3838 0.02% 96 4121 0.03% 97 4433 0.03% 98 4549 0.03% 99 4952 0.03% 100 5339 0.03% 101 5533 0.04% 102 5678 0.04% 103 6231 0.04% 104 6620 0.04% 105 7200 0.05% 106 7732 0.05% 107 8257 0.05% 108 8560 0.05% 109 9109 0.06% 110 9442 0.06% 111 10091 0.06% 112 10844 0.07% 113 11624 0.07% 114 12258 0.08% 115 13203 0.08% 116 13917 0.09% 117 14684 0.09% 118 15736 0.10% 119 16421 0.10% 120 17383 0.11% 121 18133 0.12% 122 19383 0.12% 123 20858 0.13% 124 22480 0.14% 125 23665 0.15% 126 25237 0.16% 127 26961 0.17% 128 28596 0.18% 129 30589 0.20% 130 32661 0.21% 131 34782 0.22% 132 37658 0.24% 133 40769 0.26% 134 43468 0.28% 135 47539 0.30% 136 51643 0.33% 137 56644 0.36% 138 62385 0.40% 139 69025 0.44% 140 75572 0.48% 141 83346 0.53% 142 93403 0.60% 143 105419 0.67% 144 124073 0.79% 145 150919 0.96% 146 190603 1.22% 147 266770 1.70% 148 401508 2.56% 149 790396 5.04% 150 3718742 23.72% 151 8703565 55.52% 15677088 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=45 prefix-density=0.21 prefix-fanout=2.4 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=369.99 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=18.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=5.64 fanout-score-rank=23 prefix-density=0.30 prefix-fanout=3.8 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=232.01 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=25.1 sequence=GAAGAAGAAGAAA SRR7169114 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:41:11 Started mapping on | Feb 10 22:41:11 Finished on | Feb 10 22:43:59 Mapping speed, Million of reads per hour | 335.94 Number of input reads | 15677088 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14391329 Uniquely mapped reads % | 91.80% Average mapped length | 296.54 Number of splices: Total | 13882339 Number of splices: Annotated (sjdb) | 13669681 Number of splices: GT/AG | 13677271 Number of splices: GC/AG | 164627 Number of splices: AT/AC | 11771 Number of splices: Non-canonical | 28670 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 307506 % of reads mapped to multiple loci | 1.96% Number of reads mapped to too many loci | 22783 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.06% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 998173 998173 998173 N_multimapping 307506 307506 307506 N_noFeature 251026 14224429 316407 N_ambiguous 158087 730 56137 UnstrandedReadsAssigned:13982216 PositiveStrandReadsAssigned:166170 NegativeStrandReadsAssigned:14018785 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169114 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169114-trimmed-pair1.fastq SRR7169114-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,677,088 reads, 13,928,034 reads pseudoaligned [quant] estimated average fragment length: 269.235 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR7169114.ke.tsv 34699 SRR7169114.se.tsv 87100 total ==> SRR7169114.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.76 242 7.73578 Potri.005G024800.1.v4.1 1035 766.765 36 2.62608 Potri.004G059700.1.v4.1 961 692.777 5 0.403687 Potri.007G009000.2.v4.1 1416 1147.76 0 0 Potri.003G141000.2.v4.1 2943 2674.76 249 5.20693 Potri.016G087400.1.v4.1 270 61.3578 1534.53 1398.86 Potri.015G069301.1.v4.1 564 300.138 0 0 Potri.010G195200.1.v4.1 1773 1504.76 17 0.6319 Potri.012G127500.1.v4.1 977 708.777 7015 553.588 ==> SRR7169114.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 861 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 254 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169114 completed mapping pipeline successfully