Starting /dee2/code/volunteer_pipeline.sh SRR7169115 current disk space = 3057160720384 free memory = 1337930376 SRR7169115 SRAfilesize 776137e0efcf95745e0ba7520a854766 SRR7169115.sra SRR7169115.sra file validated SRR7169115 is paired end SRR7169115 is conventional basespace SRR7169115 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169115_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90775 34.0 33.0 34.0 33.0 34.0 2 33.32925 34.0 33.0 34.0 33.0 34.0 3 33.27525 34.0 33.0 34.0 33.0 34.0 4 33.3285 34.0 33.0 34.0 33.0 34.0 5 33.3425 34.0 33.0 34.0 33.0 34.0 6 36.926 38.0 37.0 38.0 35.0 38.0 7 37.34425 38.0 38.0 38.0 37.0 38.0 8 37.39825 38.0 38.0 38.0 37.0 38.0 9 37.3855 38.0 38.0 38.0 37.0 38.0 10-14 37.389 38.0 38.0 38.0 37.0 38.0 15-19 37.360800000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.23885 38.0 38.0 38.0 36.8 38.0 25-29 37.2284 38.0 38.0 38.0 36.6 38.0 30-34 37.2043 38.0 38.0 38.0 36.6 38.0 35-39 37.0495 38.0 38.0 38.0 36.0 38.0 40-44 36.9493 38.0 38.0 38.0 35.8 38.0 45-49 36.7618 38.0 38.0 38.0 35.0 38.0 50-54 36.6625 38.0 38.0 38.0 34.6 38.0 55-59 36.5758 38.0 38.0 38.0 34.2 38.0 60-64 36.641 38.0 38.0 38.0 34.0 38.0 65-69 36.544050000000006 38.0 38.0 38.0 34.0 38.0 70-74 36.3363 38.0 37.6 38.0 33.6 38.0 75-79 36.2682 38.0 37.2 38.0 33.6 38.0 80-84 35.70315000000001 38.0 36.8 38.0 31.0 38.0 85-89 36.04945 38.0 37.0 38.0 33.0 38.0 90-94 35.814750000000004 38.0 37.0 38.0 31.4 38.0 95-99 35.523250000000004 38.0 36.2 38.0 29.8 38.0 100-104 35.19995 38.0 36.0 38.0 28.4 38.0 105-109 34.685399999999994 38.0 35.2 38.0 25.6 38.0 110-114 34.63035 38.0 34.8 38.0 25.2 38.0 115-119 35.0293 38.0 35.6 38.0 28.0 38.0 120-124 34.137899999999995 38.0 34.4 38.0 23.0 38.0 125-129 33.74615 38.0 34.0 38.0 21.8 38.0 130-134 33.60245 38.0 34.0 38.0 20.2 38.0 135-139 33.05585 37.8 33.2 38.0 16.6 38.0 140-144 32.0986 37.0 32.0 38.0 14.4 38.0 145-149 30.80895 36.0 31.0 38.0 8.6 38.0 150-151 26.757375 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 2.0 13 0.0 14 2.0 15 5.0 16 3.0 17 1.0 18 7.0 19 3.0 20 6.0 21 10.0 22 12.0 23 11.0 24 14.0 25 20.0 26 42.0 27 47.0 28 53.0 29 56.0 30 62.0 31 91.0 32 114.0 33 162.0 34 245.0 35 467.0 36 960.0 37 1602.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.241379310344826 12.778904665314403 8.316430020283976 36.66328600405679 2 22.650000000000002 14.524999999999999 33.925 28.9 3 18.025 18.975 26.075 36.925000000000004 4 21.65 26.6 23.974999999999998 27.775 5 22.475 31.825 23.95 21.75 6 20.65 34.300000000000004 23.825 21.224999999999998 7 14.000000000000002 29.25 40.025 16.725 8 18.375 26.275 30.075000000000003 25.275 9 15.925 23.625 36.025 24.425 10-14 19.7 29.904999999999998 27.205000000000002 23.189999999999998 15-19 19.869999999999997 28.904999999999998 27.46 23.765 20-24 19.165 29.04 27.88 23.915 25-29 19.950000000000003 28.48 27.750000000000004 23.82 30-34 19.88 28.694999999999997 27.685 23.74 35-39 20.064999999999998 28.255000000000003 27.815 23.865 40-44 19.415 29.225 27.495000000000005 23.865 45-49 20.294999999999998 28.58 27.700000000000003 23.425 50-54 20.04 28.449999999999996 27.55 23.96 55-59 19.75 29.03 27.474999999999998 23.745 60-64 20.385 28.375 27.575 23.665 65-69 19.605 28.925 27.33 24.14 70-74 20.080000000000002 28.58 27.445000000000004 23.895 75-79 19.905 28.685 27.325 24.085 80-84 20.23 28.62 27.205000000000002 23.945 85-89 20.205000000000002 29.005 27.405 23.385 90-94 20.405 28.59 27.275 23.73 95-99 20.48 28.549999999999997 27.025 23.945 100-104 20.24 28.87 27.29 23.599999999999998 105-109 20.43 27.705000000000002 28.16 23.705000000000002 110-114 20.01 28.405 27.71 23.875 115-119 20.335 27.689999999999998 27.99 23.985 120-124 20.66 28.310000000000002 27.439999999999998 23.59 125-129 20.375 28.34 27.860000000000003 23.425 130-134 20.375 28.444999999999997 27.72 23.46 135-139 20.625 27.815 27.525 24.035 140-144 20.315 28.349999999999998 27.425 23.91 145-149 20.01 28.255000000000003 27.68 24.055 150-151 20.8625 28.6625 27.6625 22.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.5 22 1.0 23 0.5 24 1.5 25 1.5 26 3.5 27 7.0 28 10.0 29 13.0 30 15.0 31 17.5 32 24.0 33 36.0 34 45.5 35 61.0 36 99.5 37 111.5 38 120.0 39 168.5 40 191.0 41 199.0 42 234.5 43 262.0 44 272.0 45 295.5 46 304.0 47 270.5 48 242.0 49 210.5 50 172.0 51 150.0 52 115.5 53 86.5 54 70.5 55 47.5 56 35.5 57 30.5 58 20.0 59 14.0 60 12.5 61 9.0 62 5.5 63 5.0 64 3.0 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0125 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.0 0.025 0.0 0.0 0.0 88-89 0.0 0.025 0.0 0.0 0.0 90-91 0.0 0.025 0.0 0.0 0.0 92-93 0.0 0.025 0.0 0.0 0.0 94-95 0.0 0.025 0.0 0.0 0.0 96-97 0.0 0.025 0.0 0.0 0.0 98-99 0.0 0.025 0.0 0.0 0.0 100-101 0.0 0.025 0.0 0.0 0.0 102-103 0.025 0.025 0.0 0.0 0.0 104-105 0.05 0.025 0.0 0.0 0.0 106-107 0.05 0.025 0.0 0.0 0.0 108-109 0.05 0.025 0.0 0.0 0.0 110-111 0.05 0.025 0.0 0.0 0.0 112-113 0.05 0.025 0.0 0.0 0.0 114-115 0.0875 0.025 0.0 0.0 0.0 116-117 0.1 0.025 0.0 0.0 0.0 118-119 0.175 0.025 0.0 0.0 0.0 120-121 0.1875 0.025 0.0 0.0 0.0 122-123 0.25 0.025 0.0 0.0 0.0 124-125 0.275 0.025 0.0 0.0 0.0 126-127 0.325 0.025 0.0 0.0 0.0 128-129 0.38749999999999996 0.025 0.0 0.0 0.0 130-131 0.4625 0.025 0.0 0.0 0.0 132-133 0.5375000000000001 0.025 0.0 0.0 0.0 134-135 0.5874999999999999 0.025 0.0 0.0 0.0 136-137 0.65 0.025 0.0 0.0 0.0 138-139 0.7375 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169115 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169115_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90825 33.0 33.0 34.0 32.0 34.0 2 32.83525 34.0 33.0 34.0 32.0 34.0 3 32.909 34.0 33.0 34.0 32.0 34.0 4 32.7595 34.0 33.0 34.0 32.0 34.0 5 32.92725 34.0 33.0 34.0 32.0 34.0 6 37.059 38.0 38.0 38.0 37.0 38.0 7 37.03425 38.0 38.0 38.0 37.0 38.0 8 37.06475 38.0 38.0 38.0 37.0 38.0 9 36.8965 38.0 38.0 38.0 36.0 38.0 10-14 36.853699999999996 38.0 38.0 38.0 35.8 38.0 15-19 37.01995 38.0 38.0 38.0 36.2 38.0 20-24 36.98035 38.0 38.0 38.0 36.2 38.0 25-29 36.90585 38.0 38.0 38.0 36.0 38.0 30-34 36.955349999999996 38.0 38.0 38.0 36.4 38.0 35-39 36.7938 38.0 38.0 38.0 36.0 38.0 40-44 36.691900000000004 38.0 38.0 38.0 35.4 38.0 45-49 36.784549999999996 38.0 38.0 38.0 35.6 38.0 50-54 36.8652 38.0 38.0 38.0 36.0 38.0 55-59 36.80315 38.0 38.0 38.0 35.8 38.0 60-64 36.65689999999999 38.0 38.0 38.0 35.0 38.0 65-69 36.628099999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.55865 38.0 38.0 38.0 34.8 38.0 75-79 36.4342 38.0 38.0 38.0 34.2 38.0 80-84 36.283899999999996 38.0 38.0 38.0 33.8 38.0 85-89 36.2087 38.0 38.0 38.0 33.8 38.0 90-94 36.03529999999999 38.0 37.6 38.0 32.8 38.0 95-99 36.2898 38.0 38.0 38.0 34.0 38.0 100-104 36.020050000000005 38.0 38.0 38.0 33.2 38.0 105-109 35.9207 38.0 37.2 38.0 33.0 38.0 110-114 35.60075 38.0 37.0 38.0 31.0 38.0 115-119 35.41395 38.0 37.0 38.0 29.6 38.0 120-124 35.395599999999995 38.0 36.8 38.0 30.2 38.0 125-129 34.9279 38.0 36.0 38.0 27.8 38.0 130-134 34.60805 38.0 35.4 38.0 26.0 38.0 135-139 34.2572 38.0 35.0 38.0 23.8 38.0 140-144 34.1105 38.0 35.0 38.0 23.2 38.0 145-149 33.438050000000004 38.0 34.8 38.0 19.6 38.0 150-151 29.880250000000004 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 2.0 5 1.0 6 0.0 7 1.0 8 0.0 9 2.0 10 1.0 11 2.0 12 1.0 13 4.0 14 2.0 15 3.0 16 6.0 17 5.0 18 2.0 19 7.0 20 8.0 21 3.0 22 14.0 23 14.0 24 23.0 25 28.0 26 23.0 27 34.0 28 42.0 29 44.0 30 47.0 31 62.0 32 78.0 33 108.0 34 143.0 35 251.0 36 537.0 37 2494.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.0 23.35 13.600000000000001 25.05 2 29.375 25.8 28.225 16.6 3 21.080270067516878 26.881720430107524 32.25806451612903 19.779944986246562 4 22.886443221610804 32.741370685342666 25.287643821910955 19.084542271135568 5 24.625 35.275 22.55 17.549999999999997 6 21.8 35.925000000000004 23.849999999999998 18.425 7 19.975 22.5 37.724999999999994 19.8 8 21.025 26.450000000000003 27.025 25.5 9 22.400000000000002 24.575 30.225 22.8 10-14 23.09 29.38 26.47 21.060000000000002 15-19 23.485 27.985 28.08 20.45 20-24 23.09 27.73 28.255000000000003 20.925 25-29 22.56 28.215 27.97 21.255 30-34 23.080000000000002 28.12 28.26 20.54 35-39 22.765 28.34 27.54 21.355 40-44 23.45 28.1 27.589999999999996 20.86 45-49 23.165 27.529999999999998 28.215 21.09 50-54 22.95 28.42 27.6 21.029999999999998 55-59 22.945 27.860000000000003 28.38 20.815 60-64 23.175 27.944999999999997 27.825 21.055 65-69 23.705000000000002 27.589999999999996 28.044999999999998 20.66 70-74 23.544999999999998 28.01 27.315 21.13 75-79 23.465 27.68 28.215 20.64 80-84 23.880000000000003 27.595 27.855 20.669999999999998 85-89 23.605 27.700000000000003 28.23 20.465 90-94 23.580000000000002 27.55 27.975 20.895 95-99 23.695 27.82 27.79 20.695 100-104 23.855 27.855 28.044999999999998 20.244999999999997 105-109 23.73 27.495000000000005 28.345 20.43 110-114 23.755000000000003 27.85 27.73 20.665 115-119 23.880000000000003 28.02 27.735 20.365 120-124 24.075 28.04 27.779999999999998 20.105 125-129 23.419999999999998 27.834999999999997 28.144999999999996 20.599999999999998 130-134 24.035 27.935 27.52 20.51 135-139 24.03 27.775 27.625 20.57 140-144 23.46 27.73 27.76 21.05 145-149 23.96 27.985 27.750000000000004 20.305 150-151 23.9875 28.775000000000002 27.200000000000003 20.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 0.0 25 1.0 26 3.0 27 5.5 28 7.5 29 5.5 30 5.0 31 10.0 32 22.0 33 34.0 34 44.5 35 56.0 36 67.0 37 96.0 38 128.0 39 161.5 40 203.0 41 241.5 42 271.0 43 279.5 44 300.5 45 316.0 46 286.0 47 271.5 48 245.0 49 190.5 50 151.0 51 143.5 52 127.5 53 87.0 54 67.0 55 47.5 56 32.5 57 24.0 58 19.0 59 14.5 60 9.5 61 6.5 62 6.0 63 4.5 64 2.0 65 1.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0125 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.2375 0.0 0.0 0.0 0.0 120-121 0.2875 0.0 0.0 0.0 0.0 122-123 0.35 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.425 0.0 0.0 0.0 0.0 128-129 0.48750000000000004 0.0 0.0 0.0 0.0 130-131 0.5625 0.0 0.0 0.0 0.0 132-133 0.6375 0.0 0.0 0.0 0.0 134-135 0.6875 0.0 0.0 0.0 0.0 136-137 0.75 0.0 0.0 0.0 0.0 138-139 0.8500000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861796 spots for SRR7169115.sra Written 861796 spots for SRR7169115.sra Read 861810 spots for SRR7169115.sra Written 861810 spots for SRR7169115.sra SRR ids: ['SRR7169115.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_16g1jlva SRR7169115.sra spots: 17235934 blocks: [[1, 861796], [861797, 1723592], [1723593, 2585388], [2585389, 3447184], [3447185, 4308980], [4308981, 5170776], [5170777, 6032572], [6032573, 6894368], [6894369, 7756164], [7756165, 8617960], [8617961, 9479756], [9479757, 10341552], [10341553, 11203348], [11203349, 12065144], [12065145, 12926940], [12926941, 13788736], [13788737, 14650532], [14650533, 15512328], [15512329, 16374124], [16374125, 17235934]] SRR7169115 file size 5818992 SRR7169115 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169115 SRR7169115_1.fastq SRR7169115_2.fastq Input file: SRR7169115_1.fastq Paired file: SRR7169115_2.fastq trimmed: SRR7169115-trimmed-pair1.fastq, SRR7169115-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:11:02 2025 >> started Mon Feb 10 22:11:21 2025 >> done (18.965s) 17235934 read pairs processed; of these: 12447 ( 0.07%) short read pairs filtered out after trimming by size control 7224 ( 0.04%) empty read pairs filtered out after trimming by size control 17216263 (99.89%) read pairs available; of these: 7955509 (46.21%) trimmed read pairs available after processing 9260754 (53.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 3 0.00% 22 1 0.00% 23 4 0.00% 24 9 0.00% 25 8 0.00% 26 3 0.00% 27 7 0.00% 28 5 0.00% 29 8 0.00% 30 5 0.00% 31 5 0.00% 32 4 0.00% 33 2 0.00% 34 7 0.00% 35 6 0.00% 36 8 0.00% 37 11 0.00% 38 6 0.00% 39 8 0.00% 40 8 0.00% 41 3 0.00% 42 10 0.00% 43 9 0.00% 44 18 0.00% 45 14 0.00% 46 11 0.00% 47 19 0.00% 48 17 0.00% 49 23 0.00% 50 24 0.00% 51 29 0.00% 52 25 0.00% 53 25 0.00% 54 38 0.00% 55 34 0.00% 56 42 0.00% 57 48 0.00% 58 46 0.00% 59 63 0.00% 60 51 0.00% 61 49 0.00% 62 72 0.00% 63 69 0.00% 64 67 0.00% 65 66 0.00% 66 85 0.00% 67 111 0.00% 68 128 0.00% 69 137 0.00% 70 151 0.00% 71 206 0.00% 72 177 0.00% 73 186 0.00% 74 207 0.00% 75 240 0.00% 76 260 0.00% 77 337 0.00% 78 329 0.00% 79 385 0.00% 80 436 0.00% 81 525 0.00% 82 575 0.00% 83 706 0.00% 84 1308 0.01% 85 1696 0.01% 86 1712 0.01% 87 1892 0.01% 88 2008 0.01% 89 2147 0.01% 90 2158 0.01% 91 2210 0.01% 92 2443 0.01% 93 2519 0.01% 94 2673 0.02% 95 2827 0.02% 96 2864 0.02% 97 3201 0.02% 98 3463 0.02% 99 3641 0.02% 100 3808 0.02% 101 4129 0.02% 102 4475 0.03% 103 4647 0.03% 104 4907 0.03% 105 5280 0.03% 106 5711 0.03% 107 6113 0.04% 108 6265 0.04% 109 6774 0.04% 110 7270 0.04% 111 7897 0.05% 112 8490 0.05% 113 9091 0.05% 114 9791 0.06% 115 10580 0.06% 116 11231 0.07% 117 11906 0.07% 118 12963 0.08% 119 13537 0.08% 120 14041 0.08% 121 14764 0.09% 122 15942 0.09% 123 17378 0.10% 124 18434 0.11% 125 20171 0.12% 126 21602 0.13% 127 23138 0.13% 128 24935 0.14% 129 26699 0.16% 130 28764 0.17% 131 31614 0.18% 132 34108 0.20% 133 37591 0.22% 134 40870 0.24% 135 45150 0.26% 136 49269 0.29% 137 55170 0.32% 138 60794 0.35% 139 68350 0.40% 140 76154 0.44% 141 86985 0.51% 142 99571 0.58% 143 117177 0.68% 144 141490 0.82% 145 174274 1.01% 146 229806 1.33% 147 319563 1.86% 148 500928 2.91% 149 980056 5.69% 150 4380917 25.45% 151 9260754 53.79% 17216263 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=37 prefix-density=0.17 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=39 fanout-score=177.13 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=17.4 sequence=TCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=34 prefix-density=0.30 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=61.07 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=14.4 sequence=TGTTGGTGGTGG SRR7169115 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:12:06 Started mapping on | Feb 10 22:12:07 Finished on | Feb 10 22:13:45 Mapping speed, Million of reads per hour | 632.43 Number of input reads | 17216263 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 16397413 Uniquely mapped reads % | 95.24% Average mapped length | 297.23 Number of splices: Total | 16378735 Number of splices: Annotated (sjdb) | 16123288 Number of splices: GT/AG | 16144499 Number of splices: GC/AG | 189857 Number of splices: AT/AC | 12788 Number of splices: Non-canonical | 31591 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 300412 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 20893 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.86% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 533713 533713 533713 N_multimapping 300412 300412 300412 N_noFeature 327817 16224393 399180 N_ambiguous 170989 812 68787 UnstrandedReadsAssigned:15898607 PositiveStrandReadsAssigned:172208 NegativeStrandReadsAssigned:15929446 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169115 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169115-trimmed-pair1.fastq SRR7169115-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,216,263 reads, 15,767,315 reads pseudoaligned [quant] estimated average fragment length: 285.486 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR7169115.ke.tsv 34699 SRR7169115.se.tsv 87100 total ==> SRR7169115.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1733.51 347 12.0332 Potri.005G024800.1.v4.1 1035 750.514 52 4.16508 Potri.004G059700.1.v4.1 961 676.588 2 0.177699 Potri.007G009000.2.v4.1 1416 1131.51 0 0 Potri.003G141000.2.v4.1 2943 2658.51 206.064 4.65953 Potri.016G087400.1.v4.1 270 57.4824 1213 1268.54 Potri.015G069301.1.v4.1 564 287.796 0 0 Potri.010G195200.1.v4.1 1773 1488.51 18 0.726939 Potri.012G127500.1.v4.1 977 692.564 3672 318.729 ==> SRR7169115.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1257 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 253 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169115 completed mapping pipeline successfully