Starting /dee2/code/volunteer_pipeline.sh SRR7169116 current disk space = 3057260503040 free memory = 1414443744 SRR7169116 SRAfilesize edf8d420b9865fcfef5b8af109dd67ed SRR7169116.sra SRR7169116.sra file validated SRR7169116 is paired end SRR7169116 is conventional basespace SRR7169116 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169116_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.129 34.0 33.0 34.0 32.0 34.0 2 33.25875 34.0 33.0 34.0 32.0 34.0 3 33.34125 34.0 33.0 34.0 32.0 34.0 4 33.4155 34.0 33.0 34.0 33.0 34.0 5 33.3295 34.0 33.0 34.0 33.0 34.0 6 37.15425 38.0 37.0 38.0 36.0 38.0 7 35.815 38.0 37.0 38.0 30.0 38.0 8 36.5645 38.0 37.0 38.0 34.0 38.0 9 37.25425 38.0 38.0 38.0 36.0 38.0 10-14 37.41455 38.0 38.0 38.0 36.8 38.0 15-19 37.144099999999995 38.0 38.0 38.0 36.4 38.0 20-24 37.3998 38.0 38.0 38.0 37.0 38.0 25-29 37.3215 38.0 38.0 38.0 37.0 38.0 30-34 37.32045 38.0 38.0 38.0 37.0 38.0 35-39 37.36595 38.0 38.0 38.0 36.8 38.0 40-44 36.83055 38.0 37.8 38.0 35.0 38.0 45-49 36.84195 38.0 38.0 38.0 35.2 38.0 50-54 36.44695 38.0 37.6 38.0 33.4 38.0 55-59 36.39855 38.0 37.6 38.0 33.2 38.0 60-64 36.547000000000004 38.0 37.8 38.0 34.2 38.0 65-69 36.45205 38.0 37.6 38.0 33.8 38.0 70-74 36.2278 38.0 37.0 38.0 33.4 38.0 75-79 36.373900000000006 38.0 37.6 38.0 33.8 38.0 80-84 36.18735 38.0 37.0 38.0 33.2 38.0 85-89 35.9851 38.0 37.0 38.0 32.2 38.0 90-94 35.80015 38.0 36.8 38.0 31.6 38.0 95-99 35.7255 38.0 36.8 38.0 30.8 38.0 100-104 35.159000000000006 38.0 35.8 38.0 28.4 38.0 105-109 34.651849999999996 38.0 34.8 38.0 25.8 38.0 110-114 34.67659999999999 38.0 34.8 38.0 26.4 38.0 115-119 34.73605 38.0 35.0 38.0 27.0 38.0 120-124 34.12035 38.0 34.0 38.0 23.2 38.0 125-129 33.9105 38.0 34.0 38.0 23.0 38.0 130-134 33.7308 38.0 33.6 38.0 22.4 38.0 135-139 33.0992 37.8 32.6 38.0 19.0 38.0 140-144 31.88195 36.2 31.6 38.0 13.4 38.0 145-149 30.4844 36.0 30.4 38.0 8.6 38.0 150-151 25.5565 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 2.0 11 1.0 12 1.0 13 1.0 14 4.0 15 2.0 16 0.0 17 4.0 18 4.0 19 5.0 20 6.0 21 9.0 22 4.0 23 14.0 24 12.0 25 26.0 26 22.0 27 41.0 28 47.0 29 55.0 30 93.0 31 100.0 32 118.0 33 176.0 34 281.0 35 477.0 36 1015.0 37 1478.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.456725755995826 12.48696558915537 8.263816475495307 35.79249217935349 2 23.35 15.575 33.35 27.725 3 19.175 22.175 26.674999999999997 31.974999999999998 4 22.225 28.499999999999996 23.200000000000003 26.075 5 21.825 33.4 23.849999999999998 20.925 6 19.975 35.5 24.05 20.474999999999998 7 14.325 27.250000000000004 40.725 17.7 8 18.099999999999998 24.8 30.7 26.400000000000002 9 17.125 25.1 33.2 24.575 10-14 19.675 30.014999999999997 26.474999999999998 23.835 15-19 19.525000000000002 29.17 27.310000000000002 23.995 20-24 19.95699569956996 29.61796179617962 27.277727772777276 23.14731473147315 25-29 19.830000000000002 29.035 27.185 23.95 30-34 20.00700070007001 28.61286128612861 27.86278627862786 23.517351735173516 35-39 20.652065206520653 28.66786678667867 27.21272127212721 23.467346734673466 40-44 19.75993998499625 29.197299324831206 27.021755438859714 24.021005251312825 45-49 20.205000000000002 28.904999999999998 26.855 24.035 50-54 20.06 28.42 27.96 23.56 55-59 19.79 28.715000000000003 27.095000000000002 24.4 60-64 20.01600080004 28.41642082104105 27.51637581879094 24.051202560128008 65-69 20.14 28.21 27.785 23.865 70-74 20.332033203320332 29.48294829482948 26.882688268826882 23.3023302330233 75-79 20.035 28.465 27.565 23.935000000000002 80-84 20.41 28.375 27.185 24.03 85-89 20.47602380119006 28.491424571228563 27.416370818540926 23.61618080904045 90-94 20.638095714357156 28.58428764314647 27.48412261839276 23.293494024103616 95-99 20.25 27.98 27.485 24.285 100-104 20.95 28.82 26.715 23.515 105-109 20.349999999999998 28.395 27.250000000000004 24.005000000000003 110-114 20.255000000000003 28.645 27.265 23.835 115-119 20.04 28.560000000000002 27.325 24.075 120-124 20.465 28.349999999999998 27.034999999999997 24.15 125-129 21.085 27.505000000000003 27.515 23.895 130-134 19.97 28.04 27.43 24.560000000000002 135-139 20.834166833366673 28.035607121424285 26.965393078615723 24.16483296659332 140-144 20.7810390519526 27.69138456922846 27.956397819890995 23.571178558927947 145-149 21.12316847527129 27.804170625593837 27.32409861479222 23.74856228434265 150-151 21.0125 27.525 26.974999999999998 24.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 0.5 20 1.0 21 1.0 22 0.5 23 2.5 24 2.0 25 2.0 26 6.5 27 10.0 28 11.5 29 11.5 30 17.5 31 27.0 32 32.0 33 34.5 34 51.5 35 73.0 36 93.0 37 108.5 38 119.0 39 141.0 40 173.0 41 213.0 42 241.5 43 248.0 44 275.5 45 290.0 46 269.0 47 257.0 48 227.5 49 205.0 50 187.0 51 149.0 52 116.5 53 94.0 54 74.0 55 51.5 56 42.0 57 35.0 58 26.0 59 18.5 60 8.0 61 9.5 62 11.0 63 6.0 64 3.5 65 3.5 66 3.5 67 3.0 68 3.0 69 2.5 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.1000000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.0 30-34 0.01 35-39 0.01 40-44 0.025 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.0 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.015 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.02 140-144 0.005 145-149 0.015 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.3 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.6 0.0 0.0 0.0 0.0 128-129 0.7 0.0 0.0 0.0 0.0 130-131 0.7 0.0 0.0 0.0 0.0 132-133 0.725 0.0 0.0 0.0 0.0 134-135 0.775 0.0 0.0 0.0 0.0 136-137 0.925 0.0 0.0 0.0 0.0 138-139 1.0750000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169116 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169116_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9895 33.0 33.0 34.0 32.0 34.0 2 33.076 34.0 33.0 34.0 32.0 34.0 3 33.04825 34.0 33.0 34.0 32.0 34.0 4 32.9995 34.0 33.0 34.0 32.0 34.0 5 33.018 34.0 33.0 34.0 32.0 34.0 6 37.145 38.0 38.0 38.0 37.0 38.0 7 37.126 38.0 38.0 38.0 37.0 38.0 8 36.5645 38.0 38.0 38.0 34.0 38.0 9 37.07625 38.0 38.0 38.0 36.0 38.0 10-14 37.054700000000004 38.0 38.0 38.0 36.6 38.0 15-19 37.119550000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.03235 38.0 38.0 38.0 36.6 38.0 25-29 37.04115 38.0 38.0 38.0 36.6 38.0 30-34 37.048300000000005 38.0 38.0 38.0 36.6 38.0 35-39 36.79255 38.0 38.0 38.0 35.6 38.0 40-44 36.79995 38.0 38.0 38.0 35.8 38.0 45-49 36.922549999999994 38.0 38.0 38.0 36.0 38.0 50-54 36.8733 38.0 38.0 38.0 36.0 38.0 55-59 36.845749999999995 38.0 38.0 38.0 35.8 38.0 60-64 36.68875 38.0 38.0 38.0 35.0 38.0 65-69 36.65955 38.0 38.0 38.0 35.0 38.0 70-74 36.5466 38.0 38.0 38.0 34.4 38.0 75-79 36.36435 38.0 38.0 38.0 34.0 38.0 80-84 36.31155 38.0 38.0 38.0 34.0 38.0 85-89 36.027049999999996 38.0 37.8 38.0 32.6 38.0 90-94 36.033699999999996 38.0 37.8 38.0 33.2 38.0 95-99 36.1817 38.0 38.0 38.0 33.6 38.0 100-104 35.993900000000004 38.0 37.6 38.0 33.0 38.0 105-109 35.68795 38.0 37.0 38.0 31.2 38.0 110-114 35.3478 38.0 36.6 38.0 29.6 38.0 115-119 35.2084 38.0 36.4 38.0 28.8 38.0 120-124 35.32340000000001 38.0 36.4 38.0 30.2 38.0 125-129 34.63075 38.0 35.4 38.0 25.8 38.0 130-134 34.243 38.0 35.0 38.0 23.0 38.0 135-139 33.72755 38.0 34.2 38.0 21.4 38.0 140-144 33.5158 38.0 33.6 38.0 21.0 38.0 145-149 32.410399999999996 38.0 33.2 38.0 13.2 38.0 150-151 28.00525 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 5.0 4 2.0 5 0.0 6 3.0 7 2.0 8 0.0 9 0.0 10 0.0 11 2.0 12 3.0 13 2.0 14 5.0 15 2.0 16 4.0 17 8.0 18 6.0 19 7.0 20 11.0 21 5.0 22 16.0 23 17.0 24 15.0 25 17.0 26 19.0 27 35.0 28 37.0 29 46.0 30 55.0 31 82.0 32 87.0 33 129.0 34 154.0 35 271.0 36 651.0 37 2302.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.0 22.575 12.15 25.275 2 27.150000000000002 26.025 30.425 16.400000000000002 3 21.925 28.475 31.0 18.6 4 23.599999999999998 32.625 24.0 19.775000000000002 5 24.099999999999998 36.575 21.575 17.75 6 21.025 37.574999999999996 24.075 17.325 7 19.075 22.5 37.35 21.075 8 21.75 25.3 27.55 25.4 9 22.25 25.7 28.775000000000002 23.275000000000002 10-14 23.29 28.57 26.340000000000003 21.8 15-19 22.73 27.994999999999997 28.065 21.21 20-24 23.395 27.77 27.715 21.12 25-29 23.24 27.88 27.195000000000004 21.685 30-34 23.494999999999997 27.994999999999997 28.04 20.47 35-39 23.445 27.845 27.395000000000003 21.315 40-44 22.95 28.43 27.36 21.26 45-49 23.45 28.444999999999997 27.33 20.775 50-54 23.01 27.875 28.04 21.075 55-59 23.330000000000002 27.884999999999998 27.58 21.205 60-64 23.169999999999998 27.805000000000003 28.09 20.935000000000002 65-69 23.375 27.32 28.555000000000003 20.75 70-74 23.64 27.474999999999998 28.13 20.755000000000003 75-79 23.62 27.544999999999998 28.360000000000003 20.474999999999998 80-84 23.755000000000003 27.765 27.18 21.3 85-89 23.794999999999998 27.625 28.09 20.49 90-94 23.580000000000002 27.445000000000004 27.79 21.185000000000002 95-99 23.265 27.73 28.305000000000003 20.7 100-104 23.785 27.57 27.685 20.96 105-109 23.405 28.025 27.955000000000002 20.615 110-114 23.325000000000003 27.505000000000003 27.794999999999998 21.375 115-119 23.965 27.655 27.694999999999997 20.685000000000002 120-124 23.674999999999997 27.91 27.775 20.64 125-129 23.95 27.939999999999998 27.175 20.935000000000002 130-134 24.060000000000002 27.325 27.425 21.19 135-139 24.175 27.38 27.900000000000002 20.544999999999998 140-144 24.104999999999997 28.105000000000004 27.485 20.305 145-149 24.425 27.935 27.1 20.54 150-151 23.65 27.325 28.1875 20.837500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.0 26 2.0 27 3.5 28 4.5 29 4.5 30 8.0 31 13.5 32 16.5 33 29.0 34 43.5 35 57.0 36 71.5 37 92.0 38 125.5 39 156.0 40 196.5 41 234.0 42 263.0 43 290.5 44 293.5 45 287.5 46 284.5 47 273.5 48 240.0 49 196.5 50 168.0 51 146.0 52 123.0 53 96.5 54 73.0 55 51.5 56 34.0 57 27.0 58 24.0 59 19.0 60 13.5 61 12.0 62 8.0 63 4.5 64 2.5 65 1.5 66 2.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.2508780732563974 0.5 3 0.050175614651279475 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.3 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.725 0.0 0.0 0.0 0.0 130-131 0.725 0.0 0.0 0.0 0.0 132-133 0.75 0.0 0.0 0.0 0.0 134-135 0.8 0.0 0.0 0.0 0.0 136-137 0.95 0.0 0.0 0.0 0.0 138-139 1.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941185 spots for SRR7169116.sra Written 941185 spots for SRR7169116.sra Read 941194 spots for SRR7169116.sra Written 941194 spots for SRR7169116.sra SRR ids: ['SRR7169116.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6qqn9o7x SRR7169116.sra spots: 18823709 blocks: [[1, 941185], [941186, 1882370], [1882371, 2823555], [2823556, 3764740], [3764741, 4705925], [4705926, 5647110], [5647111, 6588295], [6588296, 7529480], [7529481, 8470665], [8470666, 9411850], [9411851, 10353035], [10353036, 11294220], [11294221, 12235405], [12235406, 13176590], [13176591, 14117775], [14117776, 15058960], [15058961, 16000145], [16000146, 16941330], [16941331, 17882515], [17882516, 18823709]] SRR7169116 file size 6357036 SRR7169116 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169116 SRR7169116_1.fastq SRR7169116_2.fastq Input file: SRR7169116_1.fastq Paired file: SRR7169116_2.fastq trimmed: SRR7169116-trimmed-pair1.fastq, SRR7169116-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:15:41 2025 >> started Mon Feb 10 22:16:18 2025 >> done (36.868s) 18823709 read pairs processed; of these: 18212 ( 0.10%) short read pairs filtered out after trimming by size control 11082 ( 0.06%) empty read pairs filtered out after trimming by size control 18794415 (99.84%) read pairs available; of these: 9382384 (49.92%) trimmed read pairs available after processing 9412031 (50.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 9 0.00% 21 6 0.00% 22 7 0.00% 23 5 0.00% 24 3 0.00% 25 6 0.00% 26 8 0.00% 27 14 0.00% 28 2 0.00% 29 4 0.00% 30 8 0.00% 31 8 0.00% 32 2 0.00% 33 7 0.00% 34 8 0.00% 35 9 0.00% 36 11 0.00% 37 13 0.00% 38 10 0.00% 39 13 0.00% 40 12 0.00% 41 13 0.00% 42 18 0.00% 43 18 0.00% 44 21 0.00% 45 24 0.00% 46 33 0.00% 47 30 0.00% 48 26 0.00% 49 25 0.00% 50 37 0.00% 51 27 0.00% 52 39 0.00% 53 41 0.00% 54 59 0.00% 55 44 0.00% 56 65 0.00% 57 54 0.00% 58 66 0.00% 59 65 0.00% 60 75 0.00% 61 91 0.00% 62 118 0.00% 63 118 0.00% 64 143 0.00% 65 167 0.00% 66 161 0.00% 67 179 0.00% 68 178 0.00% 69 242 0.00% 70 274 0.00% 71 285 0.00% 72 302 0.00% 73 355 0.00% 74 349 0.00% 75 425 0.00% 76 455 0.00% 77 497 0.00% 78 542 0.00% 79 647 0.00% 80 729 0.00% 81 874 0.00% 82 976 0.01% 83 1092 0.01% 84 2013 0.01% 85 2419 0.01% 86 2542 0.01% 87 2786 0.01% 88 3121 0.02% 89 3102 0.02% 90 3160 0.02% 91 3414 0.02% 92 3557 0.02% 93 3705 0.02% 94 3877 0.02% 95 4114 0.02% 96 4410 0.02% 97 4567 0.02% 98 4735 0.03% 99 5291 0.03% 100 5560 0.03% 101 5937 0.03% 102 6398 0.03% 103 6706 0.04% 104 7210 0.04% 105 7653 0.04% 106 8115 0.04% 107 8723 0.05% 108 9254 0.05% 109 9763 0.05% 110 10349 0.06% 111 11050 0.06% 112 11743 0.06% 113 12729 0.07% 114 13513 0.07% 115 14074 0.07% 116 15091 0.08% 117 15881 0.08% 118 16810 0.09% 119 17536 0.09% 120 18430 0.10% 121 19581 0.10% 122 21204 0.11% 123 22643 0.12% 124 24477 0.13% 125 26216 0.14% 126 28121 0.15% 127 30235 0.16% 128 32179 0.17% 129 34737 0.18% 130 37100 0.20% 131 39727 0.21% 132 43429 0.23% 133 47617 0.25% 134 51879 0.28% 135 56479 0.30% 136 62434 0.33% 137 68622 0.37% 138 75300 0.40% 139 84271 0.45% 140 94326 0.50% 141 106843 0.57% 142 123709 0.66% 143 144216 0.77% 144 174702 0.93% 145 216903 1.15% 146 278881 1.48% 147 389031 2.07% 148 599622 3.19% 149 1168308 6.22% 150 4980098 26.50% 151 9412031 50.08% 18794415 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=32 prefix-density=0.27 prefix-fanout=2.5 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCAGGTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=66.70 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=7.1 sequence=AACAATCTTACATCAAATTACAAGCACGTATGGTCTTGTAATATTTGCAGTAAACCGAGCTTTTTTTTCTAAAAAGGAAGAAAAACAGTAGATGGACATAACCAAACAAGCCACACATCAAGCATCATCATCACCGTTCTATAGAACACAAGAATACTGCCTGCTGCCCTACTGGGAAGCACTCTCCTTTTCTTTCTCCTTCTC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=37 prefix-density=0.30 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.13 sequence-density-rank=17 fanout-score=47.41 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=12.4 sequence=TGTTGGTGGTGG SRR7169116 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:17:16 Started mapping on | Feb 10 22:17:16 Finished on | Feb 10 22:19:55 Mapping speed, Million of reads per hour | 425.53 Number of input reads | 18794415 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17804541 Uniquely mapped reads % | 94.73% Average mapped length | 296.53 Number of splices: Total | 16774364 Number of splices: Annotated (sjdb) | 16505865 Number of splices: GT/AG | 16540430 Number of splices: GC/AG | 186837 Number of splices: AT/AC | 12618 Number of splices: Non-canonical | 34479 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 345418 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 82863 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.91% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 665206 665206 665206 N_multimapping 345418 345418 345418 N_noFeature 407927 17600114 499407 N_ambiguous 188630 1302 74683 UnstrandedReadsAssigned:17207984 PositiveStrandReadsAssigned:203125 NegativeStrandReadsAssigned:17230451 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169116 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169116-trimmed-pair1.fastq SRR7169116-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,794,415 reads, 17,141,092 reads pseudoaligned [quant] estimated average fragment length: 281.556 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52401 SRR7169116.ke.tsv 34699 SRR7169116.se.tsv 87100 total ==> SRR7169116.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.44 242 7.38426 Potri.005G024800.1.v4.1 1035 754.444 30 2.10813 Potri.004G059700.1.v4.1 961 680.517 3 0.233714 Potri.007G009000.2.v4.1 1416 1135.44 0 0 Potri.003G141000.2.v4.1 2943 2662.44 316 6.29229 Potri.016G087400.1.v4.1 270 59.5484 1529 1361.26 Potri.015G069301.1.v4.1 564 292.677 0 0 Potri.010G195200.1.v4.1 1773 1492.44 35 1.24329 Potri.012G127500.1.v4.1 977 696.489 7435 565.938 ==> SRR7169116.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2097 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 316 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169116 completed mapping pipeline successfully