Starting /dee2/code/volunteer_pipeline.sh SRR7169117 current disk space = 3057470230528 free memory = 1143842108 SRR7169117 SRAfilesize c9db1e7a2ae5dd99d9f9c106526db38b SRR7169117.sra SRR7169117.sra file validated SRR7169117 is paired end SRR7169117 is conventional basespace SRR7169117 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169117_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84 34.0 33.0 34.0 33.0 34.0 2 33.33125 34.0 33.0 34.0 33.0 34.0 3 33.35125 34.0 33.0 34.0 33.0 34.0 4 33.4025 34.0 33.0 34.0 33.0 34.0 5 33.448 34.0 33.0 34.0 33.0 34.0 6 36.84925 38.0 37.0 38.0 35.0 38.0 7 37.259 38.0 38.0 38.0 36.0 38.0 8 37.3235 38.0 38.0 38.0 37.0 38.0 9 37.469 38.0 38.0 38.0 37.0 38.0 10-14 37.4508 38.0 38.0 38.0 37.0 38.0 15-19 37.365849999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.333600000000004 38.0 38.0 38.0 36.6 38.0 25-29 37.2638 38.0 38.0 38.0 36.8 38.0 30-34 37.26205 38.0 38.0 38.0 36.4 38.0 35-39 37.131 38.0 38.0 38.0 36.2 38.0 40-44 36.8502 38.0 38.0 38.0 35.0 38.0 45-49 36.64765 38.0 38.0 38.0 34.2 38.0 50-54 36.57475 38.0 38.0 38.0 34.0 38.0 55-59 36.46515 38.0 37.6 38.0 34.0 38.0 60-64 36.363099999999996 38.0 37.0 38.0 33.6 38.0 65-69 36.30935 38.0 37.0 38.0 33.4 38.0 70-74 36.1897 38.0 37.0 38.0 33.0 38.0 75-79 36.05310000000001 38.0 37.0 38.0 33.0 38.0 80-84 35.837450000000004 38.0 37.0 38.0 31.0 38.0 85-89 35.7823 38.0 36.6 38.0 31.0 38.0 90-94 35.51025 38.0 36.0 38.0 29.4 38.0 95-99 35.41215 38.0 36.0 38.0 29.0 38.0 100-104 35.246449999999996 38.0 36.0 38.0 29.0 38.0 105-109 34.89645 38.0 35.2 38.0 27.8 38.0 110-114 34.6806 38.0 35.0 38.0 26.6 38.0 115-119 34.4105 38.0 34.6 38.0 25.8 38.0 120-124 34.043000000000006 38.0 34.0 38.0 23.0 38.0 125-129 33.731300000000005 38.0 33.8 38.0 20.0 38.0 130-134 33.20155 38.0 33.8 38.0 17.4 38.0 135-139 32.50675 37.0 33.0 38.0 15.0 38.0 140-144 31.981150000000003 36.0 31.8 38.0 14.2 38.0 145-149 31.068900000000003 36.0 31.6 38.0 9.0 38.0 150-151 26.62825 34.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 2.0 13 2.0 14 2.0 15 2.0 16 4.0 17 4.0 18 8.0 19 10.0 20 8.0 21 13.0 22 12.0 23 17.0 24 22.0 25 19.0 26 26.0 27 34.0 28 39.0 29 41.0 30 82.0 31 109.0 32 120.0 33 180.0 34 244.0 35 484.0 36 1068.0 37 1447.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.25699745547074 14.096692111959289 9.84732824427481 32.79898218829517 2 23.724999999999998 15.125 32.9 28.249999999999996 3 19.950000000000003 19.825 27.625 32.6 4 22.475 27.750000000000004 24.7 25.074999999999996 5 23.525 32.1 23.925 20.45 6 19.3 34.875 25.374999999999996 20.45 7 15.15 28.775000000000002 39.45 16.625 8 17.175 27.05 29.549999999999997 26.224999999999998 9 16.950000000000003 26.275 33.475 23.3 10-14 20.175 29.875 27.084999999999997 22.865 15-19 19.625 29.37 27.605 23.400000000000002 20-24 20.01 28.349999999999998 27.33 24.310000000000002 25-29 19.38 29.38 27.400000000000002 23.84 30-34 19.689999999999998 29.409999999999997 27.389999999999997 23.51 35-39 20.19 28.689999999999998 26.805 24.315 40-44 20.29 28.884999999999998 27.134999999999998 23.69 45-49 20.115 28.299999999999997 27.555000000000003 24.03 50-54 19.935 28.95 27.07 24.044999999999998 55-59 20.51 28.144999999999996 27.175 24.169999999999998 60-64 20.445 28.000000000000004 27.42 24.135 65-69 20.26 28.305000000000003 27.615000000000002 23.82 70-74 20.085 28.975 27.26 23.68 75-79 20.94 28.22 27.345000000000002 23.494999999999997 80-84 20.615 29.38 26.26 23.745 85-89 20.24 28.139999999999997 27.325 24.295 90-94 20.244999999999997 29.080000000000002 27.26 23.415 95-99 20.405 27.955000000000002 27.465 24.175 100-104 20.04 28.945 27.61 23.405 105-109 20.505000000000003 28.199999999999996 27.57 23.724999999999998 110-114 20.515 28.455000000000002 27.185 23.845 115-119 20.655 28.405 27.245 23.695 120-124 20.880000000000003 28.544999999999998 27.415 23.16 125-129 20.775 28.09 27.515 23.62 130-134 21.555 28.43 26.87 23.145 135-139 21.14605730286514 28.39141957097855 26.511325566278316 23.951197559877993 140-144 20.91 28.544999999999998 27.01 23.535 145-149 20.96 28.235 26.96 23.845 150-151 20.4875 28.749999999999996 26.6125 24.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 1.5 20 0.0 21 0.5 22 0.5 23 1.0 24 3.0 25 4.0 26 5.5 27 6.0 28 5.5 29 12.0 30 18.5 31 26.0 32 37.0 33 42.5 34 46.0 35 68.5 36 95.0 37 106.5 38 122.5 39 160.5 40 189.0 41 214.5 42 239.0 43 240.5 44 258.5 45 254.5 46 252.5 47 267.5 48 240.5 49 195.0 50 167.5 51 156.5 52 139.0 53 102.5 54 75.0 55 57.5 56 41.5 57 40.0 58 31.5 59 19.0 60 14.5 61 9.0 62 3.5 63 5.5 64 6.5 65 4.5 66 2.5 67 0.5 68 1.5 69 2.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.42500000000000004 0.0 0.0 0.0 0.0 120-121 0.45 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.6 0.0 0.0 0.0 0.0 126-127 0.6 0.0 0.0 0.0 0.0 128-129 0.6375 0.0 0.0 0.0 0.0 130-131 0.6625000000000001 0.0 0.0 0.0 0.0 132-133 0.7124999999999999 0.0 0.0 0.0 0.0 134-135 0.7375 0.0 0.0 0.0 0.0 136-137 0.8500000000000001 0.0 0.0 0.0 0.0 138-139 0.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169117 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169117_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.59575 33.0 33.0 34.0 32.0 34.0 2 32.79675 33.0 33.0 34.0 32.0 34.0 3 32.8115 34.0 33.0 34.0 32.0 34.0 4 32.75525 34.0 33.0 34.0 32.0 34.0 5 32.78475 34.0 33.0 34.0 32.0 34.0 6 36.95525 38.0 38.0 38.0 36.0 38.0 7 36.9435 38.0 38.0 38.0 36.0 38.0 8 36.973 38.0 38.0 38.0 37.0 38.0 9 37.05 38.0 38.0 38.0 36.0 38.0 10-14 36.9512 38.0 38.0 38.0 36.2 38.0 15-19 36.9112 38.0 38.0 38.0 36.0 38.0 20-24 36.85745000000001 38.0 38.0 38.0 36.0 38.0 25-29 36.89475 38.0 38.0 38.0 36.2 38.0 30-34 36.863099999999996 38.0 38.0 38.0 36.2 38.0 35-39 36.78925 38.0 38.0 38.0 36.0 38.0 40-44 36.725 38.0 38.0 38.0 35.8 38.0 45-49 36.7733 38.0 38.0 38.0 36.0 38.0 50-54 36.7005 38.0 38.0 38.0 35.8 38.0 55-59 36.71490000000001 38.0 38.0 38.0 35.8 38.0 60-64 36.66160000000001 38.0 38.0 38.0 35.6 38.0 65-69 36.662349999999996 38.0 38.0 38.0 35.2 38.0 70-74 36.524899999999995 38.0 38.0 38.0 34.8 38.0 75-79 36.43085 38.0 38.0 38.0 34.2 38.0 80-84 36.3164 38.0 38.0 38.0 34.0 38.0 85-89 36.31185000000001 38.0 38.0 38.0 34.0 38.0 90-94 36.193650000000005 38.0 38.0 38.0 34.0 38.0 95-99 36.00705000000001 38.0 38.0 38.0 33.2 38.0 100-104 35.934200000000004 38.0 38.0 38.0 33.2 38.0 105-109 35.7698 38.0 37.6 38.0 32.2 38.0 110-114 35.65115 38.0 37.0 38.0 31.2 38.0 115-119 35.47405 38.0 37.0 38.0 31.0 38.0 120-124 35.3321 38.0 37.0 38.0 29.6 38.0 125-129 34.979 38.0 36.2 38.0 28.0 38.0 130-134 34.808 38.0 36.0 38.0 27.8 38.0 135-139 34.5096 38.0 36.0 38.0 25.8 38.0 140-144 34.067899999999995 38.0 35.0 38.0 23.2 38.0 145-149 33.2234 38.0 34.8 38.0 15.6 38.0 150-151 29.5875 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 2.0 5 5.0 6 1.0 7 2.0 8 0.0 9 5.0 10 1.0 11 2.0 12 4.0 13 6.0 14 6.0 15 4.0 16 5.0 17 2.0 18 9.0 19 10.0 20 6.0 21 7.0 22 12.0 23 11.0 24 16.0 25 15.0 26 22.0 27 31.0 28 29.0 29 43.0 30 51.0 31 57.0 32 85.0 33 87.0 34 133.0 35 229.0 36 482.0 37 2608.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.05951487871968 24.23105776444111 12.953238309577394 24.756189047261813 2 28.35708927231808 27.60690172543136 26.93173293323331 17.104276069017253 3 20.980245061265315 30.532633158289574 28.657164291072768 19.829957489372344 4 24.0 34.125 23.325000000000003 18.55 5 24.2 36.4 21.4 18.0 6 21.55 37.775 23.125 17.549999999999997 7 20.025000000000002 22.325 38.3 19.35 8 22.55 25.75 26.825 24.875 9 21.975 24.85 30.125 23.05 10-14 23.669999999999998 28.29 26.135 21.905 15-19 23.41 27.810000000000002 27.38 21.4 20-24 23.23 28.13 27.195000000000004 21.445 25-29 23.21 28.575 27.295 20.919999999999998 30-34 23.66 27.675 27.400000000000002 21.265 35-39 23.04 28.54 26.665 21.755 40-44 23.43 27.825 27.415 21.33 45-49 23.425 27.54 27.6 21.435000000000002 50-54 23.595 27.87 27.42 21.115000000000002 55-59 23.91 27.595 27.52 20.974999999999998 60-64 23.73 26.924999999999997 28.04 21.305 65-69 23.05 28.395 27.76 20.794999999999998 70-74 23.605 27.189999999999998 27.83 21.375 75-79 23.22777527640202 27.58016909300115 27.840312171694432 21.351743458902398 80-84 24.104999999999997 27.815 27.785 20.294999999999998 85-89 23.985 27.87 27.52 20.625 90-94 23.785 26.815 28.035 21.365000000000002 95-99 23.849999999999998 27.57 27.694999999999997 20.885 100-104 24.169999999999998 27.625 27.544999999999998 20.66 105-109 24.205 27.02 28.000000000000004 20.775 110-114 24.224999999999998 27.27 27.794999999999998 20.71 115-119 23.695 27.715 27.994999999999997 20.595 120-124 23.665 27.76 27.51 21.065 125-129 24.235 27.834999999999997 26.96 20.97 130-134 23.43 26.889999999999997 28.415000000000003 21.265 135-139 23.54 27.534999999999997 27.894999999999996 21.029999999999998 140-144 23.515 27.455000000000002 27.71 21.32 145-149 24.041741922536623 27.563716636564315 27.172386112783464 21.222155328115594 150-151 24.247765327961726 27.09303789500189 27.823240589198033 20.83595618783835 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 2.0 25 1.0 26 0.5 27 1.0 28 4.0 29 5.0 30 5.5 31 10.0 32 16.0 33 20.0 34 23.0 35 50.0 36 65.0 37 79.0 38 122.5 39 158.0 40 197.5 41 240.0 42 267.5 43 281.5 44 290.5 45 277.5 46 267.5 47 267.5 48 241.0 49 218.0 50 202.5 51 160.0 52 128.0 53 108.0 54 79.0 55 55.5 56 39.5 57 37.5 58 26.5 59 13.0 60 13.0 61 9.5 62 3.5 63 1.5 64 2.0 65 3.0 66 2.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.055 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.33999999999999997 150-151 0.7125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.42500000000000004 0.0 0.0 0.0 0.0 120-121 0.45 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.575 0.0 0.0 0.0 0.0 128-129 0.6125 0.0 0.0 0.0 0.0 130-131 0.6375 0.0 0.0 0.0 0.0 132-133 0.6875 0.0 0.0 0.0 0.0 134-135 0.7124999999999999 0.0 0.0 0.0 0.0 136-137 0.825 0.0 0.0 0.0 0.0 138-139 0.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAGCC 10 0.006830828 145.0 5 >>END_MODULE Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840628 spots for SRR7169117.sra Written 840628 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra Read 840615 spots for SRR7169117.sra Written 840615 spots for SRR7169117.sra SRR ids: ['SRR7169117.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_45oad6ea SRR7169117.sra spots: 16812313 blocks: [[1, 840615], [840616, 1681230], [1681231, 2521845], [2521846, 3362460], [3362461, 4203075], [4203076, 5043690], [5043691, 5884305], [5884306, 6724920], [6724921, 7565535], [7565536, 8406150], [8406151, 9246765], [9246766, 10087380], [10087381, 10927995], [10927996, 11768610], [11768611, 12609225], [12609226, 13449840], [13449841, 14290455], [14290456, 15131070], [15131071, 15971685], [15971686, 16812313]] SRR7169117 file size 5675440 SRR7169117 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169117 SRR7169117_1.fastq SRR7169117_2.fastq Input file: SRR7169117_1.fastq Paired file: SRR7169117_2.fastq trimmed: SRR7169117-trimmed-pair1.fastq, SRR7169117-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:37:16 2025 >> started Mon Feb 10 22:37:36 2025 >> done (19.920s) 16812313 read pairs processed; of these: 26930 ( 0.16%) short read pairs filtered out after trimming by size control 21630 ( 0.13%) empty read pairs filtered out after trimming by size control 16763753 (99.71%) read pairs available; of these: 7855815 (46.86%) trimmed read pairs available after processing 8907938 (53.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 1 0.00% 21 4 0.00% 22 6 0.00% 23 6 0.00% 24 13 0.00% 25 6 0.00% 26 6 0.00% 27 10 0.00% 28 4 0.00% 29 8 0.00% 30 15 0.00% 31 10 0.00% 32 7 0.00% 33 12 0.00% 34 11 0.00% 35 13 0.00% 36 15 0.00% 37 8 0.00% 38 9 0.00% 39 12 0.00% 40 11 0.00% 41 15 0.00% 42 19 0.00% 43 27 0.00% 44 22 0.00% 45 30 0.00% 46 40 0.00% 47 27 0.00% 48 31 0.00% 49 44 0.00% 50 44 0.00% 51 49 0.00% 52 48 0.00% 53 46 0.00% 54 64 0.00% 55 69 0.00% 56 60 0.00% 57 86 0.00% 58 100 0.00% 59 95 0.00% 60 104 0.00% 61 119 0.00% 62 153 0.00% 63 114 0.00% 64 120 0.00% 65 147 0.00% 66 163 0.00% 67 190 0.00% 68 228 0.00% 69 250 0.00% 70 277 0.00% 71 316 0.00% 72 323 0.00% 73 372 0.00% 74 359 0.00% 75 473 0.00% 76 497 0.00% 77 555 0.00% 78 604 0.00% 79 672 0.00% 80 797 0.00% 81 844 0.01% 82 978 0.01% 83 1239 0.01% 84 2303 0.01% 85 2975 0.02% 86 3057 0.02% 87 3058 0.02% 88 3150 0.02% 89 3199 0.02% 90 3260 0.02% 91 3288 0.02% 92 3429 0.02% 93 3575 0.02% 94 3868 0.02% 95 4032 0.02% 96 4290 0.03% 97 4585 0.03% 98 4874 0.03% 99 5198 0.03% 100 5348 0.03% 101 5573 0.03% 102 6199 0.04% 103 6351 0.04% 104 6808 0.04% 105 7309 0.04% 106 7889 0.05% 107 8224 0.05% 108 8776 0.05% 109 9335 0.06% 110 9853 0.06% 111 10693 0.06% 112 11451 0.07% 113 12077 0.07% 114 12623 0.08% 115 13599 0.08% 116 14316 0.09% 117 15121 0.09% 118 16185 0.10% 119 17019 0.10% 120 17915 0.11% 121 19074 0.11% 122 20443 0.12% 123 21744 0.13% 124 23261 0.14% 125 24485 0.15% 126 26549 0.16% 127 28173 0.17% 128 30322 0.18% 129 32359 0.19% 130 34548 0.21% 131 37644 0.22% 132 40461 0.24% 133 44811 0.27% 134 47503 0.28% 135 51518 0.31% 136 56862 0.34% 137 62878 0.38% 138 70376 0.42% 139 78469 0.47% 140 86787 0.52% 141 97884 0.58% 142 113514 0.68% 143 124235 0.74% 144 146399 0.87% 145 178803 1.07% 146 226846 1.35% 147 315602 1.88% 148 486233 2.90% 149 974740 5.81% 150 4061482 24.23% 151 8907938 53.14% 16763753 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=36 prefix-density=0.22 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=342.82 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=18.0 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=40 prefix-density=0.25 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=125.49 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=12.5 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTTCTCGAGAAGATCAAGGAGA SRR7169117 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:38:25 Started mapping on | Feb 10 22:38:26 Finished on | Feb 10 22:40:49 Mapping speed, Million of reads per hour | 422.02 Number of input reads | 16763753 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15577858 Uniquely mapped reads % | 92.93% Average mapped length | 296.38 Number of splices: Total | 14588196 Number of splices: Annotated (sjdb) | 14361927 Number of splices: GT/AG | 14386089 Number of splices: GC/AG | 163336 Number of splices: AT/AC | 11031 Number of splices: Non-canonical | 27740 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 302355 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 15558 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.15% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 909267 909267 909267 N_multimapping 302355 302355 302355 N_noFeature 284456 15402369 361508 N_ambiguous 160056 1217 60692 UnstrandedReadsAssigned:15133346 PositiveStrandReadsAssigned:174272 NegativeStrandReadsAssigned:15155658 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169117 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169117-trimmed-pair1.fastq SRR7169117-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,763,753 reads, 15,073,554 reads pseudoaligned [quant] estimated average fragment length: 281.142 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR7169117.ke.tsv 34699 SRR7169117.se.tsv 87100 total ==> SRR7169117.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.86 284 9.09217 Potri.005G024800.1.v4.1 1035 754.858 29 2.13745 Potri.004G059700.1.v4.1 961 680.899 1 0.081711 Potri.007G009000.2.v4.1 1416 1135.86 0 0 Potri.003G141000.2.v4.1 2943 2662.86 261 5.45326 Potri.016G087400.1.v4.1 270 58.7309 1342 1271.3 Potri.015G069301.1.v4.1 564 290.952 0 0 Potri.010G195200.1.v4.1 1773 1492.86 15 0.559032 Potri.012G127500.1.v4.1 977 696.882 6457 515.508 ==> SRR7169117.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1282 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 220 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169117 completed mapping pipeline successfully