Starting /dee2/code/volunteer_pipeline.sh SRR7169118 current disk space = 3057640312832 free memory = 1200609932 SRR7169118 SRAfilesize af6443dfe4d241cfe9856f4f720c8709 SRR7169118.sra SRR7169118.sra file validated SRR7169118 is paired end SRR7169118 is conventional basespace SRR7169118 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169118_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1655 34.0 33.0 34.0 33.0 34.0 2 33.4815 34.0 34.0 34.0 33.0 34.0 3 33.54625 34.0 34.0 34.0 33.0 34.0 4 33.5535 34.0 34.0 34.0 33.0 34.0 5 33.5315 34.0 34.0 34.0 33.0 34.0 6 37.26825 38.0 38.0 38.0 36.0 38.0 7 37.4415 38.0 38.0 38.0 37.0 38.0 8 37.512 38.0 38.0 38.0 37.0 38.0 9 37.55875 38.0 38.0 38.0 38.0 38.0 10-14 37.52225 38.0 38.0 38.0 37.6 38.0 15-19 37.445949999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.4403 38.0 38.0 38.0 37.0 38.0 25-29 37.40525 38.0 38.0 38.0 37.0 38.0 30-34 37.26845 38.0 38.0 38.0 37.0 38.0 35-39 37.19955 38.0 38.0 38.0 36.6 38.0 40-44 36.83275 38.0 38.0 38.0 35.2 38.0 45-49 36.61465 38.0 38.0 38.0 34.2 38.0 50-54 36.4516 38.0 38.0 38.0 34.0 38.0 55-59 36.425200000000004 38.0 37.8 38.0 34.0 38.0 60-64 36.354850000000006 38.0 37.4 38.0 33.6 38.0 65-69 36.235 38.0 37.0 38.0 33.2 38.0 70-74 36.16035 38.0 37.0 38.0 33.0 38.0 75-79 35.980549999999994 38.0 37.0 38.0 32.8 38.0 80-84 35.927 38.0 37.0 38.0 32.2 38.0 85-89 35.68455 38.0 37.0 38.0 30.6 38.0 90-94 35.324149999999996 38.0 36.2 38.0 29.0 38.0 95-99 35.368700000000004 38.0 36.0 38.0 29.0 38.0 100-104 34.8916 38.0 35.6 38.0 27.8 38.0 105-109 34.777150000000006 38.0 35.8 38.0 27.0 38.0 110-114 34.336200000000005 38.0 34.8 38.0 24.2 38.0 115-119 34.159800000000004 38.0 34.8 38.0 23.6 38.0 120-124 33.87475 38.0 34.2 38.0 22.4 38.0 125-129 33.376599999999996 38.0 33.8 38.0 18.6 38.0 130-134 32.93044999999999 38.0 33.4 38.0 15.0 38.0 135-139 32.659499999999994 37.8 33.2 38.0 14.6 38.0 140-144 31.944599999999998 36.6 32.0 38.0 14.0 38.0 145-149 30.9697 36.0 31.0 38.0 8.6 38.0 150-151 27.134625 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 2.0 10 1.0 11 0.0 12 1.0 13 2.0 14 6.0 15 6.0 16 8.0 17 3.0 18 11.0 19 15.0 20 10.0 21 12.0 22 16.0 23 16.0 24 20.0 25 28.0 26 21.0 27 31.0 28 40.0 29 51.0 30 67.0 31 95.0 32 109.0 33 151.0 34 269.0 35 430.0 36 994.0 37 1583.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.4243803743045 14.618108244815378 9.939301972685888 32.01820940819423 2 24.65 13.875000000000002 31.7 29.775000000000002 3 18.8 19.5 29.099999999999998 32.6 4 21.099999999999998 27.900000000000002 23.724999999999998 27.275 5 22.0 31.15 24.725 22.125 6 20.349999999999998 33.650000000000006 25.55 20.45 7 14.575 28.775000000000002 39.074999999999996 17.575 8 17.299999999999997 28.375 31.125000000000004 23.200000000000003 9 17.150000000000002 26.625 34.150000000000006 22.075 10-14 18.83 31.424999999999997 27.32 22.425 15-19 19.3 30.009999999999998 27.339999999999996 23.35 20-24 19.155 30.264999999999997 26.995 23.585 25-29 19.25 30.080000000000002 27.29 23.380000000000003 30-34 18.995 30.235 27.01 23.76 35-39 19.2 30.240000000000002 27.015 23.544999999999998 40-44 19.994999999999997 29.37 27.57 23.064999999999998 45-49 19.735 29.635 26.855 23.775 50-54 19.615 29.925 26.705000000000002 23.755000000000003 55-59 19.689999999999998 29.759999999999998 26.855 23.695 60-64 20.419999999999998 29.45 26.8 23.330000000000002 65-69 19.400000000000002 29.585 27.500000000000004 23.515 70-74 19.835 29.2 27.115000000000002 23.849999999999998 75-79 20.26 28.9 27.27 23.57 80-84 20.055 29.630000000000003 26.534999999999997 23.78 85-89 20.31 29.28 26.8 23.61 90-94 20.265 29.17 26.834999999999997 23.73 95-99 19.62 29.020000000000003 27.785 23.575 100-104 19.892903613251928 28.981082974677207 27.3946551896707 23.73135822240016 105-109 20.115 28.689999999999998 27.08 24.115000000000002 110-114 20.278389745643903 28.304626477067895 27.718806328860406 23.6981774484278 115-119 19.84 28.16 27.884999999999998 24.115000000000002 120-124 20.416333066453163 28.537830264211365 26.986589271417134 24.059247397918334 125-129 20.68206820682068 27.907790779077907 27.81278127812781 23.597359735973598 130-134 20.76 28.139999999999997 27.16 23.94 135-139 20.405 28.185 27.224999999999998 24.185000000000002 140-144 21.310000000000002 28.425 26.634999999999998 23.630000000000003 145-149 20.28 28.67 26.700000000000003 24.349999999999998 150-151 20.875 28.249999999999996 26.974999999999998 23.9 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.5 17 1.5 18 2.0 19 2.0 20 1.5 21 1.5 22 2.0 23 3.0 24 4.0 25 6.5 26 9.0 27 14.0 28 18.0 29 21.5 30 27.0 31 35.5 32 44.5 33 66.5 34 92.0 35 98.5 36 112.0 37 129.0 38 135.0 39 166.0 40 190.0 41 179.0 42 193.0 43 226.5 44 244.5 45 249.0 46 249.0 47 235.0 48 225.0 49 197.0 50 149.0 51 125.5 52 117.5 53 106.5 54 88.0 55 61.5 56 41.5 57 29.0 58 23.0 59 22.5 60 13.5 61 9.5 62 9.0 63 5.0 64 3.5 65 4.5 66 2.5 67 2.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.09 105-109 0.0 110-114 0.13999999999999999 115-119 0.0 120-124 0.08 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5534591194968553 1.0999999999999999 3 0.0 0.0 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0125 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.025 0.0 0.0 0.025 0.0 86-87 0.025 0.0 0.0 0.025 0.0 88-89 0.025 0.0 0.0 0.025 0.0 90-91 0.025 0.0 0.0 0.025 0.0 92-93 0.037500000000000006 0.0 0.0 0.025 0.0 94-95 0.05 0.0 0.0 0.025 0.0 96-97 0.05 0.0 0.0 0.025 0.0 98-99 0.05 0.0 0.0 0.025 0.0 100-101 0.075 0.0 0.0 0.025 0.0 102-103 0.0875 0.0 0.0 0.025 0.0 104-105 0.1125 0.0 0.0 0.025 0.0 106-107 0.1375 0.0 0.0 0.025 0.0 108-109 0.15 0.0 0.0 0.025 0.0 110-111 0.175 0.0 0.0 0.025 0.0 112-113 0.2375 0.0 0.0 0.025 0.0 114-115 0.3 0.0 0.0 0.025 0.0 116-117 0.32499999999999996 0.0 0.0 0.025 0.0 118-119 0.375 0.0 0.0 0.025 0.0 120-121 0.375 0.0 0.0 0.025 0.0 122-123 0.4375 0.0 0.0 0.025 0.0 124-125 0.575 0.0 0.0 0.025 0.0 126-127 0.6625000000000001 0.0 0.0 0.025 0.0 128-129 0.8 0.0 0.0 0.025 0.0 130-131 1.0375 0.0 0.0 0.025 0.0 132-133 1.05 0.0 0.0 0.025 0.0 134-135 1.1375 0.0 0.0 0.025 0.0 136-137 1.25 0.0 0.0 0.025 0.0 138-139 1.3125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGATAA 10 0.006832588 144.9875 6 GGATAAA 10 0.006832588 144.9875 7 >>END_MODULE SRR7169118 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169118_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.03975 33.0 32.0 33.0 27.0 34.0 2 31.386 33.0 32.0 33.0 27.0 34.0 3 31.4205 33.0 32.0 33.0 27.0 34.0 4 31.278 33.0 32.0 33.0 27.0 34.0 5 31.22 33.0 32.0 33.0 27.0 34.0 6 35.09625 38.0 36.0 38.0 29.0 38.0 7 35.472 38.0 36.0 38.0 29.0 38.0 8 35.54675 38.0 36.0 38.0 30.0 38.0 9 35.294 38.0 36.0 38.0 29.0 38.0 10-14 35.3066 38.0 36.0 38.0 29.0 38.0 15-19 35.1913 38.0 36.0 38.0 29.0 38.0 20-24 35.161150000000006 38.0 36.0 38.0 28.8 38.0 25-29 35.0822 38.0 36.0 38.0 28.8 38.0 30-34 34.753750000000004 38.0 35.6 38.0 27.6 38.0 35-39 34.612700000000004 38.0 35.0 38.0 27.0 38.0 40-44 34.5909 38.0 35.0 38.0 27.0 38.0 45-49 34.48995 38.0 35.2 38.0 25.8 38.0 50-54 34.259 38.0 34.6 38.0 25.2 38.0 55-59 34.06455 38.0 34.2 38.0 24.6 38.0 60-64 33.9697 38.0 34.0 38.0 23.0 38.0 65-69 33.669 38.0 34.0 38.0 16.0 38.0 70-74 33.578050000000005 38.0 34.0 38.0 16.0 38.0 75-79 33.35855 38.0 34.0 38.0 16.0 38.0 80-84 33.09825 38.0 33.4 38.0 16.0 38.0 85-89 32.88055 37.2 33.0 38.0 15.4 38.0 90-94 32.74025 37.0 33.0 38.0 15.0 38.0 95-99 32.461 37.0 32.2 38.0 15.0 38.0 100-104 32.13745 37.0 31.6 38.0 15.0 38.0 105-109 31.76205 37.0 30.0 38.0 15.0 38.0 110-114 31.18565 36.2 29.0 38.0 15.0 38.0 115-119 30.639550000000003 36.0 28.0 38.0 14.2 38.0 120-124 30.2138 35.8 27.2 38.0 13.2 38.0 125-129 29.42115 35.0 24.6 38.0 13.0 38.0 130-134 28.800099999999997 34.8 23.0 38.0 4.2 38.0 135-139 27.83055 34.0 19.8 38.0 2.0 38.0 140-144 26.682850000000002 34.0 14.2 38.0 2.0 38.0 145-149 24.91415 33.2 9.0 38.0 2.0 38.0 150-151 20.30925 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 15.0 4 8.0 5 6.0 6 7.0 7 4.0 8 9.0 9 13.0 10 18.0 11 13.0 12 11.0 13 11.0 14 8.0 15 18.0 16 15.0 17 24.0 18 32.0 19 17.0 20 35.0 21 39.0 22 33.0 23 39.0 24 65.0 25 56.0 26 59.0 27 69.0 28 85.0 29 99.0 30 138.0 31 188.0 32 218.0 33 327.0 34 422.0 35 622.0 36 776.0 37 477.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.63755020080321 24.046184738955823 13.328313253012048 21.987951807228914 2 29.389694847423716 27.463731865932967 25.512756378189096 17.63381690845423 3 21.810905452726363 29.289644822411205 29.364682341170585 19.534767383691847 4 24.725 33.75 23.1 18.425 5 24.48112028007002 35.50887721930482 22.13053263315829 17.879469867466867 6 22.575 37.425000000000004 22.650000000000002 17.349999999999998 7 22.1 23.25 35.275 19.375 8 23.525 25.174999999999997 26.224999999999998 25.074999999999996 9 22.675 25.874999999999996 28.525 22.925 10-14 24.39 28.625 25.82 21.165 15-19 24.27 28.235 26.695 20.8 20-24 23.66 28.895 26.82 20.625 25-29 24.22 28.29 26.715 20.775 30-34 23.94 28.804999999999996 26.325 20.93 35-39 23.765 28.22 27.155 20.86 40-44 23.815 28.17 27.439999999999998 20.575 45-49 24.075 28.33 26.810000000000002 20.785 50-54 23.787089013632716 27.937048917401764 26.96972734562951 21.306134723336008 55-59 23.859244013854727 27.40324280909593 27.503639375533357 21.233873801515987 60-64 23.782508283964255 27.834119891555375 27.638317100110456 20.745054724369915 65-69 24.74475682744053 27.601468591258865 27.360056329527737 20.293718251772873 70-74 24.520899351139278 27.906040943614506 26.859815904632562 20.71324380061365 75-79 24.114688128772634 27.711267605633804 27.736418511066397 20.437625754527165 80-84 24.326088047788765 27.945384267858035 27.47352040560213 20.255007278751066 85-89 24.70393416298675 27.423725411481332 27.569249297470893 20.30309112806102 90-94 24.388897254429555 27.706670682126184 27.842192440897456 20.062239622546805 95-99 24.158008332078502 28.037946092455957 27.59122622095066 20.21281935451488 100-104 24.531901008985493 28.191355855629734 26.96149791677125 20.315245218613523 105-109 23.80904573063601 28.402188645148335 26.926359118518146 20.862406505697507 110-114 24.02369240036141 28.144764581869293 27.667904828832445 20.163638188936854 115-119 24.156626506024097 27.89156626506024 27.434738955823295 20.51706827309237 120-124 24.77409638554217 27.886546184738958 26.867469879518076 20.471887550200805 125-129 24.135334571557653 28.52768435319512 27.112092766427388 20.22488830881984 130-134 23.875727765508934 28.09676771732584 27.283677976309978 20.743826540855252 135-139 23.619631901840492 28.376747460524992 27.330785477220154 20.672835160414362 140-144 24.178368312446523 28.501686043585483 27.20821380039257 20.11173184357542 145-149 24.28434391881658 28.040591710001518 27.53067097490786 20.144393396274044 150-151 24.686986214746426 27.734918426710507 27.077273302137346 20.500822056405717 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 1.5 21 2.0 22 3.0 23 3.5 24 4.5 25 5.0 26 6.0 27 8.0 28 8.0 29 7.0 30 9.0 31 12.5 32 14.5 33 20.5 34 29.0 35 45.5 36 66.0 37 89.0 38 126.0 39 158.5 40 182.5 41 202.0 42 218.5 43 261.0 44 287.0 45 278.5 46 281.0 47 284.5 48 262.0 49 217.0 50 181.0 51 152.0 52 126.0 53 110.5 54 91.5 55 66.5 56 44.5 57 29.0 58 21.0 59 17.5 60 17.0 61 13.5 62 8.5 63 6.5 64 5.5 65 4.5 66 2.0 67 1.0 68 1.5 69 1.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.05 3 0.05 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.24 55-59 0.395 60-64 0.41000000000000003 65-69 0.585 70-74 0.5950000000000001 75-79 0.6 80-84 0.395 85-89 0.36 90-94 0.385 95-99 0.385 100-104 0.395 105-109 0.395 110-114 0.38999999999999996 115-119 0.4 120-124 0.4 125-129 0.395 130-134 0.38 135-139 0.5700000000000001 140-144 0.655 145-149 0.9650000000000001 150-151 1.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24395161290323 98.45 2 0.7056451612903225 1.4000000000000001 3 0.05040322580645161 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.6625000000000001 0.0 0.0 0.0 0.0 128-129 0.825 0.0 0.0 0.0 0.0 130-131 1.0625 0.0 0.0 0.0 0.0 132-133 1.075 0.0 0.0 0.0 0.0 134-135 1.1625 0.0 0.0 0.0 0.0 136-137 1.275 0.0 0.0 0.0 0.0 138-139 1.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAGTC 10 0.0068343505 144.975 3 >>END_MODULE Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537052 spots for SRR7169118.sra Written 537052 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra Read 537044 spots for SRR7169118.sra Written 537044 spots for SRR7169118.sra SRR ids: ['SRR7169118.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k3kzggiq SRR7169118.sra spots: 10740888 blocks: [[1, 537044], [537045, 1074088], [1074089, 1611132], [1611133, 2148176], [2148177, 2685220], [2685221, 3222264], [3222265, 3759308], [3759309, 4296352], [4296353, 4833396], [4833397, 5370440], [5370441, 5907484], [5907485, 6444528], [6444529, 6981572], [6981573, 7518616], [7518617, 8055660], [8055661, 8592704], [8592705, 9129748], [9129749, 9666792], [9666793, 10203836], [10203837, 10740888]] SRR7169118 file size 3618034 SRR7169118 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169118 SRR7169118_1.fastq SRR7169118_2.fastq Input file: SRR7169118_1.fastq Paired file: SRR7169118_2.fastq trimmed: SRR7169118-trimmed-pair1.fastq, SRR7169118-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:43:59 2025 >> started Mon Feb 10 22:44:10 2025 >> done (11.718s) 10740888 read pairs processed; of these: 39440 ( 0.37%) short read pairs filtered out after trimming by size control 32972 ( 0.31%) empty read pairs filtered out after trimming by size control 10668476 (99.33%) read pairs available; of these: 7632171 (71.54%) trimmed read pairs available after processing 3036305 (28.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 7 0.00% 21 7 0.00% 22 12 0.00% 23 7 0.00% 24 10 0.00% 25 12 0.00% 26 8 0.00% 27 8 0.00% 28 10 0.00% 29 21 0.00% 30 18 0.00% 31 19 0.00% 32 35 0.00% 33 30 0.00% 34 33 0.00% 35 23 0.00% 36 36 0.00% 37 39 0.00% 38 40 0.00% 39 49 0.00% 40 44 0.00% 41 53 0.00% 42 71 0.00% 43 60 0.00% 44 63 0.00% 45 85 0.00% 46 110 0.00% 47 95 0.00% 48 149 0.00% 49 131 0.00% 50 128 0.00% 51 173 0.00% 52 155 0.00% 53 191 0.00% 54 201 0.00% 55 226 0.00% 56 277 0.00% 57 261 0.00% 58 286 0.00% 59 299 0.00% 60 323 0.00% 61 383 0.00% 62 415 0.00% 63 440 0.00% 64 457 0.00% 65 566 0.01% 66 576 0.01% 67 635 0.01% 68 693 0.01% 69 816 0.01% 70 837 0.01% 71 918 0.01% 72 993 0.01% 73 1112 0.01% 74 1232 0.01% 75 1330 0.01% 76 1293 0.01% 77 1479 0.01% 78 1678 0.02% 79 1866 0.02% 80 2034 0.02% 81 1975 0.02% 82 2321 0.02% 83 2719 0.03% 84 4159 0.04% 85 4984 0.05% 86 5196 0.05% 87 5189 0.05% 88 5250 0.05% 89 5444 0.05% 90 5474 0.05% 91 5707 0.05% 92 6065 0.06% 93 6509 0.06% 94 6678 0.06% 95 7076 0.07% 96 7608 0.07% 97 8030 0.08% 98 8653 0.08% 99 8928 0.08% 100 9307 0.09% 101 8918 0.08% 102 9182 0.09% 103 9444 0.09% 104 10122 0.09% 105 10810 0.10% 106 11423 0.11% 107 12069 0.11% 108 12632 0.12% 109 13103 0.12% 110 13829 0.13% 111 14878 0.14% 112 15947 0.15% 113 16673 0.16% 114 17881 0.17% 115 19166 0.18% 116 20233 0.19% 117 21331 0.20% 118 23051 0.22% 119 24267 0.23% 120 25714 0.24% 121 27702 0.26% 122 29392 0.28% 123 31554 0.30% 124 34274 0.32% 125 36466 0.34% 126 39029 0.37% 127 41895 0.39% 128 45324 0.42% 129 48448 0.45% 130 52765 0.49% 131 57527 0.54% 132 61934 0.58% 133 66602 0.62% 134 72829 0.68% 135 80470 0.75% 136 88438 0.83% 137 97774 0.92% 138 106911 1.00% 139 117843 1.10% 140 131915 1.24% 141 147818 1.39% 142 169376 1.59% 143 194265 1.82% 144 228384 2.14% 145 268504 2.52% 146 330781 3.10% 147 437835 4.10% 148 630419 5.91% 149 1018714 9.55% 150 2485468 23.30% 151 3036305 28.46% 10668476 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=12.13 fanout-score-rank=14 prefix-density=0.27 prefix-fanout=5.4 sequence=TTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=349.49 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=23.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=7.09 fanout-score-rank=22 prefix-density=0.40 prefix-fanout=3.7 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=305.98 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=19.4 sequence=ACAAGAAGATCAACTGTCTCTCTGCCTGGTTTGTATTCCAAGAAATGGAGAAAGTCCAAAAGCTCTTTTGTGTGGCTCTATTGCTTGCAGTACTAGCCATAGCAAGCAATATTGCGAATGCCCAGAGTACCATATGCAAAATGCCTGTTGCTGGCCTAATGTCATGCAAGCCTTCTGTAACTCCTCCTAACCCTACCGCACCCTCGGCAGACTGCTGCTCGGCACTTTCGCATGCTGACATA SRR7169118 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:45:01 Started mapping on | Feb 10 22:45:01 Finished on | Feb 10 22:47:03 Mapping speed, Million of reads per hour | 314.81 Number of input reads | 10668476 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 9571140 Uniquely mapped reads % | 89.71% Average mapped length | 290.01 Number of splices: Total | 8189648 Number of splices: Annotated (sjdb) | 8045887 Number of splices: GT/AG | 8064458 Number of splices: GC/AG | 98547 Number of splices: AT/AC | 7371 Number of splices: Non-canonical | 19272 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 203313 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 19800 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.13% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 924860 924860 924860 N_multimapping 203313 203313 203313 N_noFeature 195620 9458028 237392 N_ambiguous 112737 733 41087 UnstrandedReadsAssigned:9262783 PositiveStrandReadsAssigned:112379 NegativeStrandReadsAssigned:9292661 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169118 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169118-trimmed-pair1.fastq SRR7169118-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,668,476 reads, 9,303,117 reads pseudoaligned [quant] estimated average fragment length: 259.093 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,229 rounds 52401 SRR7169118.ke.tsv 34699 SRR7169118.se.tsv 87100 total ==> SRR7169118.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.91 175 8.14732 Potri.005G024800.1.v4.1 1035 776.907 56 5.9059 Potri.004G059700.1.v4.1 961 702.927 1 0.116562 Potri.007G009000.2.v4.1 1416 1157.91 0 0 Potri.003G141000.2.v4.1 2943 2684.91 187 5.70662 Potri.016G087400.1.v4.1 270 62.8182 1091.72 1423.94 Potri.015G069301.1.v4.1 564 308.945 0 0 Potri.010G195200.1.v4.1 1773 1514.91 40 2.16342 Potri.012G127500.1.v4.1 977 718.917 6069 691.679 ==> SRR7169118.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 899 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 301 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169118 completed mapping pipeline successfully