Starting /dee2/code/volunteer_pipeline.sh SRR7169119 current disk space = 3057340964864 free memory = 1199922256 SRR7169119 SRAfilesize d85effb60b97756d6a00d0bb0c70e429 SRR7169119.sra SRR7169119.sra file validated SRR7169119 is paired end SRR7169119 is conventional basespace SRR7169119 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169119_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5525 34.0 33.0 34.0 32.0 34.0 2 33.16825 34.0 33.0 34.0 32.0 34.0 3 33.21525 34.0 33.0 34.0 31.0 34.0 4 33.36325 34.0 33.0 34.0 33.0 34.0 5 33.415 34.0 33.0 34.0 33.0 34.0 6 36.9905 38.0 37.0 38.0 36.0 38.0 7 37.31225 38.0 38.0 38.0 37.0 38.0 8 37.34625 38.0 38.0 38.0 37.0 38.0 9 37.3515 38.0 38.0 38.0 37.0 38.0 10-14 37.03920000000001 38.0 38.0 38.0 35.8 38.0 15-19 36.98235 38.0 38.0 38.0 36.0 38.0 20-24 37.302299999999995 38.0 38.0 38.0 36.8 38.0 25-29 37.13585 38.0 38.0 38.0 36.2 38.0 30-34 37.218450000000004 38.0 38.0 38.0 36.4 38.0 35-39 37.183550000000004 38.0 38.0 38.0 36.2 38.0 40-44 37.0122 38.0 38.0 38.0 35.8 38.0 45-49 36.80745 38.0 38.0 38.0 34.8 38.0 50-54 36.5971 38.0 37.8 38.0 34.2 38.0 55-59 36.227000000000004 38.0 37.0 38.0 33.0 38.0 60-64 36.4276 38.0 37.6 38.0 33.8 38.0 65-69 36.293099999999995 38.0 37.2 38.0 33.0 38.0 70-74 36.12955000000001 38.0 37.0 38.0 32.4 38.0 75-79 36.09675 38.0 37.0 38.0 32.2 38.0 80-84 36.1236 38.0 37.0 38.0 33.0 38.0 85-89 35.85945 38.0 36.8 38.0 31.0 38.0 90-94 35.59195 38.0 36.4 38.0 29.8 38.0 95-99 35.7081 38.0 36.6 38.0 30.6 38.0 100-104 35.15305 38.0 35.8 38.0 28.4 38.0 105-109 34.41295 38.0 34.8 38.0 23.6 38.0 110-114 34.78955 38.0 34.8 38.0 27.0 38.0 115-119 34.78705 38.0 35.0 38.0 27.0 38.0 120-124 34.3893 38.0 34.6 38.0 24.4 38.0 125-129 33.670249999999996 38.0 34.0 38.0 19.8 38.0 130-134 33.84065 38.0 34.0 38.0 23.0 38.0 135-139 33.494800000000005 38.0 34.0 38.0 20.2 38.0 140-144 32.38065 36.8 32.2 38.0 14.2 38.0 145-149 31.792450000000002 36.0 32.8 38.0 11.4 38.0 150-151 27.782249999999998 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 3.0 16 3.0 17 5.0 18 5.0 19 8.0 20 7.0 21 7.0 22 16.0 23 10.0 24 16.0 25 16.0 26 31.0 27 35.0 28 47.0 29 58.0 30 86.0 31 89.0 32 130.0 33 155.0 34 258.0 35 459.0 36 952.0 37 1601.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.2971033068444 12.535247372468596 9.023327351961036 37.14432196872597 2 25.0 13.175 32.375 29.45 3 20.325 16.55 26.55 36.575 4 22.525000000000002 24.65 23.875 28.95 5 24.474999999999998 30.475 22.825 22.225 6 21.55 33.7 23.200000000000003 21.55 7 15.325 28.7 39.4 16.575 8 17.299999999999997 27.700000000000003 31.4 23.599999999999998 9 16.75 25.6 34.475 23.175 10-14 19.595000000000002 29.675 27.944999999999997 22.785 15-19 19.465 28.725 27.834999999999997 23.974999999999998 20-24 20.19 28.825 27.565 23.419999999999998 25-29 19.805 28.810000000000002 27.465 23.919999999999998 30-34 20.13 28.925 27.205000000000002 23.74 35-39 19.52 28.34 27.71 24.43 40-44 19.895 29.015 27.095000000000002 23.995 45-49 19.98 28.305000000000003 27.544999999999998 24.169999999999998 50-54 20.285 28.549999999999997 27.744999999999997 23.419999999999998 55-59 19.88 27.805000000000003 27.715 24.6 60-64 20.13 28.59 27.565 23.715 65-69 19.98 28.15 27.77 24.099999999999998 70-74 20.201010050502525 28.271413570678533 27.86639331966598 23.661183059152957 75-79 20.805 27.965 27.38 23.849999999999998 80-84 20.4 28.785 27.200000000000003 23.615 85-89 20.515 29.17 27.21 23.105 90-94 20.855 28.53 26.745 23.87 95-99 20.025000000000002 28.025 28.244999999999997 23.705000000000002 100-104 20.205000000000002 28.249999999999996 27.29 24.255 105-109 20.455000000000002 27.96 27.605 23.98 110-114 20.821246373912174 28.00340102030609 27.498249474842453 23.67710313093928 115-119 20.369999999999997 28.435 27.500000000000004 23.695 120-124 21.02 28.16 27.32 23.5 125-129 20.9 27.87 27.655 23.575 130-134 20.64 27.275 28.275 23.810000000000002 135-139 20.62 27.965 27.38 24.035 140-144 20.82 28.29 27.18 23.71 145-149 20.86 28.139999999999997 27.515 23.485 150-151 20.7125 28.012500000000003 27.212500000000002 24.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 2.0 25 2.0 26 2.0 27 3.5 28 6.5 29 13.5 30 18.5 31 23.5 32 31.5 33 37.5 34 49.0 35 67.5 36 87.5 37 98.5 38 118.0 39 157.0 40 180.5 41 214.0 42 253.5 43 264.5 44 273.0 45 276.5 46 263.0 47 253.5 48 244.0 49 212.5 50 175.0 51 143.5 52 128.0 53 103.5 54 69.0 55 52.5 56 39.0 57 32.0 58 26.5 59 17.0 60 11.0 61 9.5 62 9.5 63 6.5 64 3.5 65 3.0 66 3.0 67 2.5 68 2.0 69 1.5 70 1.5 71 1.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.03 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.16249999999999998 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.21250000000000002 0.0 0.0 0.0 0.0 118-119 0.2375 0.0 0.0 0.0 0.0 120-121 0.275 0.0 0.0 0.0 0.0 122-123 0.3 0.0 0.0 0.0 0.0 124-125 0.35 0.0 0.0 0.0 0.0 126-127 0.4125 0.0 0.0 0.0 0.0 128-129 0.44999999999999996 0.0 0.0 0.0 0.0 130-131 0.5625 0.0 0.0 0.0 0.0 132-133 0.6375 0.0 0.0 0.0 0.0 134-135 0.7 0.0 0.0 0.0 0.0 136-137 0.8 0.0 0.0 0.0 0.0 138-139 0.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169119 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169119_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78625 33.0 33.0 34.0 32.0 34.0 2 33.003 34.0 33.0 34.0 32.0 34.0 3 33.0315 34.0 33.0 34.0 32.0 34.0 4 32.94675 34.0 33.0 34.0 32.0 34.0 5 32.9665 34.0 33.0 34.0 32.0 34.0 6 37.19025 38.0 38.0 38.0 37.0 38.0 7 37.03875 38.0 38.0 38.0 36.0 38.0 8 37.113 38.0 38.0 38.0 37.0 38.0 9 36.8495 38.0 38.0 38.0 36.0 38.0 10-14 36.8933 38.0 38.0 38.0 36.0 38.0 15-19 36.973699999999994 38.0 38.0 38.0 36.2 38.0 20-24 36.8873 38.0 38.0 38.0 36.0 38.0 25-29 36.978500000000004 38.0 38.0 38.0 36.2 38.0 30-34 36.99045 38.0 38.0 38.0 36.2 38.0 35-39 36.667899999999996 38.0 38.0 38.0 35.4 38.0 40-44 36.657849999999996 38.0 38.0 38.0 35.4 38.0 45-49 36.837300000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.85575 38.0 38.0 38.0 36.0 38.0 55-59 36.7265 38.0 38.0 38.0 35.8 38.0 60-64 36.713800000000006 38.0 38.0 38.0 35.4 38.0 65-69 36.607150000000004 38.0 38.0 38.0 34.8 38.0 70-74 36.340450000000004 38.0 38.0 38.0 34.0 38.0 75-79 36.432050000000004 38.0 38.0 38.0 34.2 38.0 80-84 36.40175 38.0 38.0 38.0 34.4 38.0 85-89 36.14874999999999 38.0 38.0 38.0 33.8 38.0 90-94 36.0752 38.0 38.0 38.0 33.2 38.0 95-99 36.10125000000001 38.0 38.0 38.0 33.6 38.0 100-104 36.08315 38.0 38.0 38.0 33.4 38.0 105-109 35.76065 38.0 37.2 38.0 31.8 38.0 110-114 35.48265 38.0 37.0 38.0 30.4 38.0 115-119 35.2634 38.0 36.8 38.0 29.0 38.0 120-124 35.2581 38.0 36.4 38.0 29.4 38.0 125-129 35.06635 38.0 36.0 38.0 28.6 38.0 130-134 34.52525 38.0 35.2 38.0 25.8 38.0 135-139 33.9631 38.0 34.8 38.0 22.2 38.0 140-144 34.088649999999994 38.0 35.0 38.0 22.6 38.0 145-149 33.71810000000001 38.0 35.0 38.0 21.0 38.0 150-151 30.134875 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 5.0 4 2.0 5 1.0 6 3.0 7 4.0 8 1.0 9 0.0 10 0.0 11 0.0 12 4.0 13 2.0 14 2.0 15 3.0 16 2.0 17 5.0 18 9.0 19 11.0 20 6.0 21 9.0 22 14.0 23 18.0 24 24.0 25 19.0 26 23.0 27 34.0 28 46.0 29 39.0 30 50.0 31 57.0 32 60.0 33 108.0 34 140.0 35 251.0 36 516.0 37 2529.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.340025094102884 22.685069008782936 13.224592220828105 26.750313676286076 2 29.625 25.275 28.575 16.525000000000002 3 19.1 28.9 31.674999999999997 20.325 4 22.7 33.35 25.775 18.175 5 26.5 34.725 21.275 17.5 6 21.525 39.0 21.6 17.875 7 20.8 24.375 35.85 18.975 8 23.400000000000002 26.275 26.05 24.275 9 20.674999999999997 26.700000000000003 29.425 23.200000000000003 10-14 23.775 29.28 25.6 21.345 15-19 23.781189059452974 27.796389819490976 27.456372818640933 20.96604830241512 20-24 22.84 28.720000000000002 27.665 20.775 25-29 23.340503226451904 28.302736231304088 27.22725226351858 21.129508278725424 30-34 23.27629340538377 27.999599719803864 27.719403582507756 21.00470329230461 35-39 23.95 28.335 26.715 21.0 40-44 23.116206879287038 28.17303359535373 27.406999449256496 21.303760076102737 45-49 23.326663331665834 28.269134567283643 27.478739369684842 20.92546273136568 50-54 23.21776977337536 28.33558457151433 27.545149832407823 20.901495822702486 55-59 24.095 28.435 27.05 20.419999999999998 60-64 23.833341669584353 27.53463712299305 27.849747411594056 20.78227379582854 65-69 23.215803950987745 27.671917979494875 27.881970492623154 21.230307576894223 70-74 23.865 27.49 27.83 20.815 75-79 23.72686343171586 27.6288144072036 27.63881940970485 21.005502751375687 80-84 23.97897897897898 27.34234234234234 27.782782782782782 20.895895895895897 85-89 24.19 27.875 27.46 20.474999999999998 90-94 23.95598899724931 27.936984246061513 27.44186046511628 20.66516629157289 95-99 24.054621848739497 27.631052420968388 27.696078431372552 20.618247298919567 100-104 24.435000000000002 27.29 27.584999999999997 20.69 105-109 24.62077596996245 27.619524405506883 27.53441802252816 20.225281602002504 110-114 24.120326342659794 27.513889584063268 27.473847539916914 20.891936533360028 115-119 23.983394187965786 27.78972640424148 27.644675636472765 20.58220377131996 120-124 23.64 27.79 27.865000000000002 20.705000000000002 125-129 23.441408986290405 27.919543680576403 27.364154908435907 21.27489242469729 130-134 24.392321956598007 28.09602566030171 27.344259008670374 20.16739337442991 135-139 23.456357353898543 27.347388452100756 27.612799839751617 21.583454354249085 140-144 23.825503355704697 27.53180406691375 28.072723630171293 20.569968947210256 145-149 23.550615800540704 28.201662160809054 27.400620807049165 20.84710123160108 150-151 23.51171826043364 27.710239378368218 27.647574884070686 21.13046747712746 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.0 26 1.5 27 3.0 28 3.0 29 5.5 30 9.0 31 10.0 32 17.5 33 35.0 34 39.5 35 46.0 36 63.0 37 88.5 38 123.5 39 169.5 40 210.0 41 224.0 42 235.0 43 267.0 44 303.0 45 294.0 46 275.0 47 276.0 48 257.0 49 227.0 50 185.0 51 137.5 52 118.0 53 92.0 54 69.5 55 63.5 56 47.0 57 28.0 58 17.5 59 13.5 60 11.0 61 6.0 62 3.0 63 4.0 64 3.5 65 3.0 66 3.0 67 2.5 68 1.5 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.045 30-34 0.06999999999999999 35-39 0.0 40-44 0.135 45-49 0.05 50-54 0.055 55-59 0.0 60-64 0.034999999999999996 65-69 0.025 70-74 0.0 75-79 0.05 80-84 0.1 85-89 0.0 90-94 0.025 95-99 0.04 100-104 0.0 105-109 0.125 110-114 0.105 115-119 0.034999999999999996 120-124 0.0 125-129 0.06999999999999999 130-134 0.23500000000000001 135-139 0.155 140-144 0.16999999999999998 145-149 0.13 150-151 0.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.2375 0.0 0.0 0.0 0.0 118-119 0.2625 0.0 0.0 0.0 0.0 120-121 0.3 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.4375 0.0 0.0 0.0 0.0 128-129 0.475 0.0 0.0 0.0 0.0 130-131 0.5875 0.0 0.0 0.0 0.0 132-133 0.6625000000000001 0.0 0.0 0.0 0.0 134-135 0.75 0.0 0.0 0.0 0.0 136-137 0.85 0.0 0.0 0.0 0.0 138-139 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra Read 785021 spots for SRR7169119.sra Written 785021 spots for SRR7169119.sra SRR ids: ['SRR7169119.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dzi6qgo6 SRR7169119.sra spots: 15700420 blocks: [[1, 785021], [785022, 1570042], [1570043, 2355063], [2355064, 3140084], [3140085, 3925105], [3925106, 4710126], [4710127, 5495147], [5495148, 6280168], [6280169, 7065189], [7065190, 7850210], [7850211, 8635231], [8635232, 9420252], [9420253, 10205273], [10205274, 10990294], [10990295, 11775315], [11775316, 12560336], [12560337, 13345357], [13345358, 14130378], [14130379, 14915399], [14915400, 15700420]] SRR7169119 file size 5298656 SRR7169119 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169119 SRR7169119_1.fastq SRR7169119_2.fastq Input file: SRR7169119_1.fastq Paired file: SRR7169119_2.fastq trimmed: SRR7169119-trimmed-pair1.fastq, SRR7169119-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:28:16 2025 >> started Mon Feb 10 22:28:33 2025 >> done (16.879s) 15700420 read pairs processed; of these: 13242 ( 0.08%) short read pairs filtered out after trimming by size control 11950 ( 0.08%) empty read pairs filtered out after trimming by size control 15675228 (99.84%) read pairs available; of these: 7569890 (48.29%) trimmed read pairs available after processing 8105338 (51.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 3 0.00% 21 2 0.00% 22 4 0.00% 23 3 0.00% 24 4 0.00% 25 3 0.00% 26 6 0.00% 27 9 0.00% 28 1 0.00% 29 2 0.00% 30 4 0.00% 31 3 0.00% 32 6 0.00% 33 6 0.00% 34 3 0.00% 35 3 0.00% 36 9 0.00% 37 7 0.00% 38 11 0.00% 39 8 0.00% 40 8 0.00% 41 18 0.00% 42 8 0.00% 43 23 0.00% 44 17 0.00% 45 21 0.00% 46 19 0.00% 47 22 0.00% 48 22 0.00% 49 22 0.00% 50 15 0.00% 51 19 0.00% 52 28 0.00% 53 23 0.00% 54 20 0.00% 55 40 0.00% 56 35 0.00% 57 50 0.00% 58 65 0.00% 59 52 0.00% 60 50 0.00% 61 64 0.00% 62 82 0.00% 63 98 0.00% 64 149 0.00% 65 120 0.00% 66 172 0.00% 67 158 0.00% 68 125 0.00% 69 123 0.00% 70 143 0.00% 71 180 0.00% 72 225 0.00% 73 219 0.00% 74 249 0.00% 75 264 0.00% 76 268 0.00% 77 365 0.00% 78 334 0.00% 79 395 0.00% 80 435 0.00% 81 529 0.00% 82 584 0.00% 83 793 0.01% 84 1376 0.01% 85 1683 0.01% 86 1672 0.01% 87 1836 0.01% 88 1883 0.01% 89 1881 0.01% 90 2041 0.01% 91 2150 0.01% 92 2222 0.01% 93 2401 0.02% 94 2463 0.02% 95 2612 0.02% 96 2782 0.02% 97 3058 0.02% 98 3213 0.02% 99 3416 0.02% 100 3555 0.02% 101 3874 0.02% 102 4085 0.03% 103 4473 0.03% 104 4661 0.03% 105 5265 0.03% 106 5365 0.03% 107 5967 0.04% 108 6277 0.04% 109 6636 0.04% 110 7238 0.05% 111 7539 0.05% 112 8251 0.05% 113 8588 0.05% 114 9386 0.06% 115 10107 0.06% 116 10591 0.07% 117 11169 0.07% 118 12088 0.08% 119 12863 0.08% 120 13948 0.09% 121 14639 0.09% 122 15577 0.10% 123 17145 0.11% 124 18470 0.12% 125 19682 0.13% 126 21377 0.14% 127 22994 0.15% 128 24592 0.16% 129 26248 0.17% 130 28681 0.18% 131 31084 0.20% 132 33756 0.22% 133 37201 0.24% 134 40382 0.26% 135 44305 0.28% 136 49364 0.31% 137 54952 0.35% 138 61334 0.39% 139 69213 0.44% 140 77266 0.49% 141 89167 0.57% 142 105625 0.67% 143 119423 0.76% 144 145450 0.93% 145 183087 1.17% 146 237293 1.51% 147 326844 2.09% 148 501897 3.20% 149 988113 6.30% 150 3959359 25.26% 151 8105338 51.71% 15675228 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=41 prefix-density=0.18 prefix-fanout=2.3 sequence=GGGCACCAGTCAACAAACTGAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=325.61 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.51 fanout-score-rank=21 prefix-density=0.31 prefix-fanout=3.7 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.13 sequence-density-rank=7 fanout-score=48.40 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=12.7 sequence=TGTTGGTGGTGGTACTGGA SRR7169119 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:29:23 Started mapping on | Feb 10 22:29:23 Finished on | Feb 10 22:31:02 Mapping speed, Million of reads per hour | 570.01 Number of input reads | 15675228 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14817475 Uniquely mapped reads % | 94.53% Average mapped length | 296.87 Number of splices: Total | 14411049 Number of splices: Annotated (sjdb) | 14172492 Number of splices: GT/AG | 14200674 Number of splices: GC/AG | 168032 Number of splices: AT/AC | 11414 Number of splices: Non-canonical | 30929 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 293006 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 64370 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.08% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 578739 578739 578739 N_multimapping 293006 293006 293006 N_noFeature 303096 14649100 375516 N_ambiguous 160371 1293 63475 UnstrandedReadsAssigned:14354008 PositiveStrandReadsAssigned:167082 NegativeStrandReadsAssigned:14378484 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169119 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169119-trimmed-pair1.fastq SRR7169119-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,675,228 reads, 14,292,464 reads pseudoaligned [quant] estimated average fragment length: 282.392 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52401 SRR7169119.ke.tsv 34699 SRR7169119.se.tsv 87100 total ==> SRR7169119.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.61 304 11.0052 Potri.005G024800.1.v4.1 1035 753.608 31 2.58608 Potri.004G059700.1.v4.1 961 679.652 7 0.647495 Potri.007G009000.2.v4.1 1416 1134.61 0 0 Potri.003G141000.2.v4.1 2943 2661.61 262.033 6.18922 Potri.016G087400.1.v4.1 270 58.217 1221 1318.53 Potri.015G069301.1.v4.1 564 290.316 0 0 Potri.010G195200.1.v4.1 1773 1491.61 16 0.674358 Potri.012G127500.1.v4.1 977 695.634 5148 465.246 ==> SRR7169119.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1073 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 222 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169119 completed mapping pipeline successfully