Starting /dee2/code/volunteer_pipeline.sh SRR7169120 current disk space = 3057689321472 free memory = 1504043080 SRR7169120 SRAfilesize 12bf22c0a46351504af1f82746e7982e SRR7169120.sra SRR7169120.sra file validated SRR7169120 is paired end SRR7169120 is conventional basespace SRR7169120 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169120_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0645 34.0 33.0 34.0 33.0 34.0 2 33.40175 34.0 34.0 34.0 33.0 34.0 3 33.4175 34.0 34.0 34.0 33.0 34.0 4 33.48925 34.0 34.0 34.0 33.0 34.0 5 33.482 34.0 34.0 34.0 33.0 34.0 6 36.9085 38.0 37.0 38.0 35.0 38.0 7 37.24375 38.0 38.0 38.0 36.0 38.0 8 37.39025 38.0 38.0 38.0 37.0 38.0 9 37.49425 38.0 38.0 38.0 37.0 38.0 10-14 37.5002 38.0 38.0 38.0 37.2 38.0 15-19 37.42935 38.0 38.0 38.0 37.0 38.0 20-24 37.428250000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.34545000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.3048 38.0 38.0 38.0 37.0 38.0 35-39 37.2045 38.0 38.0 38.0 36.6 38.0 40-44 36.92765 38.0 38.0 38.0 35.4 38.0 45-49 36.661350000000006 38.0 38.0 38.0 34.2 38.0 50-54 36.63605 38.0 38.0 38.0 34.0 38.0 55-59 36.54645 38.0 38.0 38.0 34.0 38.0 60-64 36.46465 38.0 38.0 38.0 34.0 38.0 65-69 36.3957 38.0 37.2 38.0 33.6 38.0 70-74 36.33225 38.0 37.0 38.0 33.8 38.0 75-79 36.2072 38.0 37.0 38.0 33.0 38.0 80-84 36.0267 38.0 37.0 38.0 32.6 38.0 85-89 35.79405 38.0 37.0 38.0 31.4 38.0 90-94 35.668850000000006 38.0 36.8 38.0 31.0 38.0 95-99 35.600300000000004 38.0 36.6 38.0 30.2 38.0 100-104 35.37145 38.0 36.0 38.0 29.0 38.0 105-109 35.17829999999999 38.0 36.0 38.0 28.8 38.0 110-114 34.8037 38.0 35.0 38.0 27.4 38.0 115-119 34.4612 38.0 34.8 38.0 25.8 38.0 120-124 34.11905 38.0 34.4 38.0 23.2 38.0 125-129 33.83135 38.0 34.0 38.0 22.6 38.0 130-134 33.46935 38.0 34.0 38.0 19.0 38.0 135-139 32.893499999999996 37.8 33.2 38.0 15.0 38.0 140-144 32.25145 36.6 32.4 38.0 14.2 38.0 145-149 31.4386 36.0 31.6 38.0 11.4 38.0 150-151 27.085625 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 3.0 13 1.0 14 2.0 15 3.0 16 5.0 17 5.0 18 6.0 19 3.0 20 9.0 21 12.0 22 7.0 23 13.0 24 19.0 25 16.0 26 38.0 27 41.0 28 35.0 29 48.0 30 65.0 31 98.0 32 125.0 33 133.0 34 222.0 35 439.0 36 1047.0 37 1603.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.27789046653144 13.412778904665315 10.31947261663286 34.98985801217038 2 23.7 14.774999999999999 32.675 28.849999999999998 3 20.325 17.849999999999998 27.825 34.0 4 22.175 26.1 24.875 26.85 5 23.05 28.775000000000002 23.575 24.6 6 20.75 33.625 25.05 20.575 7 15.125 26.700000000000003 39.45 18.725 8 18.099999999999998 26.974999999999998 30.049999999999997 24.875 9 17.325 25.7 34.225 22.75 10-14 19.71 30.320000000000004 26.889999999999997 23.080000000000002 15-19 19.655 28.74 27.694999999999997 23.91 20-24 19.72 28.910000000000004 27.439999999999998 23.93 25-29 19.035 29.865000000000002 27.455000000000002 23.645 30-34 19.81 28.470000000000002 27.284999999999997 24.435000000000002 35-39 19.625 29.18 26.755000000000003 24.44 40-44 19.465 28.83 27.125 24.58 45-49 20.135 29.15 26.38 24.335 50-54 19.855 29.01 27.034999999999997 24.099999999999998 55-59 20.23 28.439999999999998 27.150000000000002 24.18 60-64 19.885 28.505000000000003 27.21 24.4 65-69 20.369999999999997 28.325 27.68 23.625 70-74 19.96 28.525 26.724999999999998 24.79 75-79 20.075000000000003 28.405 27.250000000000004 24.27 80-84 20.485 27.555000000000003 27.61 24.349999999999998 85-89 20.71 28.33 27.08 23.880000000000003 90-94 20.77 28.205000000000002 26.884999999999998 24.14 95-99 20.76 28.79 26.784999999999997 23.665 100-104 20.62 28.050000000000004 27.345000000000002 23.985 105-109 20.565 27.715 27.339999999999996 24.38 110-114 20.505000000000003 28.294999999999998 27.48 23.72 115-119 20.66 27.715 27.72 23.905 120-124 21.044999999999998 28.165000000000003 26.900000000000002 23.89 125-129 20.89 27.725 27.38 24.005000000000003 130-134 20.94 28.115000000000002 26.465 24.48 135-139 20.919999999999998 28.13 27.04 23.91 140-144 20.580000000000002 27.185 27.525 24.709999999999997 145-149 21.18 27.689999999999998 27.295 23.835 150-151 20.875 27.1125 27.750000000000004 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 2.0 23 2.5 24 2.0 25 3.5 26 5.0 27 8.5 28 11.0 29 11.0 30 17.0 31 24.5 32 33.5 33 44.0 34 50.5 35 68.0 36 82.5 37 92.0 38 125.5 39 159.0 40 173.5 41 199.5 42 213.5 43 235.5 44 265.5 45 272.5 46 260.5 47 244.0 48 244.5 49 216.0 50 175.5 51 159.0 52 143.5 53 113.5 54 75.0 55 55.5 56 51.5 57 41.5 58 27.5 59 20.5 60 18.5 61 11.5 62 8.5 63 5.5 64 3.5 65 4.0 66 3.0 67 2.0 68 2.5 69 3.5 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.9624999999999999 0.0 0.0 0.0 0.0 128-129 0.9875 0.0 0.0 0.0 0.0 130-131 1.0125 0.0 0.0 0.0 0.0 132-133 1.1125 0.0 0.0 0.0 0.0 134-135 1.225 0.0 0.0 0.0 0.0 136-137 1.35 0.0 0.0 0.0 0.0 138-139 1.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169120 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169120_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.66875 33.0 33.0 34.0 32.0 34.0 2 32.7535 34.0 33.0 34.0 32.0 34.0 3 32.73975 34.0 33.0 34.0 32.0 34.0 4 32.59975 34.0 33.0 34.0 32.0 34.0 5 32.67975 34.0 33.0 34.0 32.0 34.0 6 36.79375 38.0 38.0 38.0 36.0 38.0 7 36.77125 38.0 38.0 38.0 36.0 38.0 8 36.70275 38.0 38.0 38.0 36.0 38.0 9 36.79125 38.0 38.0 38.0 36.0 38.0 10-14 36.71725 38.0 38.0 38.0 36.0 38.0 15-19 36.6309 38.0 38.0 38.0 36.0 38.0 20-24 36.6292 38.0 38.0 38.0 35.8 38.0 25-29 36.6495 38.0 38.0 38.0 36.0 38.0 30-34 36.6062 38.0 38.0 38.0 36.0 38.0 35-39 36.50345 38.0 38.0 38.0 36.0 38.0 40-44 36.5218 38.0 38.0 38.0 35.6 38.0 45-49 36.4841 38.0 38.0 38.0 35.4 38.0 50-54 36.4822 38.0 38.0 38.0 35.6 38.0 55-59 36.410399999999996 38.0 38.0 38.0 35.2 38.0 60-64 36.343199999999996 38.0 38.0 38.0 34.8 38.0 65-69 36.2565 38.0 38.0 38.0 34.4 38.0 70-74 36.2231 38.0 38.0 38.0 34.0 38.0 75-79 36.20035 38.0 38.0 38.0 34.0 38.0 80-84 36.16955 38.0 38.0 38.0 34.0 38.0 85-89 36.04215 38.0 38.0 38.0 34.0 38.0 90-94 35.95175 38.0 38.0 38.0 34.0 38.0 95-99 35.771499999999996 38.0 38.0 38.0 32.6 38.0 100-104 35.63705 38.0 38.0 38.0 32.2 38.0 105-109 35.56275000000001 38.0 38.0 38.0 31.6 38.0 110-114 35.377250000000004 38.0 37.4 38.0 31.0 38.0 115-119 35.16895000000001 38.0 37.0 38.0 29.8 38.0 120-124 34.963350000000005 38.0 36.8 38.0 28.0 38.0 125-129 34.78505 38.0 36.4 38.0 27.8 38.0 130-134 34.48365 38.0 36.0 38.0 26.0 38.0 135-139 34.0467 38.0 35.2 38.0 22.6 38.0 140-144 33.71589999999999 38.0 35.0 38.0 19.0 38.0 145-149 33.087650000000004 38.0 35.0 38.0 12.0 38.0 150-151 29.637500000000003 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 15.0 4 7.0 5 5.0 6 3.0 7 0.0 8 4.0 9 2.0 10 1.0 11 3.0 12 6.0 13 6.0 14 2.0 15 6.0 16 3.0 17 7.0 18 8.0 19 10.0 20 15.0 21 16.0 22 9.0 23 10.0 24 18.0 25 21.0 26 23.0 27 29.0 28 41.0 29 24.0 30 42.0 31 50.0 32 73.0 33 94.0 34 118.0 35 195.0 36 444.0 37 2670.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.325 21.9 16.3 25.474999999999998 2 27.85 26.450000000000003 28.000000000000004 17.7 3 20.424999999999997 30.725 29.299999999999997 19.55 4 22.650000000000002 34.599999999999994 23.275000000000002 19.475 5 22.825 35.949999999999996 23.474999999999998 17.75 6 21.6 35.475 23.775 19.15 7 20.0 23.35 37.075 19.575 8 23.075000000000003 26.474999999999998 26.125 24.325 9 21.95 26.0 28.299999999999997 23.75 10-14 23.77 29.07 25.5 21.66 15-19 24.085 28.68 25.885 21.349999999999998 20-24 23.765 28.93 26.265 21.04 25-29 23.68 27.925 27.405 20.990000000000002 30-34 23.49 28.875 26.565 21.07 35-39 23.24 28.325 27.01 21.425 40-44 23.49 27.47 27.22 21.82 45-49 23.330000000000002 27.42 28.105000000000004 21.145 50-54 23.79 28.025 27.3 20.885 55-59 23.895 27.455000000000002 27.500000000000004 21.15 60-64 23.96 27.675 27.13 21.235 65-69 24.062108690207864 27.38292011019284 27.25770097670924 21.29727022289006 70-74 24.28492711516305 27.696238040374695 27.46581175174072 20.553023092721535 75-79 23.849812265331664 27.619524405506883 27.80976220275344 20.72090112640801 80-84 24.276213810690532 27.541377068853446 27.49137456872844 20.691034551727586 85-89 24.275 27.560000000000002 26.72 21.445 90-94 24.15 27.79 27.055 21.005 95-99 24.585 27.555000000000003 27.05 20.810000000000002 100-104 23.845 27.765 27.435 20.955 105-109 24.285 26.905 27.500000000000004 21.310000000000002 110-114 23.785 28.000000000000004 27.694999999999997 20.52 115-119 23.995 27.775 27.38 20.849999999999998 120-124 24.6 26.915 27.839999999999996 20.645 125-129 24.3 27.439999999999998 27.46 20.8 130-134 24.645 28.384999999999998 26.545 20.424999999999997 135-139 24.49244924492449 27.15271527152715 27.797779777977798 20.557055705570555 140-144 24.204681872749102 27.601040416166466 26.99079631852741 21.203481392557023 145-149 24.337881219903693 27.49297752808989 27.247191011235955 20.921950240770464 150-151 24.489538694227374 27.67834635744895 27.7917822031762 20.040332745147467 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 2.0 25 3.0 26 3.0 27 3.0 28 4.5 29 5.5 30 5.5 31 11.0 32 19.0 33 25.0 34 34.0 35 37.5 36 45.5 37 70.5 38 117.0 39 153.5 40 172.0 41 217.5 42 252.0 43 275.0 44 303.5 45 297.0 46 278.5 47 265.0 48 254.5 49 233.0 50 190.5 51 155.0 52 133.5 53 105.0 54 76.5 55 68.0 56 54.0 57 32.5 58 25.0 59 18.5 60 12.5 61 11.5 62 9.0 63 6.0 64 4.0 65 3.5 66 2.5 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.17500000000000002 70-74 0.185 75-79 0.125 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.04 145-149 0.32 150-151 0.8250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.9125000000000001 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 0.9624999999999999 0.0 0.0 0.0 0.0 132-133 1.0625 0.0 0.0 0.0 0.0 134-135 1.1749999999999998 0.0 0.0 0.0 0.0 136-137 1.3125 0.0 0.0 0.0 0.0 138-139 1.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785222 spots for SRR7169120.sra Written 785222 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra Read 785206 spots for SRR7169120.sra Written 785206 spots for SRR7169120.sra SRR ids: ['SRR7169120.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yk_yfgd1 SRR7169120.sra spots: 15704136 blocks: [[1, 785206], [785207, 1570412], [1570413, 2355618], [2355619, 3140824], [3140825, 3926030], [3926031, 4711236], [4711237, 5496442], [5496443, 6281648], [6281649, 7066854], [7066855, 7852060], [7852061, 8637266], [8637267, 9422472], [9422473, 10207678], [10207679, 10992884], [10992885, 11778090], [11778091, 12563296], [12563297, 13348502], [13348503, 14133708], [14133709, 14918914], [14918915, 15704136]] SRR7169120 file size 5299916 SRR7169120 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169120 SRR7169120_1.fastq SRR7169120_2.fastq Input file: SRR7169120_1.fastq Paired file: SRR7169120_2.fastq trimmed: SRR7169120-trimmed-pair1.fastq, SRR7169120-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:12:30 2025 >> started Mon Feb 10 23:12:49 2025 >> done (19.178s) 15704136 read pairs processed; of these: 31341 ( 0.20%) short read pairs filtered out after trimming by size control 30194 ( 0.19%) empty read pairs filtered out after trimming by size control 15642601 (99.61%) read pairs available; of these: 7445001 (47.59%) trimmed read pairs available after processing 8197600 (52.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 2 0.00% 21 4 0.00% 22 7 0.00% 23 6 0.00% 24 7 0.00% 25 6 0.00% 26 5 0.00% 27 12 0.00% 28 5 0.00% 29 7 0.00% 30 16 0.00% 31 9 0.00% 32 14 0.00% 33 6 0.00% 34 14 0.00% 35 11 0.00% 36 14 0.00% 37 23 0.00% 38 10 0.00% 39 18 0.00% 40 17 0.00% 41 19 0.00% 42 27 0.00% 43 24 0.00% 44 30 0.00% 45 32 0.00% 46 26 0.00% 47 19 0.00% 48 30 0.00% 49 44 0.00% 50 44 0.00% 51 49 0.00% 52 68 0.00% 53 45 0.00% 54 54 0.00% 55 90 0.00% 56 73 0.00% 57 96 0.00% 58 67 0.00% 59 102 0.00% 60 94 0.00% 61 104 0.00% 62 114 0.00% 63 146 0.00% 64 156 0.00% 65 149 0.00% 66 186 0.00% 67 198 0.00% 68 240 0.00% 69 257 0.00% 70 278 0.00% 71 293 0.00% 72 294 0.00% 73 327 0.00% 74 381 0.00% 75 414 0.00% 76 500 0.00% 77 531 0.00% 78 565 0.00% 79 659 0.00% 80 732 0.00% 81 851 0.01% 82 979 0.01% 83 1224 0.01% 84 2417 0.02% 85 3072 0.02% 86 3107 0.02% 87 3001 0.02% 88 3082 0.02% 89 3185 0.02% 90 3274 0.02% 91 3418 0.02% 92 3542 0.02% 93 3775 0.02% 94 3959 0.03% 95 4154 0.03% 96 4417 0.03% 97 4657 0.03% 98 5027 0.03% 99 5236 0.03% 100 5523 0.04% 101 5813 0.04% 102 6102 0.04% 103 6577 0.04% 104 6931 0.04% 105 7455 0.05% 106 8055 0.05% 107 8520 0.05% 108 9062 0.06% 109 9554 0.06% 110 10310 0.07% 111 10727 0.07% 112 11748 0.08% 113 12503 0.08% 114 12834 0.08% 115 13904 0.09% 116 14637 0.09% 117 15545 0.10% 118 16698 0.11% 119 17237 0.11% 120 18285 0.12% 121 19551 0.12% 122 20618 0.13% 123 21956 0.14% 124 23520 0.15% 125 25281 0.16% 126 27090 0.17% 127 28727 0.18% 128 30709 0.20% 129 32506 0.21% 130 34800 0.22% 131 37464 0.24% 132 40464 0.26% 133 43733 0.28% 134 47068 0.30% 135 50636 0.32% 136 55381 0.35% 137 60486 0.39% 138 67573 0.43% 139 74858 0.48% 140 83103 0.53% 141 90643 0.58% 142 102267 0.65% 143 116963 0.75% 144 138421 0.88% 145 167970 1.07% 146 214536 1.37% 147 297307 1.90% 148 463958 2.97% 149 905018 5.79% 150 3824218 24.45% 151 8197600 52.41% 15642601 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=39 prefix-density=0.26 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=93.37 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=11.3 sequence=CATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACG criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=43 prefix-density=0.25 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=45 fanout-score=155.15 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.7 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169120 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:13:34 Started mapping on | Feb 10 23:13:34 Finished on | Feb 10 23:15:16 Mapping speed, Million of reads per hour | 552.09 Number of input reads | 15642601 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14618838 Uniquely mapped reads % | 93.46% Average mapped length | 296.09 Number of splices: Total | 13268766 Number of splices: Annotated (sjdb) | 13051001 Number of splices: GT/AG | 13083425 Number of splices: GC/AG | 147701 Number of splices: AT/AC | 11089 Number of splices: Non-canonical | 26551 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 284114 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 12367 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.62% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 765431 765431 765431 N_multimapping 284114 284114 284114 N_noFeature 309471 14443043 376389 N_ambiguous 167095 1209 57295 UnstrandedReadsAssigned:14142272 PositiveStrandReadsAssigned:174586 NegativeStrandReadsAssigned:14185154 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169120 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169120-trimmed-pair1.fastq SRR7169120-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,642,601 reads, 14,101,538 reads pseudoaligned [quant] estimated average fragment length: 265.745 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR7169120.ke.tsv 34699 SRR7169120.se.tsv 87100 total ==> SRR7169120.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.25 204 6.71906 Potri.005G024800.1.v4.1 1035 770.255 33 2.47402 Potri.004G059700.1.v4.1 961 696.268 1 0.0829367 Potri.007G009000.2.v4.1 1416 1151.25 0 0 Potri.003G141000.2.v4.1 2943 2678.25 255 5.49808 Potri.016G087400.1.v4.1 270 61.2113 1615 1523.58 Potri.015G069301.1.v4.1 564 303.479 0 0 Potri.010G195200.1.v4.1 1773 1508.25 14 0.536014 Potri.012G127500.1.v4.1 977 712.268 5551 450.04 ==> SRR7169120.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1441 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 211 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169120 completed mapping pipeline successfully