Starting /dee2/code/volunteer_pipeline.sh SRR7169121 current disk space = 3057485824000 free memory = 1419686376 SRR7169121 SRAfilesize 521ec7ee7848bc6c5d9a638263eae2e4 SRR7169121.sra SRR7169121.sra file validated SRR7169121 is paired end SRR7169121 is conventional basespace SRR7169121 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169121_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99075 34.0 33.0 34.0 33.0 34.0 2 33.39125 34.0 33.0 34.0 33.0 34.0 3 33.42325 34.0 34.0 34.0 33.0 34.0 4 33.42775 34.0 34.0 34.0 33.0 34.0 5 33.37725 34.0 34.0 34.0 33.0 34.0 6 37.03525 38.0 37.0 38.0 36.0 38.0 7 37.4035 38.0 38.0 38.0 37.0 38.0 8 37.4105 38.0 38.0 38.0 37.0 38.0 9 37.48775 38.0 38.0 38.0 37.0 38.0 10-14 37.442899999999995 38.0 38.0 38.0 37.6 38.0 15-19 37.4402 38.0 38.0 38.0 37.2 38.0 20-24 37.3581 38.0 38.0 38.0 37.0 38.0 25-29 37.3438 38.0 38.0 38.0 37.0 38.0 30-34 37.33465 38.0 38.0 38.0 37.0 38.0 35-39 37.235549999999996 38.0 38.0 38.0 36.8 38.0 40-44 36.993100000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.9269 38.0 38.0 38.0 35.6 38.0 50-54 36.8433 38.0 38.0 38.0 35.4 38.0 55-59 36.8038 38.0 38.0 38.0 35.0 38.0 60-64 36.6849 38.0 38.0 38.0 34.6 38.0 65-69 36.5676 38.0 38.0 38.0 34.0 38.0 70-74 36.56395 38.0 38.0 38.0 34.0 38.0 75-79 36.496700000000004 38.0 38.0 38.0 34.0 38.0 80-84 36.34065 38.0 38.0 38.0 33.8 38.0 85-89 36.2028 38.0 37.6 38.0 33.4 38.0 90-94 36.0494 38.0 37.0 38.0 33.0 38.0 95-99 35.88985 38.0 37.0 38.0 32.0 38.0 100-104 35.7098 38.0 37.0 38.0 30.6 38.0 105-109 35.441700000000004 38.0 36.0 38.0 29.0 38.0 110-114 35.358450000000005 38.0 36.0 38.0 29.0 38.0 115-119 35.100300000000004 38.0 36.0 38.0 28.0 38.0 120-124 34.8976 38.0 35.6 38.0 28.0 38.0 125-129 34.403200000000005 38.0 34.8 38.0 24.8 38.0 130-134 34.09445000000001 38.0 34.8 38.0 23.2 38.0 135-139 33.68255 38.0 34.2 38.0 20.6 38.0 140-144 33.3387 38.0 34.0 38.0 16.2 38.0 145-149 32.38695 38.0 33.2 38.0 13.8 38.0 150-151 28.510624999999997 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 3.0 14 2.0 15 2.0 16 3.0 17 1.0 18 3.0 19 11.0 20 6.0 21 8.0 22 12.0 23 14.0 24 19.0 25 26.0 26 26.0 27 27.0 28 50.0 29 43.0 30 67.0 31 71.0 32 84.0 33 143.0 34 177.0 35 306.0 36 714.0 37 2180.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.242470260693494 13.363705391040243 9.693748418121995 34.70007593014427 2 21.349999999999998 16.075 34.675 27.900000000000002 3 19.975 21.975 27.3 30.75 4 21.575 28.275 23.35 26.8 5 23.25 31.65 24.925 20.175 6 20.775 33.900000000000006 24.15 21.175 7 14.524999999999999 26.35 40.25 18.875 8 18.65 26.55 28.875 25.924999999999997 9 17.025000000000002 24.05 33.825 25.1 10-14 20.405 29.275000000000002 26.965 23.355 15-19 19.715 28.975 27.450000000000003 23.86 20-24 19.765 28.560000000000002 27.689999999999998 23.985 25-29 20.349999999999998 28.51 26.715 24.425 30-34 20.169999999999998 28.01 27.485 24.335 35-39 20.119999999999997 28.955 27.565 23.36 40-44 20.27 28.694999999999997 27.375 23.66 45-49 20.3 27.994999999999997 27.575 24.13 50-54 20.645 28.08 27.425 23.849999999999998 55-59 20.155 28.384999999999998 27.310000000000002 24.15 60-64 20.125 27.71 28.03 24.135 65-69 20.21 28.455000000000002 27.33 24.005000000000003 70-74 20.655 28.754999999999995 27.155 23.435 75-79 20.195 28.349999999999998 26.875 24.58 80-84 20.335 28.435 27.694999999999997 23.535 85-89 21.044999999999998 28.315 26.919999999999998 23.72 90-94 20.96 28.03 27.034999999999997 23.974999999999998 95-99 20.635 28.139999999999997 27.05 24.175 100-104 20.885 28.65 26.935 23.53 105-109 20.86 27.79 27.27 24.08 110-114 20.62 27.865000000000002 27.060000000000002 24.455 115-119 20.845 28.410000000000004 26.655 24.09 120-124 20.849999999999998 28.15 26.840000000000003 24.16 125-129 20.945 27.765 27.584999999999997 23.705000000000002 130-134 21.195 28.410000000000004 27.084999999999997 23.31 135-139 21.09 28.88 26.090000000000003 23.94 140-144 20.995 28.125 26.72 24.16 145-149 20.49 28.07 27.55 23.89 150-151 22.075 27.4125 26.625 23.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.5 19 1.5 20 1.0 21 0.5 22 0.5 23 1.0 24 1.5 25 2.5 26 3.5 27 4.0 28 6.0 29 10.5 30 20.0 31 24.5 32 26.5 33 34.5 34 42.0 35 60.0 36 79.5 37 97.0 38 126.5 39 154.0 40 173.0 41 200.5 42 235.5 43 254.5 44 259.5 45 262.0 46 267.0 47 267.0 48 246.0 49 222.0 50 191.0 51 156.5 52 130.0 53 106.0 54 92.0 55 68.5 56 44.5 57 36.0 58 23.5 59 13.0 60 11.0 61 9.0 62 9.0 63 7.0 64 3.0 65 3.0 66 2.5 67 1.0 68 1.0 69 2.0 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.1125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.16249999999999998 0.0 0.0 0.0 0.0 114-115 0.1875 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.4875 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.5874999999999999 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 1.025 0.0 0.0 0.0 0.0 134-135 1.175 0.0 0.0 0.0 0.0 136-137 1.3375 0.0 0.0 0.0 0.0 138-139 1.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTGCC 10 0.006577216 146.82278 1 >>END_MODULE SRR7169121 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169121_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.51 33.0 33.0 34.0 32.0 34.0 2 32.573 33.0 33.0 34.0 32.0 34.0 3 32.64275 34.0 33.0 34.0 32.0 34.0 4 32.50725 34.0 33.0 34.0 32.0 34.0 5 32.63225 34.0 33.0 34.0 32.0 34.0 6 36.6355 38.0 38.0 38.0 36.0 38.0 7 36.69025 38.0 38.0 38.0 36.0 38.0 8 36.686 38.0 38.0 38.0 36.0 38.0 9 36.61075 38.0 38.0 38.0 35.0 38.0 10-14 36.61345 38.0 38.0 38.0 35.4 38.0 15-19 36.5749 38.0 38.0 38.0 35.2 38.0 20-24 36.56895 38.0 38.0 38.0 35.6 38.0 25-29 36.491550000000004 38.0 38.0 38.0 35.2 38.0 30-34 36.465999999999994 38.0 38.0 38.0 35.2 38.0 35-39 36.370799999999996 38.0 38.0 38.0 34.8 38.0 40-44 36.353100000000005 38.0 38.0 38.0 34.6 38.0 45-49 36.386449999999996 38.0 38.0 38.0 34.8 38.0 50-54 36.2988 38.0 38.0 38.0 34.0 38.0 55-59 36.34665 38.0 38.0 38.0 35.0 38.0 60-64 36.2793 38.0 38.0 38.0 34.2 38.0 65-69 36.214 38.0 38.0 38.0 34.0 38.0 70-74 36.2053 38.0 38.0 38.0 34.0 38.0 75-79 36.00335 38.0 38.0 38.0 33.4 38.0 80-84 35.9839 38.0 38.0 38.0 33.2 38.0 85-89 35.87115 38.0 38.0 38.0 32.6 38.0 90-94 35.8215 38.0 38.0 38.0 33.0 38.0 95-99 35.6884 38.0 37.8 38.0 31.8 38.0 100-104 35.557100000000005 38.0 37.6 38.0 31.0 38.0 105-109 35.4009 38.0 37.0 38.0 29.4 38.0 110-114 35.283049999999996 38.0 37.0 38.0 29.4 38.0 115-119 35.03775 38.0 37.0 38.0 28.0 38.0 120-124 34.90735 38.0 37.0 38.0 27.8 38.0 125-129 34.56845 38.0 36.0 38.0 25.6 38.0 130-134 34.25095 38.0 35.6 38.0 23.4 38.0 135-139 33.9332 38.0 35.2 38.0 21.8 38.0 140-144 33.6498 38.0 35.0 38.0 19.6 38.0 145-149 32.800599999999996 38.0 34.8 38.0 11.4 38.0 150-151 29.401625000000003 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 11.0 4 8.0 5 7.0 6 1.0 7 1.0 8 0.0 9 1.0 10 1.0 11 4.0 12 3.0 13 4.0 14 4.0 15 7.0 16 7.0 17 9.0 18 6.0 19 9.0 20 12.0 21 22.0 22 21.0 23 15.0 24 23.0 25 12.0 26 41.0 27 30.0 28 38.0 29 49.0 30 55.0 31 58.0 32 70.0 33 99.0 34 114.0 35 217.0 36 440.0 37 2585.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.2 22.175 13.575000000000001 26.05 2 26.974999999999998 27.05 28.499999999999996 17.474999999999998 3 20.525 29.349999999999998 30.425 19.7 4 23.25 34.225 23.95 18.575 5 24.5 35.949999999999996 21.525 18.025 6 21.95 36.775000000000006 22.5 18.775 7 19.650000000000002 23.375 37.05 19.925 8 23.125 25.7 26.775 24.4 9 22.15 24.8 29.099999999999998 23.95 10-14 24.01 28.7 26.035000000000004 21.255 15-19 22.78 27.91 27.99 21.32 20-24 23.165 27.99 27.46 21.385 25-29 23.34 28.53 27.029999999999998 21.099999999999998 30-34 22.825 27.54 27.91 21.725 35-39 23.01 27.205000000000002 28.000000000000004 21.785 40-44 23.175 27.525 27.97 21.33 45-49 23.305 27.889999999999997 27.61 21.195 50-54 23.825 27.395000000000003 27.73 21.05 55-59 23.580000000000002 27.525 27.744999999999997 21.15 60-64 23.465 27.665 27.565 21.305 65-69 23.95859378906836 27.559133870080508 27.684152622893432 20.798119717957693 70-74 24.264705882352942 27.35094037615046 26.93077230892357 21.453581432573028 75-79 24.004208627686758 27.050453429530535 28.22285685655594 20.722481086226765 80-84 23.615 27.950000000000003 27.800000000000004 20.635 85-89 23.86 27.689999999999998 27.43 21.02 90-94 24.044999999999998 27.474999999999998 27.415 21.065 95-99 23.79 27.810000000000002 27.175 21.224999999999998 100-104 24.169999999999998 27.169999999999998 27.62 21.04 105-109 23.145 27.235 27.965 21.654999999999998 110-114 24.025 27.375 27.67 20.93 115-119 24.224999999999998 27.045 27.905 20.825 120-124 23.69 27.615000000000002 27.785 20.91 125-129 24.404999999999998 27.800000000000004 27.560000000000002 20.235 130-134 24.5 27.08 27.58 20.84 135-139 24.16 27.41 27.515 20.915 140-144 23.925 27.63 27.584999999999997 20.86 145-149 24.245008528142872 27.63118290358182 27.405437945219223 20.718370623056085 150-151 24.18908725169726 27.35730450088006 27.910485290419913 20.543122957002765 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.5 26 2.5 27 1.5 28 3.0 29 5.0 30 6.0 31 7.5 32 10.0 33 22.0 34 39.5 35 50.0 36 66.5 37 88.0 38 111.5 39 149.5 40 177.5 41 217.5 42 262.5 43 273.5 44 280.0 45 293.5 46 300.5 47 298.5 48 257.5 49 215.0 50 195.5 51 166.5 52 136.0 53 95.5 54 66.5 55 53.0 56 39.5 57 27.5 58 21.5 59 14.0 60 7.5 61 8.5 62 6.0 63 3.5 64 3.5 65 2.0 66 2.0 67 3.5 68 2.0 69 0.0 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.015 70-74 0.04 75-79 0.20500000000000002 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.33 150-151 0.575 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.21250000000000002 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.4875 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.5874999999999999 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.8375 0.0 0.0 0.0 0.0 132-133 1.05 0.0 0.0 0.0 0.0 134-135 1.175 0.0 0.0 0.0 0.0 136-137 1.3125 0.0 0.0 0.0 0.0 138-139 1.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAGAA 10 0.006830828 145.0 5 >>END_MODULE Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887213 spots for SRR7169121.sra Written 887213 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra Read 887196 spots for SRR7169121.sra Written 887196 spots for SRR7169121.sra SRR ids: ['SRR7169121.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sg2ma9fb SRR7169121.sra spots: 17743937 blocks: [[1, 887196], [887197, 1774392], [1774393, 2661588], [2661589, 3548784], [3548785, 4435980], [4435981, 5323176], [5323177, 6210372], [6210373, 7097568], [7097569, 7984764], [7984765, 8871960], [8871961, 9759156], [9759157, 10646352], [10646353, 11533548], [11533549, 12420744], [12420745, 13307940], [13307941, 14195136], [14195137, 15082332], [15082333, 15969528], [15969529, 16856724], [16856725, 17743937]] SRR7169121 file size 5991137 SRR7169121 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169121 SRR7169121_1.fastq SRR7169121_2.fastq Input file: SRR7169121_1.fastq Paired file: SRR7169121_2.fastq trimmed: SRR7169121-trimmed-pair1.fastq, SRR7169121-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:34:43 2025 >> started Mon Feb 10 22:35:20 2025 >> done (37.376s) 17743937 read pairs processed; of these: 30381 ( 0.17%) short read pairs filtered out after trimming by size control 27485 ( 0.15%) empty read pairs filtered out after trimming by size control 17686071 (99.67%) read pairs available; of these: 7537539 (42.62%) trimmed read pairs available after processing 10148532 (57.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 3 0.00% 21 3 0.00% 22 7 0.00% 23 2 0.00% 24 7 0.00% 25 6 0.00% 26 9 0.00% 27 11 0.00% 28 10 0.00% 29 6 0.00% 30 13 0.00% 31 7 0.00% 32 9 0.00% 33 12 0.00% 34 10 0.00% 35 14 0.00% 36 18 0.00% 37 16 0.00% 38 14 0.00% 39 20 0.00% 40 18 0.00% 41 25 0.00% 42 19 0.00% 43 28 0.00% 44 23 0.00% 45 25 0.00% 46 29 0.00% 47 26 0.00% 48 27 0.00% 49 55 0.00% 50 39 0.00% 51 46 0.00% 52 51 0.00% 53 57 0.00% 54 68 0.00% 55 70 0.00% 56 74 0.00% 57 90 0.00% 58 90 0.00% 59 97 0.00% 60 115 0.00% 61 125 0.00% 62 132 0.00% 63 159 0.00% 64 166 0.00% 65 194 0.00% 66 212 0.00% 67 235 0.00% 68 214 0.00% 69 321 0.00% 70 345 0.00% 71 324 0.00% 72 405 0.00% 73 387 0.00% 74 443 0.00% 75 515 0.00% 76 585 0.00% 77 669 0.00% 78 685 0.00% 79 736 0.00% 80 833 0.00% 81 976 0.01% 82 1102 0.01% 83 1369 0.01% 84 2669 0.02% 85 3361 0.02% 86 3364 0.02% 87 3372 0.02% 88 3405 0.02% 89 3530 0.02% 90 3493 0.02% 91 3767 0.02% 92 3870 0.02% 93 4103 0.02% 94 4310 0.02% 95 4579 0.03% 96 4836 0.03% 97 4887 0.03% 98 5424 0.03% 99 5726 0.03% 100 5950 0.03% 101 6145 0.03% 102 6647 0.04% 103 7023 0.04% 104 7525 0.04% 105 7996 0.05% 106 8310 0.05% 107 8905 0.05% 108 9601 0.05% 109 9869 0.06% 110 10401 0.06% 111 11281 0.06% 112 12134 0.07% 113 12853 0.07% 114 13671 0.08% 115 14474 0.08% 116 15542 0.09% 117 16619 0.09% 118 17532 0.10% 119 18193 0.10% 120 19226 0.11% 121 20443 0.12% 122 21564 0.12% 123 23259 0.13% 124 24741 0.14% 125 26532 0.15% 126 28694 0.16% 127 30479 0.17% 128 32024 0.18% 129 34409 0.19% 130 36492 0.21% 131 39271 0.22% 132 42143 0.24% 133 45593 0.26% 134 49092 0.28% 135 53369 0.30% 136 57903 0.33% 137 63209 0.36% 138 69698 0.39% 139 76880 0.43% 140 84638 0.48% 141 92718 0.52% 142 103101 0.58% 143 116338 0.66% 144 135876 0.77% 145 164212 0.93% 146 204664 1.16% 147 281958 1.59% 148 420062 2.38% 149 817050 4.62% 150 4024126 22.75% 151 10148532 57.38% 17686071 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=39 prefix-density=0.23 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=320.85 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=17.4 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=45 prefix-density=0.21 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=46 fanout-score=51.07 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.6 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7169121 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:36:15 Started mapping on | Feb 10 22:36:15 Finished on | Feb 10 22:38:39 Mapping speed, Million of reads per hour | 442.15 Number of input reads | 17686071 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16545443 Uniquely mapped reads % | 93.55% Average mapped length | 296.60 Number of splices: Total | 15741169 Number of splices: Annotated (sjdb) | 15512692 Number of splices: GT/AG | 15530204 Number of splices: GC/AG | 170718 Number of splices: AT/AC | 11371 Number of splices: Non-canonical | 28876 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 290546 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 24226 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.64% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 878232 878232 878232 N_multimapping 290546 290546 290546 N_noFeature 289567 16342770 370756 N_ambiguous 186860 956 64791 UnstrandedReadsAssigned:16069016 PositiveStrandReadsAssigned:201717 NegativeStrandReadsAssigned:16109896 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169121 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169121-trimmed-pair1.fastq SRR7169121-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,686,071 reads, 16,010,355 reads pseudoaligned [quant] estimated average fragment length: 277.576 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52401 SRR7169121.ke.tsv 34699 SRR7169121.se.tsv 87100 total ==> SRR7169121.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1741.42 270 9.39848 Potri.005G024800.1.v4.1 1035 758.424 19 1.51859 Potri.004G059700.1.v4.1 961 684.491 2 0.177117 Potri.007G009000.2.v4.1 1416 1139.42 0 0 Potri.003G141000.2.v4.1 2943 2666.42 354.081 8.04955 Potri.016G087400.1.v4.1 270 61.3153 1293.83 1279.11 Potri.015G069301.1.v4.1 564 295.344 0 0 Potri.010G195200.1.v4.1 1773 1496.42 13 0.526608 Potri.012G127500.1.v4.1 977 700.454 4802 415.567 ==> SRR7169121.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1755 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 183 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169121 completed mapping pipeline successfully