Starting /dee2/code/volunteer_pipeline.sh SRR7169122 current disk space = 3057728921600 free memory = 1505143676 SRR7169122 SRAfilesize 6f356c7cf4c0e8e13790c5d2477a1b83 SRR7169122.sra SRR7169122.sra file validated SRR7169122 is paired end SRR7169122 is conventional basespace SRR7169122 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169122_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.23525 34.0 34.0 34.0 33.0 34.0 2 33.50475 34.0 34.0 34.0 33.0 34.0 3 33.51175 34.0 34.0 34.0 33.0 34.0 4 33.58275 34.0 34.0 34.0 33.0 34.0 5 33.57675 34.0 34.0 34.0 33.0 34.0 6 37.22775 38.0 38.0 38.0 36.0 38.0 7 37.4555 38.0 38.0 38.0 37.0 38.0 8 37.51 38.0 38.0 38.0 37.0 38.0 9 37.611 38.0 38.0 38.0 38.0 38.0 10-14 37.5625 38.0 38.0 38.0 38.0 38.0 15-19 37.551249999999996 38.0 38.0 38.0 37.8 38.0 20-24 37.48035 38.0 38.0 38.0 37.4 38.0 25-29 37.44175 38.0 38.0 38.0 37.2 38.0 30-34 37.40725 38.0 38.0 38.0 37.0 38.0 35-39 37.3159 38.0 38.0 38.0 36.8 38.0 40-44 37.0242 38.0 38.0 38.0 35.8 38.0 45-49 36.89125 38.0 38.0 38.0 35.2 38.0 50-54 36.76455 38.0 38.0 38.0 35.0 38.0 55-59 36.62195 38.0 38.0 38.0 34.0 38.0 60-64 36.6511 38.0 38.0 38.0 34.0 38.0 65-69 36.474000000000004 38.0 37.8 38.0 34.0 38.0 70-74 36.42569999999999 38.0 37.8 38.0 34.0 38.0 75-79 36.238099999999996 38.0 37.0 38.0 33.6 38.0 80-84 36.131899999999995 38.0 37.0 38.0 33.0 38.0 85-89 35.956199999999995 38.0 37.0 38.0 32.2 38.0 90-94 35.77080000000001 38.0 36.6 38.0 31.0 38.0 95-99 35.56015 38.0 36.2 38.0 29.8 38.0 100-104 35.308550000000004 38.0 36.0 38.0 29.0 38.0 105-109 35.12935 38.0 36.0 38.0 28.8 38.0 110-114 34.914750000000005 38.0 35.6 38.0 28.0 38.0 115-119 34.57365 38.0 35.0 38.0 26.6 38.0 120-124 34.2565 38.0 34.8 38.0 24.6 38.0 125-129 33.904650000000004 38.0 34.0 38.0 23.0 38.0 130-134 33.4611 38.0 34.0 38.0 17.8 38.0 135-139 32.94265 38.0 33.4 38.0 15.0 38.0 140-144 32.23425 37.0 32.8 38.0 14.0 38.0 145-149 31.441549999999996 36.0 31.6 38.0 11.2 38.0 150-151 27.596125 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 2.0 13 2.0 14 1.0 15 3.0 16 4.0 17 3.0 18 6.0 19 10.0 20 8.0 21 9.0 22 10.0 23 18.0 24 23.0 25 24.0 26 26.0 27 33.0 28 41.0 29 42.0 30 60.0 31 59.0 32 111.0 33 122.0 34 217.0 35 464.0 36 1049.0 37 1651.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.644174879959564 14.783927217589083 7.8594895122567605 33.71240839019459 2 24.775 13.725000000000001 31.85 29.65 3 19.650000000000002 17.2 26.375 36.775000000000006 4 22.1 23.325000000000003 24.65 29.925 5 22.275 28.999999999999996 24.625 24.099999999999998 6 21.75 32.35 23.65 22.25 7 16.05 30.25 36.1 17.599999999999998 8 17.625 28.725 31.85 21.8 9 17.150000000000002 27.250000000000004 32.85 22.75 10-14 19.735 31.045 27.395000000000003 21.825 15-19 19.555 29.935000000000002 27.115000000000002 23.395 20-24 19.425 29.825000000000003 27.615000000000002 23.135 25-29 20.06 29.185 26.855 23.9 30-34 19.29 29.935000000000002 27.13 23.645 35-39 20.3 29.160000000000004 27.26 23.28 40-44 19.759999999999998 29.404999999999998 27.025 23.810000000000002 45-49 20.13 29.060000000000002 26.97 23.84 50-54 19.950000000000003 29.065 27.165 23.82 55-59 20.244999999999997 29.065 27.27 23.419999999999998 60-64 19.515 28.98 27.57 23.935000000000002 65-69 20.22 28.194999999999997 27.455000000000002 24.13 70-74 19.98 28.04 27.805000000000003 24.175 75-79 19.855 28.99 27.215 23.94 80-84 20.25 28.71 27.3 23.74 85-89 20.44 28.16 27.595 23.805 90-94 20.395 28.82 26.840000000000003 23.945 95-99 19.895 28.09 27.62 24.395 100-104 19.905 28.294999999999998 28.17 23.630000000000003 105-109 20.415 28.360000000000003 26.93 24.295 110-114 20.355 28.29 27.35 24.005000000000003 115-119 20.715 28.244999999999997 27.834999999999997 23.205000000000002 120-124 20.52 28.144999999999996 27.02 24.315 125-129 20.979999999999997 27.565 27.275 24.18 130-134 20.32 27.965 27.279999999999998 24.435000000000002 135-139 20.615 28.12 27.425 23.84 140-144 21.145 27.42 27.455000000000002 23.98 145-149 20.599999999999998 28.005000000000003 27.325 24.07 150-151 20.95 28.275 26.6 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.5 20 1.0 21 0.5 22 0.0 23 2.0 24 3.5 25 3.5 26 7.0 27 12.5 28 15.0 29 17.5 30 21.0 31 29.5 32 40.5 33 51.5 34 65.0 35 82.5 36 88.5 37 106.0 38 125.5 39 145.5 40 178.0 41 208.0 42 232.0 43 243.5 44 241.0 45 245.0 46 264.5 47 247.0 48 216.0 49 206.0 50 182.0 51 151.0 52 129.0 53 101.0 54 87.0 55 68.0 56 44.5 57 35.5 58 26.0 59 18.5 60 14.0 61 9.0 62 7.0 63 6.5 64 3.0 65 2.0 66 2.5 67 1.5 68 2.0 69 3.0 70 1.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.30000000000000004 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.875 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.0499999999999998 0.0 0.0 0.0 0.0 134-135 1.2625 0.0 0.0 0.0 0.0 136-137 1.4625 0.0 0.0 0.0 0.0 138-139 1.7625000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169122 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169122_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.022 33.0 33.0 34.0 32.0 34.0 2 33.085 34.0 33.0 34.0 32.0 34.0 3 33.1455 34.0 33.0 34.0 33.0 34.0 4 33.0735 34.0 33.0 34.0 33.0 34.0 5 33.10675 34.0 33.0 34.0 33.0 34.0 6 37.25375 38.0 38.0 38.0 37.0 38.0 7 37.2335 38.0 38.0 38.0 37.0 38.0 8 37.246 38.0 38.0 38.0 38.0 38.0 9 37.20675 38.0 38.0 38.0 37.0 38.0 10-14 37.23075 38.0 38.0 38.0 37.6 38.0 15-19 37.208999999999996 38.0 38.0 38.0 37.4 38.0 20-24 37.1753 38.0 38.0 38.0 37.2 38.0 25-29 37.189800000000005 38.0 38.0 38.0 37.4 38.0 30-34 37.136250000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.18605 38.0 38.0 38.0 37.2 38.0 40-44 37.1151 38.0 38.0 38.0 37.0 38.0 45-49 37.140150000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.05475 38.0 38.0 38.0 37.0 38.0 55-59 37.04365 38.0 38.0 38.0 37.0 38.0 60-64 37.0148 38.0 38.0 38.0 37.0 38.0 65-69 36.9131 38.0 38.0 38.0 36.8 38.0 70-74 36.89765 38.0 38.0 38.0 36.2 38.0 75-79 36.839000000000006 38.0 38.0 38.0 36.2 38.0 80-84 36.7992 38.0 38.0 38.0 36.0 38.0 85-89 36.77545 38.0 38.0 38.0 36.0 38.0 90-94 36.701800000000006 38.0 38.0 38.0 35.8 38.0 95-99 36.5828 38.0 38.0 38.0 35.6 38.0 100-104 36.41905 38.0 38.0 38.0 34.8 38.0 105-109 36.31945 38.0 38.0 38.0 34.2 38.0 110-114 36.213049999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.001850000000005 38.0 38.0 38.0 33.6 38.0 120-124 35.85115 38.0 38.0 38.0 33.0 38.0 125-129 35.58265 38.0 38.0 38.0 31.6 38.0 130-134 35.44035 38.0 37.4 38.0 31.4 38.0 135-139 35.10125 38.0 36.4 38.0 30.4 38.0 140-144 34.502250000000004 38.0 36.0 38.0 26.8 38.0 145-149 33.95525 38.0 35.4 38.0 22.6 38.0 150-151 30.694 36.5 29.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 3.0 4 1.0 5 1.0 6 0.0 7 2.0 8 3.0 9 2.0 10 0.0 11 1.0 12 3.0 13 2.0 14 4.0 15 4.0 16 4.0 17 3.0 18 6.0 19 7.0 20 8.0 21 11.0 22 2.0 23 7.0 24 9.0 25 14.0 26 16.0 27 25.0 28 26.0 29 31.0 30 36.0 31 46.0 32 49.0 33 65.0 34 94.0 35 174.0 36 386.0 37 2944.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.0 24.349999999999998 11.675 24.975 2 27.800000000000004 28.249999999999996 27.474999999999998 16.475 3 20.9 29.025000000000002 29.725 20.349999999999998 4 24.075 34.300000000000004 23.125 18.5 5 25.0 35.0 21.725 18.275 6 21.25 37.974999999999994 21.55 19.225 7 20.849999999999998 23.275000000000002 36.275 19.6 8 20.8 27.025 27.1 25.074999999999996 9 21.975 25.575 28.999999999999996 23.45 10-14 23.794999999999998 29.565 25.36 21.279999999999998 15-19 24.23 28.505000000000003 26.765 20.5 20-24 23.785 28.58 26.735 20.9 25-29 24.115000000000002 28.395 26.540000000000003 20.95 30-34 23.915 27.825 27.1 21.16 35-39 23.855 27.665 27.175 21.305 40-44 23.79 27.815 27.26 21.135 45-49 23.965 28.26 26.979999999999997 20.794999999999998 50-54 23.974999999999998 28.205000000000002 26.82 21.0 55-59 23.985 27.575 27.339999999999996 21.099999999999998 60-64 24.095 27.925 27.305 20.674999999999997 65-69 24.483967935871743 27.930861723446892 26.978957915831664 20.606212424849698 70-74 24.16453730146801 28.172754145999296 26.955258279472922 20.70745027305977 75-79 23.868642370845013 27.297757308770525 27.568081698037645 21.265518622346814 80-84 23.35 27.765 27.589999999999996 21.295 85-89 24.740000000000002 27.345000000000002 27.060000000000002 20.855 90-94 23.990000000000002 27.400000000000002 28.095 20.515 95-99 24.535 27.235 27.3 20.93 100-104 24.4 28.205000000000002 26.965 20.43 105-109 24.235 27.87 27.16 20.735 110-114 24.42 27.939999999999998 26.805 20.835 115-119 24.235 27.950000000000003 27.115000000000002 20.7 120-124 24.47 27.650000000000002 27.08 20.8 125-129 24.310000000000002 27.73 27.384999999999998 20.575 130-134 24.39 27.255000000000003 27.644999999999996 20.71 135-139 24.687155871458604 27.500250275302836 27.560316347982784 20.25227750525578 140-144 24.524323510216377 27.983332496611276 27.45619760028114 20.03614639289121 145-149 24.837588759631366 28.27214584277585 26.585083345923348 20.305182051669437 150-151 24.76010101010101 27.765151515151516 27.954545454545453 19.52020202020202 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.5 25 1.5 26 1.5 27 2.5 28 4.5 29 5.0 30 5.5 31 10.5 32 13.0 33 19.5 34 30.0 35 38.0 36 56.5 37 89.5 38 113.0 39 141.0 40 173.5 41 214.0 42 246.5 43 269.5 44 289.5 45 292.0 46 296.0 47 296.5 48 276.5 49 224.0 50 184.0 51 160.5 52 126.0 53 101.0 54 76.5 55 58.5 56 50.5 57 37.0 58 28.0 59 21.0 60 14.0 61 8.5 62 4.5 63 2.5 64 2.5 65 3.0 66 2.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.2 70-74 0.20500000000000002 75-79 0.12 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.11 140-144 0.40499999999999997 145-149 0.715 150-151 1.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.875 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.025 0.0 0.0 0.0 0.0 134-135 1.225 0.0 0.0 0.0 0.0 136-137 1.425 0.0 0.0 0.0 0.0 138-139 1.7374999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCACT 10 0.006830828 145.0 2 >>END_MODULE Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629334 spots for SRR7169122.sra Written 629334 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra Read 629320 spots for SRR7169122.sra Written 629320 spots for SRR7169122.sra SRR ids: ['SRR7169122.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7e8_goyd SRR7169122.sra spots: 12586414 blocks: [[1, 629320], [629321, 1258640], [1258641, 1887960], [1887961, 2517280], [2517281, 3146600], [3146601, 3775920], [3775921, 4405240], [4405241, 5034560], [5034561, 5663880], [5663881, 6293200], [6293201, 6922520], [6922521, 7551840], [7551841, 8181160], [8181161, 8810480], [8810481, 9439800], [9439801, 10069120], [10069121, 10698440], [10698441, 11327760], [11327761, 11957080], [11957081, 12586414]] SRR7169122 file size 4243422 SRR7169122 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169122 SRR7169122_1.fastq SRR7169122_2.fastq Input file: SRR7169122_1.fastq Paired file: SRR7169122_2.fastq trimmed: SRR7169122-trimmed-pair1.fastq, SRR7169122-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:19:00 2025 >> started Mon Feb 10 23:19:13 2025 >> done (13.328s) 12586414 read pairs processed; of these: 15602 ( 0.12%) short read pairs filtered out after trimming by size control 14885 ( 0.12%) empty read pairs filtered out after trimming by size control 12555927 (99.76%) read pairs available; of these: 6486803 (51.66%) trimmed read pairs available after processing 6069124 (48.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 8 0.00% 21 3 0.00% 22 5 0.00% 23 8 0.00% 24 10 0.00% 25 5 0.00% 26 10 0.00% 27 9 0.00% 28 8 0.00% 29 10 0.00% 30 12 0.00% 31 6 0.00% 32 12 0.00% 33 10 0.00% 34 8 0.00% 35 10 0.00% 36 11 0.00% 37 13 0.00% 38 11 0.00% 39 15 0.00% 40 9 0.00% 41 16 0.00% 42 17 0.00% 43 16 0.00% 44 24 0.00% 45 22 0.00% 46 34 0.00% 47 21 0.00% 48 29 0.00% 49 30 0.00% 50 34 0.00% 51 33 0.00% 52 47 0.00% 53 29 0.00% 54 59 0.00% 55 41 0.00% 56 60 0.00% 57 69 0.00% 58 64 0.00% 59 73 0.00% 60 77 0.00% 61 92 0.00% 62 86 0.00% 63 101 0.00% 64 115 0.00% 65 107 0.00% 66 140 0.00% 67 153 0.00% 68 152 0.00% 69 191 0.00% 70 209 0.00% 71 197 0.00% 72 247 0.00% 73 249 0.00% 74 288 0.00% 75 344 0.00% 76 361 0.00% 77 415 0.00% 78 446 0.00% 79 490 0.00% 80 628 0.01% 81 654 0.01% 82 801 0.01% 83 860 0.01% 84 1584 0.01% 85 1870 0.01% 86 1904 0.02% 87 2159 0.02% 88 2323 0.02% 89 2239 0.02% 90 2349 0.02% 91 2486 0.02% 92 2666 0.02% 93 2794 0.02% 94 3181 0.03% 95 3319 0.03% 96 3529 0.03% 97 3835 0.03% 98 4157 0.03% 99 4245 0.03% 100 4491 0.04% 101 4919 0.04% 102 5239 0.04% 103 5518 0.04% 104 5893 0.05% 105 6456 0.05% 106 6792 0.05% 107 7426 0.06% 108 7919 0.06% 109 8303 0.07% 110 8747 0.07% 111 9041 0.07% 112 9650 0.08% 113 10408 0.08% 114 10823 0.09% 115 11804 0.09% 116 12371 0.10% 117 13276 0.11% 118 13716 0.11% 119 14783 0.12% 120 15716 0.13% 121 16514 0.13% 122 17347 0.14% 123 18917 0.15% 124 20128 0.16% 125 21467 0.17% 126 23068 0.18% 127 24664 0.20% 128 26100 0.21% 129 28001 0.22% 130 29832 0.24% 131 32000 0.25% 132 34599 0.28% 133 37477 0.30% 134 40172 0.32% 135 44023 0.35% 136 48282 0.38% 137 53038 0.42% 138 59740 0.48% 139 67034 0.53% 140 74027 0.59% 141 82785 0.66% 142 93473 0.74% 143 107742 0.86% 144 128332 1.02% 145 157425 1.25% 146 201921 1.61% 147 283682 2.26% 148 436211 3.47% 149 831133 6.62% 150 3201414 25.50% 151 6069124 48.34% 12555927 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=35 prefix-density=0.20 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=332.62 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=20.7 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=43 prefix-density=0.22 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=226.52 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=24.3 sequence=GAAGAAGAAGAAA SRR7169122 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:19:58 Started mapping on | Feb 10 23:19:58 Finished on | Feb 10 23:21:15 Mapping speed, Million of reads per hour | 587.03 Number of input reads | 12555927 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11801783 Uniquely mapped reads % | 93.99% Average mapped length | 295.79 Number of splices: Total | 10627614 Number of splices: Annotated (sjdb) | 10454597 Number of splices: GT/AG | 10476036 Number of splices: GC/AG | 122731 Number of splices: AT/AC | 8342 Number of splices: Non-canonical | 20505 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 248996 % of reads mapped to multiple loci | 1.98% Number of reads mapped to too many loci | 19641 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.83% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 520612 520612 520612 N_multimapping 248996 248996 248996 N_noFeature 217367 11666407 271768 N_ambiguous 128951 641 47545 UnstrandedReadsAssigned:11455465 PositiveStrandReadsAssigned:134735 NegativeStrandReadsAssigned:11482470 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169122 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169122-trimmed-pair1.fastq SRR7169122-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,555,927 reads, 11,439,442 reads pseudoaligned [quant] estimated average fragment length: 251.083 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR7169122.ke.tsv 34699 SRR7169122.se.tsv 87100 total ==> SRR7169122.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.92 164 5.94565 Potri.005G024800.1.v4.1 1035 784.917 31 2.53137 Potri.004G059700.1.v4.1 961 710.922 2 0.180312 Potri.007G009000.2.v4.1 1416 1165.92 0 0 Potri.003G141000.2.v4.1 2943 2692.92 174 4.14136 Potri.016G087400.1.v4.1 270 64.3444 1404 1398.53 Potri.015G069301.1.v4.1 564 316.22 0 0 Potri.010G195200.1.v4.1 1773 1522.92 22 0.925899 Potri.012G127500.1.v4.1 977 726.917 6465 570.034 ==> SRR7169122.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 713 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169122 completed mapping pipeline successfully