Starting /dee2/code/volunteer_pipeline.sh SRR7169123 current disk space = 3057502892032 free memory = 1579220956 SRR7169123 SRAfilesize c12ced0581fd552b13b7ff279569f52f SRR7169123.sra SRR7169123.sra file validated SRR7169123 is paired end SRR7169123 is conventional basespace SRR7169123 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169123_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8945 34.0 33.0 34.0 33.0 34.0 2 33.365 34.0 33.0 34.0 33.0 34.0 3 33.44025 34.0 34.0 34.0 33.0 34.0 4 33.4785 34.0 34.0 34.0 33.0 34.0 5 33.44125 34.0 33.0 34.0 33.0 34.0 6 36.88575 38.0 37.0 38.0 35.0 38.0 7 37.217 38.0 38.0 38.0 36.0 38.0 8 37.30125 38.0 38.0 38.0 37.0 38.0 9 37.40125 38.0 38.0 38.0 37.0 38.0 10-14 37.3225 38.0 38.0 38.0 36.6 38.0 15-19 37.222899999999996 38.0 38.0 38.0 36.0 38.0 20-24 37.1764 38.0 38.0 38.0 36.2 38.0 25-29 37.15945000000001 38.0 38.0 38.0 36.0 38.0 30-34 37.125800000000005 38.0 38.0 38.0 36.0 38.0 35-39 37.015499999999996 38.0 38.0 38.0 35.6 38.0 40-44 36.581849999999996 38.0 38.0 38.0 34.2 38.0 45-49 36.431 38.0 37.2 38.0 33.8 38.0 50-54 36.2367 38.0 37.0 38.0 33.2 38.0 55-59 36.1686 38.0 37.0 38.0 33.0 38.0 60-64 36.088049999999996 38.0 37.0 38.0 33.0 38.0 65-69 35.904250000000005 38.0 37.0 38.0 31.0 38.0 70-74 35.82185 38.0 36.8 38.0 31.2 38.0 75-79 35.7744 38.0 36.4 38.0 31.0 38.0 80-84 35.553700000000006 38.0 36.0 38.0 29.4 38.0 85-89 35.3577 38.0 36.0 38.0 29.0 38.0 90-94 35.0825 38.0 35.8 38.0 28.6 38.0 95-99 34.981350000000006 38.0 35.6 38.0 28.0 38.0 100-104 34.72044999999999 38.0 35.0 38.0 26.8 38.0 105-109 34.43625 38.0 34.4 38.0 25.6 38.0 110-114 34.14925 38.0 34.2 38.0 23.2 38.0 115-119 33.825 38.0 34.0 38.0 22.6 38.0 120-124 33.547200000000004 38.0 34.0 38.0 18.6 38.0 125-129 33.11675 37.2 33.2 38.0 16.6 38.0 130-134 32.430949999999996 37.0 31.6 38.0 15.0 38.0 135-139 32.07365 36.6 31.2 38.0 14.4 38.0 140-144 31.450699999999994 36.0 31.0 38.0 13.8 38.0 145-149 30.1949 36.0 28.6 38.0 6.4 38.0 150-151 25.820375 33.0 14.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 2.0 13 5.0 14 3.0 15 3.0 16 1.0 17 5.0 18 4.0 19 11.0 20 5.0 21 15.0 22 10.0 23 21.0 24 29.0 25 30.0 26 31.0 27 46.0 28 68.0 29 64.0 30 93.0 31 94.0 32 139.0 33 199.0 34 293.0 35 567.0 36 1063.0 37 1196.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.29964448958863 15.820213306246824 10.74149314372778 33.13864906043677 2 23.674999999999997 16.900000000000002 34.425 25.0 3 19.525000000000002 23.225 27.450000000000003 29.799999999999997 4 21.4 31.6 23.125 23.875 5 21.875 33.775 23.849999999999998 20.5 6 19.75 35.225 24.474999999999998 20.549999999999997 7 15.325 27.975 38.7 18.0 8 19.425 25.25 29.575000000000003 25.75 9 17.299999999999997 24.5 31.825 26.375 10-14 20.294999999999998 29.220000000000002 26.82 23.665 15-19 19.755 29.025000000000002 27.450000000000003 23.77 20-24 19.605 28.605000000000004 27.83 23.96 25-29 19.835 29.255 27.675 23.235 30-34 19.39 28.955 27.810000000000002 23.845 35-39 19.91 28.955 27.77 23.365 40-44 20.465 28.49 27.87 23.175 45-49 19.915 28.65 27.415 24.02 50-54 20.21 28.804999999999996 27.13 23.855 55-59 20.305 29.054999999999996 26.805 23.835 60-64 20.064999999999998 28.835 27.46 23.64 65-69 20.19 28.305000000000003 27.35 24.154999999999998 70-74 20.345 28.715000000000003 27.005000000000003 23.935000000000002 75-79 20.47 28.035 27.415 24.08 80-84 20.32 28.505000000000003 27.715 23.46 85-89 20.395 28.57 27.29 23.745 90-94 19.82 28.825 27.584999999999997 23.77 95-99 19.715 28.53 27.62 24.135 100-104 20.76 28.634999999999998 27.42 23.185 105-109 20.335 27.755000000000003 27.92 23.990000000000002 110-114 20.294999999999998 28.84 27.045 23.82 115-119 21.065 28.285 27.215 23.435 120-124 20.44 28.57 27.195000000000004 23.794999999999998 125-129 20.885 27.900000000000002 27.744999999999997 23.47 130-134 20.455000000000002 28.560000000000002 27.11 23.875 135-139 20.97 28.77 27.284999999999997 22.975 140-144 20.78 28.29 26.68 24.25 145-149 20.345 28.475 27.224999999999998 23.955000000000002 150-151 20.7 27.1 27.625 24.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 1.5 23 1.5 24 2.0 25 3.0 26 10.0 27 14.0 28 11.5 29 15.5 30 22.5 31 29.5 32 33.5 33 39.0 34 51.0 35 61.5 36 73.5 37 98.0 38 132.0 39 162.0 40 193.0 41 214.0 42 232.0 43 256.0 44 256.5 45 259.0 46 268.0 47 273.0 48 253.0 49 211.5 50 177.0 51 148.0 52 119.0 53 87.5 54 71.0 55 52.5 56 39.0 57 36.5 58 26.0 59 15.0 60 10.0 61 10.0 62 8.0 63 3.5 64 3.0 65 3.0 66 1.5 67 0.5 68 0.5 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.5125 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.6 0.0 0.0 0.0 0.0 126-127 0.675 0.0 0.0 0.0 0.0 128-129 0.7124999999999999 0.0 0.0 0.0 0.0 130-131 0.7875 0.0 0.0 0.0 0.0 132-133 0.8875 0.0 0.0 0.0 0.0 134-135 0.925 0.0 0.0 0.0 0.0 136-137 1.0499999999999998 0.0 0.0 0.0 0.0 138-139 1.1749999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATATTG 10 0.006830828 145.0 3 >>END_MODULE SRR7169123 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169123_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.66175 33.0 33.0 34.0 32.0 34.0 2 32.72 33.0 33.0 34.0 32.0 34.0 3 32.79375 34.0 33.0 34.0 32.0 34.0 4 32.70825 34.0 33.0 34.0 32.0 34.0 5 32.7655 34.0 33.0 34.0 32.0 34.0 6 36.85975 38.0 38.0 38.0 36.0 38.0 7 36.85425 38.0 38.0 38.0 36.0 38.0 8 36.82425 38.0 38.0 38.0 36.0 38.0 9 36.804 38.0 38.0 38.0 36.0 38.0 10-14 36.81955000000001 38.0 38.0 38.0 36.0 38.0 15-19 36.7668 38.0 38.0 38.0 36.0 38.0 20-24 36.765750000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.786550000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.73025 38.0 38.0 38.0 36.0 38.0 35-39 36.62305 38.0 38.0 38.0 35.8 38.0 40-44 36.58305 38.0 38.0 38.0 35.8 38.0 45-49 36.5649 38.0 38.0 38.0 35.8 38.0 50-54 36.549549999999996 38.0 38.0 38.0 35.6 38.0 55-59 36.5048 38.0 38.0 38.0 35.4 38.0 60-64 36.4596 38.0 38.0 38.0 35.2 38.0 65-69 36.3952 38.0 38.0 38.0 35.0 38.0 70-74 36.3756 38.0 38.0 38.0 34.8 38.0 75-79 36.24535 38.0 38.0 38.0 34.2 38.0 80-84 36.2319 38.0 38.0 38.0 34.0 38.0 85-89 36.086 38.0 38.0 38.0 34.0 38.0 90-94 36.08055 38.0 38.0 38.0 34.0 38.0 95-99 35.84075 38.0 38.0 38.0 32.4 38.0 100-104 35.74085000000001 38.0 38.0 38.0 32.0 38.0 105-109 35.6725 38.0 37.8 38.0 32.0 38.0 110-114 35.58025 38.0 37.4 38.0 31.8 38.0 115-119 35.3922 38.0 37.0 38.0 30.8 38.0 120-124 35.3026 38.0 37.2 38.0 31.0 38.0 125-129 34.877449999999996 38.0 36.2 38.0 27.6 38.0 130-134 34.55445 38.0 36.0 38.0 26.4 38.0 135-139 34.295049999999996 38.0 36.0 38.0 24.0 38.0 140-144 33.87145 38.0 35.0 38.0 22.2 38.0 145-149 33.04345 38.0 35.0 38.0 13.8 38.0 150-151 29.61325 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 8.0 4 5.0 5 4.0 6 2.0 7 3.0 8 6.0 9 3.0 10 4.0 11 5.0 12 1.0 13 2.0 14 3.0 15 8.0 16 4.0 17 6.0 18 9.0 19 10.0 20 10.0 21 7.0 22 11.0 23 17.0 24 16.0 25 18.0 26 19.0 27 30.0 28 27.0 29 42.0 30 52.0 31 55.0 32 67.0 33 82.0 34 137.0 35 180.0 36 484.0 37 2648.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.125 22.7 14.299999999999999 24.875 2 27.750000000000004 27.0 27.425 17.825 3 20.95 30.525000000000002 30.625000000000004 17.9 4 23.474999999999998 34.425 22.650000000000002 19.45 5 24.45 36.475 21.075 18.0 6 22.45 36.55 21.975 19.025 7 20.8 22.475 36.875 19.85 8 21.725 26.0 26.35 25.924999999999997 9 22.05 25.1 30.525000000000002 22.325 10-14 23.705000000000002 28.325 25.97 22.0 15-19 22.99 28.335 27.235 21.44 20-24 23.035 28.43 27.575 20.96 25-29 22.985 28.005000000000003 27.500000000000004 21.51 30-34 23.03 27.87 28.439999999999998 20.66 35-39 23.365 27.425 27.655 21.555 40-44 23.395 28.21 27.065 21.33 45-49 23.810000000000002 27.785 27.089999999999996 21.315 50-54 23.085 27.875 27.725 21.315 55-59 23.615 27.16 27.99 21.235 60-64 23.68 27.755000000000003 28.144999999999996 20.419999999999998 65-69 23.422026607982392 27.853356006802038 27.738321496448936 20.98629588876663 70-74 23.92914331465172 27.73218574859888 27.622097678142516 20.716573258606886 75-79 23.717177791140507 27.72599719382642 27.741030266586492 20.815794748446585 80-84 24.32 27.145000000000003 27.529999999999998 21.005 85-89 23.78 27.48 27.839999999999996 20.9 90-94 23.78 27.93 27.71 20.580000000000002 95-99 23.59 27.950000000000003 28.050000000000004 20.41 100-104 24.36 27.55 27.605 20.485 105-109 23.96 27.439999999999998 28.000000000000004 20.599999999999998 110-114 23.775 27.689999999999998 27.889999999999997 20.645 115-119 24.265 27.229999999999997 27.694999999999997 20.810000000000002 120-124 23.945 27.42 28.035 20.599999999999998 125-129 23.48 27.52 28.165000000000003 20.835 130-134 24.235 27.675 27.52 20.57 135-139 24.044999999999998 28.04 27.425 20.49 140-144 23.79 27.76 27.54 20.91 145-149 24.181726907630523 27.76104417670683 27.68072289156627 20.376506024096386 150-151 23.922902494331066 28.76039304610733 27.37465356512975 19.942050894431848 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 1.5 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 1.5 26 1.0 27 2.0 28 3.0 29 4.5 30 10.0 31 10.5 32 14.0 33 20.5 34 30.5 35 51.0 36 66.5 37 93.5 38 139.0 39 169.0 40 193.0 41 220.0 42 245.0 43 267.5 44 284.0 45 296.5 46 288.5 47 265.0 48 245.0 49 215.0 50 185.0 51 165.5 52 134.5 53 101.5 54 76.0 55 56.5 56 36.0 57 22.5 58 21.0 59 15.0 60 9.5 61 7.5 62 4.5 63 4.0 64 3.5 65 3.0 66 3.0 67 3.5 68 2.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.03 70-74 0.08 75-79 0.22 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.4 150-151 0.775 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5375000000000001 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.675 0.0 0.0 0.0 0.0 128-129 0.725 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.9375 0.0 0.0 0.0 0.0 134-135 0.975 0.0 0.0 0.0 0.0 136-137 1.125 0.0 0.0 0.0 0.0 138-139 1.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGTCGT 10 0.006830828 145.0 6 >>END_MODULE Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819608 spots for SRR7169123.sra Written 819608 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra Read 819600 spots for SRR7169123.sra Written 819600 spots for SRR7169123.sra SRR ids: ['SRR7169123.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c11dyqno SRR7169123.sra spots: 16392008 blocks: [[1, 819600], [819601, 1639200], [1639201, 2458800], [2458801, 3278400], [3278401, 4098000], [4098001, 4917600], [4917601, 5737200], [5737201, 6556800], [6556801, 7376400], [7376401, 8196000], [8196001, 9015600], [9015601, 9835200], [9835201, 10654800], [10654801, 11474400], [11474401, 12294000], [12294001, 13113600], [13113601, 13933200], [13933201, 14752800], [14752801, 15572400], [15572401, 16392008]] SRR7169123 file size 5533013 SRR7169123 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169123 SRR7169123_1.fastq SRR7169123_2.fastq Input file: SRR7169123_1.fastq Paired file: SRR7169123_2.fastq trimmed: SRR7169123-trimmed-pair1.fastq, SRR7169123-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:49:14 2025 >> started Mon Feb 10 23:49:31 2025 >> done (17.750s) 16392008 read pairs processed; of these: 32026 ( 0.20%) short read pairs filtered out after trimming by size control 34962 ( 0.21%) empty read pairs filtered out after trimming by size control 16325020 (99.59%) read pairs available; of these: 8194740 (50.20%) trimmed read pairs available after processing 8130280 (49.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 4 0.00% 20 4 0.00% 21 9 0.00% 22 6 0.00% 23 5 0.00% 24 11 0.00% 25 4 0.00% 26 8 0.00% 27 9 0.00% 28 7 0.00% 29 5 0.00% 30 17 0.00% 31 10 0.00% 32 12 0.00% 33 16 0.00% 34 18 0.00% 35 10 0.00% 36 15 0.00% 37 18 0.00% 38 18 0.00% 39 21 0.00% 40 30 0.00% 41 21 0.00% 42 27 0.00% 43 29 0.00% 44 28 0.00% 45 33 0.00% 46 36 0.00% 47 49 0.00% 48 40 0.00% 49 49 0.00% 50 59 0.00% 51 70 0.00% 52 84 0.00% 53 73 0.00% 54 76 0.00% 55 80 0.00% 56 98 0.00% 57 95 0.00% 58 105 0.00% 59 135 0.00% 60 134 0.00% 61 152 0.00% 62 143 0.00% 63 187 0.00% 64 219 0.00% 65 212 0.00% 66 206 0.00% 67 264 0.00% 68 280 0.00% 69 278 0.00% 70 323 0.00% 71 367 0.00% 72 396 0.00% 73 501 0.00% 74 534 0.00% 75 552 0.00% 76 625 0.00% 77 665 0.00% 78 807 0.00% 79 851 0.01% 80 967 0.01% 81 1104 0.01% 82 1198 0.01% 83 1507 0.01% 84 2796 0.02% 85 3541 0.02% 86 3321 0.02% 87 3628 0.02% 88 3523 0.02% 89 3542 0.02% 90 3779 0.02% 91 3812 0.02% 92 4082 0.03% 93 4319 0.03% 94 4523 0.03% 95 4829 0.03% 96 4974 0.03% 97 5293 0.03% 98 5417 0.03% 99 5792 0.04% 100 6035 0.04% 101 6612 0.04% 102 7063 0.04% 103 7393 0.05% 104 7615 0.05% 105 8387 0.05% 106 8928 0.05% 107 9086 0.06% 108 9561 0.06% 109 10197 0.06% 110 10876 0.07% 111 11528 0.07% 112 12579 0.08% 113 13069 0.08% 114 14086 0.09% 115 15092 0.09% 116 15781 0.10% 117 16793 0.10% 118 17581 0.11% 119 18700 0.11% 120 19443 0.12% 121 20862 0.13% 122 22081 0.14% 123 23568 0.14% 124 25402 0.16% 125 26694 0.16% 126 28923 0.18% 127 30856 0.19% 128 32711 0.20% 129 34495 0.21% 130 37298 0.23% 131 40102 0.25% 132 43788 0.27% 133 48350 0.30% 134 51747 0.32% 135 56338 0.35% 136 61828 0.38% 137 68022 0.42% 138 76186 0.47% 139 84722 0.52% 140 93851 0.57% 141 103740 0.64% 142 117431 0.72% 143 135414 0.83% 144 161974 0.99% 145 199952 1.22% 146 255592 1.57% 147 360957 2.21% 148 544042 3.33% 149 1034756 6.34% 150 4045557 24.78% 151 8130280 49.80% 16325020 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=43 prefix-density=0.19 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=45 fanout-score=207.12 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAAC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=5.92 fanout-score-rank=20 prefix-density=0.33 prefix-fanout=3.9 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=22 fanout-score=53.86 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=13.0 sequence=TGTTGGTGGTGG SRR7169123 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:50:15 Started mapping on | Feb 10 23:50:15 Finished on | Feb 10 23:52:19 Mapping speed, Million of reads per hour | 473.95 Number of input reads | 16325020 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14959257 Uniquely mapped reads % | 91.63% Average mapped length | 295.80 Number of splices: Total | 13885112 Number of splices: Annotated (sjdb) | 13659263 Number of splices: GT/AG | 13688760 Number of splices: GC/AG | 158193 Number of splices: AT/AC | 11631 Number of splices: Non-canonical | 26528 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305343 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 18720 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.35% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1086264 1086264 1086264 N_multimapping 305343 305343 305343 N_noFeature 293222 14789504 364672 N_ambiguous 162312 1248 63055 UnstrandedReadsAssigned:14503723 PositiveStrandReadsAssigned:168505 NegativeStrandReadsAssigned:14531530 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169123 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169123-trimmed-pair1.fastq SRR7169123-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,325,020 reads, 14,459,119 reads pseudoaligned [quant] estimated average fragment length: 275.571 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR7169123.ke.tsv 34699 SRR7169123.se.tsv 87100 total ==> SRR7169123.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.43 254 8.57455 Potri.005G024800.1.v4.1 1035 760.429 30 2.32191 Potri.004G059700.1.v4.1 961 686.458 4 0.342947 Potri.007G009000.2.v4.1 1416 1141.43 0 0 Potri.003G141000.2.v4.1 2943 2668.43 181.022 3.99262 Potri.016G087400.1.v4.1 270 60.7562 1380 1336.81 Potri.015G069301.1.v4.1 564 295.863 0 0 Potri.010G195200.1.v4.1 1773 1498.43 17 0.66772 Potri.012G127500.1.v4.1 977 702.452 6033 505.473 ==> SRR7169123.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1701 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169123 completed mapping pipeline successfully