Starting /dee2/code/volunteer_pipeline.sh SRR7169124 current disk space = 3057623719936 free memory = 1290789072 SRR7169124 SRAfilesize 3f88a94175d8831b9eaf95ebf187a424 SRR7169124.sra SRR7169124.sra file validated SRR7169124 is paired end SRR7169124 is conventional basespace SRR7169124 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169124_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.889 34.0 33.0 34.0 32.0 34.0 2 33.18725 34.0 33.0 34.0 32.0 34.0 3 33.264 34.0 33.0 34.0 32.0 34.0 4 33.432 34.0 33.0 34.0 33.0 34.0 5 33.298 34.0 33.0 34.0 33.0 34.0 6 37.1005 38.0 37.0 38.0 36.0 38.0 7 35.45025 38.0 37.0 38.0 29.0 38.0 8 36.13725 38.0 37.0 38.0 31.0 38.0 9 37.124 38.0 38.0 38.0 36.0 38.0 10-14 37.2658 38.0 38.0 38.0 36.8 38.0 15-19 37.04305 38.0 38.0 38.0 36.0 38.0 20-24 37.33445 38.0 38.0 38.0 37.0 38.0 25-29 37.2253 38.0 38.0 38.0 36.6 38.0 30-34 37.20235 38.0 38.0 38.0 36.6 38.0 35-39 37.3245 38.0 38.0 38.0 37.0 38.0 40-44 36.817899999999995 38.0 37.8 38.0 35.0 38.0 45-49 36.69670000000001 38.0 38.0 38.0 34.6 38.0 50-54 36.305150000000005 38.0 37.4 38.0 32.8 38.0 55-59 36.2546 38.0 37.2 38.0 33.2 38.0 60-64 36.3496 38.0 37.6 38.0 33.4 38.0 65-69 36.24825 38.0 37.0 38.0 33.4 38.0 70-74 35.964600000000004 38.0 37.0 38.0 32.2 38.0 75-79 36.2181 38.0 37.0 38.0 33.2 38.0 80-84 36.075 38.0 37.0 38.0 32.6 38.0 85-89 35.779250000000005 38.0 36.8 38.0 31.0 38.0 90-94 35.63275 38.0 36.4 38.0 30.4 38.0 95-99 35.571749999999994 38.0 36.2 38.0 30.2 38.0 100-104 34.943650000000005 38.0 35.4 38.0 27.4 38.0 105-109 34.290549999999996 38.0 34.4 38.0 23.0 38.0 110-114 34.4637 38.0 34.6 38.0 25.6 38.0 115-119 34.47769999999999 38.0 34.8 38.0 25.8 38.0 120-124 33.822799999999994 38.0 34.0 38.0 21.4 38.0 125-129 33.386649999999996 38.0 34.0 38.0 17.8 38.0 130-134 33.21955 38.0 33.4 38.0 19.0 38.0 135-139 32.6494 37.4 32.2 38.0 17.0 38.0 140-144 31.5017 36.0 30.6 38.0 13.6 38.0 145-149 29.9966 36.0 29.0 38.0 6.4 38.0 150-151 25.307625 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 1.0 11 1.0 12 1.0 13 2.0 14 2.0 15 3.0 16 3.0 17 2.0 18 3.0 19 7.0 20 12.0 21 10.0 22 11.0 23 17.0 24 21.0 25 24.0 26 27.0 27 51.0 28 47.0 29 48.0 30 79.0 31 110.0 32 132.0 33 186.0 34 297.0 35 524.0 36 1092.0 37 1282.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.734243697478995 12.368697478991598 10.89810924369748 37.99894957983193 2 23.3 14.05 34.699999999999996 27.950000000000003 3 18.875 19.8 26.200000000000003 35.125 4 22.45 27.575 23.200000000000003 26.775 5 22.625 33.2 22.7 21.475 6 19.55 34.849999999999994 25.224999999999998 20.375 7 14.75 26.375 41.025 17.849999999999998 8 18.05 27.325 29.7 24.925 9 17.05 25.85 33.85 23.25 10-14 19.53 29.645 27.169999999999998 23.655 15-19 20.055 28.4 27.894999999999996 23.65 20-24 20.187018701870187 28.862886288628864 27.28772877287729 23.662366236623665 25-29 20.04 28.07 28.075 23.815 30-34 19.741974197419744 28.5028502850285 27.442744274427444 24.312431243124312 35-39 19.85797869680452 28.199229884482673 27.879181877281596 24.063609541431212 40-44 19.853970794158833 28.275655131026205 27.865573114622926 24.00480096019204 45-49 19.985 28.24 27.805000000000003 23.97 50-54 20.23101155057753 28.551427571378568 27.336366818340917 23.881194059702985 55-59 20.39 28.299999999999997 27.1 24.21 60-64 19.610980549027452 28.471423571178562 27.346367318365917 24.57122856142807 65-69 20.255000000000003 28.435 27.18 24.13 70-74 20.32101605080254 28.646432321616082 27.50637531876594 23.52617630881544 75-79 20.630000000000003 27.965 27.665 23.74 80-84 19.580000000000002 28.33 28.185 23.905 85-89 20.081004050202512 28.431421571078552 27.031351567578376 24.456222811140556 90-94 20.477047704770477 28.06280628062806 27.512751275127513 23.94739473947395 95-99 20.29 28.065 27.42 24.224999999999998 100-104 20.419999999999998 28.01 27.975 23.595 105-109 20.34 27.82 27.095000000000002 24.745 110-114 21.205 27.27 27.395000000000003 24.13 115-119 20.44 28.1 27.54 23.919999999999998 120-124 20.5 28.095 27.29 24.115000000000002 125-129 20.97 27.79 27.439999999999998 23.799999999999997 130-134 21.025 28.395 27.21 23.369999999999997 135-139 21.09527381845461 27.831957989497376 27.35183795948987 23.72093023255814 140-144 20.95604780239012 27.711385569278463 27.366368318415923 23.966198309915494 145-149 20.589117823564713 28.405681136227244 26.715343068613723 24.28985797159432 150-151 20.875 27.800000000000004 26.724999999999998 24.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 0.5 26 0.5 27 3.0 28 7.0 29 10.0 30 16.5 31 18.5 32 22.5 33 35.5 34 39.0 35 57.0 36 91.5 37 105.5 38 121.5 39 153.5 40 186.0 41 219.5 42 246.0 43 264.0 44 287.0 45 296.5 46 287.0 47 263.5 48 242.5 49 204.0 50 170.0 51 157.0 52 125.0 53 95.0 54 70.5 55 50.0 56 31.5 57 26.0 58 25.5 59 20.5 60 13.0 61 6.5 62 7.0 63 5.5 64 3.0 65 3.0 66 2.5 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.0 30-34 0.01 35-39 0.015 40-44 0.02 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.005 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.025 140-144 0.005 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.1875 0.0 0.0 0.0 0.0 116-117 0.2625 0.0 0.0 0.0 0.0 118-119 0.325 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.44999999999999996 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.5375000000000001 0.0 0.0 0.0 0.0 128-129 0.5874999999999999 0.0 0.0 0.0 0.0 130-131 0.7 0.0 0.0 0.0 0.0 132-133 0.8875 0.0 0.0 0.0 0.0 134-135 1.0499999999999998 0.0 0.0 0.0 0.0 136-137 1.1125 0.0 0.0 0.0 0.0 138-139 1.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGACAT 10 0.0068378756 144.95 2 >>END_MODULE SRR7169124 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169124_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0085 33.0 33.0 34.0 32.0 34.0 2 33.101 34.0 33.0 34.0 32.0 34.0 3 33.0535 34.0 33.0 34.0 32.0 34.0 4 32.95125 34.0 33.0 34.0 32.0 34.0 5 33.0195 34.0 33.0 34.0 32.0 34.0 6 37.06725 38.0 38.0 38.0 37.0 38.0 7 37.10125 38.0 38.0 38.0 37.0 38.0 8 36.509 38.0 38.0 38.0 34.0 38.0 9 37.047 38.0 38.0 38.0 37.0 38.0 10-14 37.06755 38.0 38.0 38.0 36.6 38.0 15-19 37.10849999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.03265 38.0 38.0 38.0 36.6 38.0 25-29 37.01219999999999 38.0 38.0 38.0 36.8 38.0 30-34 37.0434 38.0 38.0 38.0 36.8 38.0 35-39 36.76585 38.0 38.0 38.0 35.8 38.0 40-44 36.76145 38.0 38.0 38.0 35.8 38.0 45-49 36.9249 38.0 38.0 38.0 36.0 38.0 50-54 36.964099999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.8427 38.0 38.0 38.0 35.8 38.0 60-64 36.73425 38.0 38.0 38.0 36.0 38.0 65-69 36.749649999999995 38.0 38.0 38.0 35.6 38.0 70-74 36.60455 38.0 38.0 38.0 34.8 38.0 75-79 36.46315 38.0 38.0 38.0 34.4 38.0 80-84 36.369099999999996 38.0 38.0 38.0 33.8 38.0 85-89 36.0812 38.0 38.0 38.0 32.8 38.0 90-94 36.10654999999999 38.0 38.0 38.0 33.4 38.0 95-99 36.259699999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.10385 38.0 38.0 38.0 33.4 38.0 105-109 35.8572 38.0 37.2 38.0 32.4 38.0 110-114 35.521550000000005 38.0 37.0 38.0 29.8 38.0 115-119 35.33315 38.0 36.6 38.0 29.0 38.0 120-124 35.457049999999995 38.0 37.0 38.0 30.6 38.0 125-129 34.8428 38.0 35.6 38.0 27.6 38.0 130-134 34.2943 38.0 35.0 38.0 23.4 38.0 135-139 34.007549999999995 38.0 35.0 38.0 22.2 38.0 140-144 33.778650000000006 38.0 34.2 38.0 22.6 38.0 145-149 32.74784999999999 38.0 33.2 38.0 13.4 38.0 150-151 28.575499999999998 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 1.0 5 2.0 6 1.0 7 1.0 8 0.0 9 1.0 10 0.0 11 3.0 12 3.0 13 2.0 14 2.0 15 1.0 16 5.0 17 3.0 18 7.0 19 5.0 20 7.0 21 6.0 22 13.0 23 14.0 24 20.0 25 22.0 26 28.0 27 33.0 28 43.0 29 42.0 30 49.0 31 65.0 32 82.0 33 123.0 34 149.0 35 256.0 36 593.0 37 2410.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.209052263065765 21.955488872218055 14.603650912728183 27.231807951987996 2 28.432108027006752 27.506876719179797 28.532133033258315 15.528882220555138 3 19.7 28.325 31.025000000000002 20.95 4 22.75 34.675 23.150000000000002 19.425 5 23.125 36.95 22.2 17.724999999999998 6 20.575 36.925000000000004 24.099999999999998 18.4 7 19.525000000000002 22.95 38.85 18.675 8 23.25 26.375 26.400000000000002 23.974999999999998 9 22.075 25.25 29.125 23.549999999999997 10-14 23.01 28.64 26.845000000000002 21.505 15-19 22.650000000000002 27.450000000000003 28.435 21.465 20-24 23.035 27.950000000000003 27.810000000000002 21.205 25-29 22.814999999999998 28.144999999999996 27.97 21.07 30-34 22.895 28.185 27.935 20.985 35-39 23.335 27.615000000000002 27.67 21.38 40-44 22.695 28.055000000000003 27.900000000000002 21.349999999999998 45-49 23.3 27.915 27.615000000000002 21.17 50-54 22.759999999999998 28.16 28.199999999999996 20.880000000000003 55-59 23.48 27.575 28.185 20.76 60-64 23.24 27.73 27.925 21.105 65-69 23.56 27.46 28.58 20.4 70-74 23.45 27.500000000000004 27.87 21.18 75-79 23.419999999999998 27.54 28.165000000000003 20.875 80-84 23.755000000000003 27.485 27.83 20.93 85-89 23.505000000000003 28.225 27.715 20.555 90-94 23.61 27.939999999999998 28.015 20.435 95-99 23.9 27.095000000000002 28.12 20.885 100-104 23.544999999999998 27.525 27.884999999999998 21.044999999999998 105-109 23.189999999999998 27.57 27.944999999999997 21.295 110-114 24.235 27.505000000000003 27.389999999999997 20.87 115-119 23.435 27.66 27.644999999999996 21.26 120-124 23.5 27.779999999999998 27.505000000000003 21.215 125-129 24.02360354053108 27.129069360404063 27.734160124018604 21.11316697504626 130-134 24.05 27.74 27.43 20.78 135-139 23.84 28.310000000000002 27.279999999999998 20.57 140-144 23.665 27.72 27.395000000000003 21.22 145-149 23.955000000000002 27.800000000000004 27.439999999999998 20.805 150-151 23.625 27.037499999999998 27.6875 21.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.5 26 1.5 27 2.5 28 3.5 29 7.0 30 10.5 31 15.5 32 21.0 33 24.5 34 38.5 35 59.5 36 81.0 37 101.5 38 123.5 39 164.0 40 202.0 41 249.5 42 276.5 43 287.0 44 292.0 45 281.5 46 275.0 47 267.5 48 243.5 49 205.5 50 174.5 51 138.0 52 103.5 53 85.0 54 69.0 55 47.0 56 36.0 57 27.0 58 18.5 59 14.5 60 13.0 61 7.5 62 6.0 63 5.5 64 3.5 65 2.5 66 2.0 67 2.0 68 2.0 69 1.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.015 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0125 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.025 0.0 0.0 0.025 0.0 92-93 0.025 0.0 0.0 0.025 0.0 94-95 0.037500000000000006 0.0 0.0 0.025 0.0 96-97 0.075 0.0 0.0 0.025 0.0 98-99 0.1 0.0 0.0 0.025 0.0 100-101 0.1125 0.0 0.0 0.025 0.0 102-103 0.15 0.0 0.0 0.025 0.0 104-105 0.15 0.0 0.0 0.025 0.0 106-107 0.175 0.0 0.0 0.025 0.0 108-109 0.175 0.0 0.0 0.025 0.0 110-111 0.175 0.0 0.0 0.025 0.0 112-113 0.175 0.0 0.0 0.025 0.0 114-115 0.1875 0.0 0.0 0.025 0.0 116-117 0.25 0.0 0.0 0.025 0.0 118-119 0.3 0.0 0.0 0.025 0.0 120-121 0.375 0.0 0.0 0.025 0.0 122-123 0.42500000000000004 0.0 0.0 0.025 0.0 124-125 0.4875 0.0 0.0 0.025 0.0 126-127 0.525 0.0 0.0 0.025 0.0 128-129 0.5874999999999999 0.0 0.0 0.025 0.0 130-131 0.7250000000000001 0.0 0.0 0.025 0.0 132-133 0.9125 0.0 0.0 0.025 0.0 134-135 1.0750000000000002 0.0 0.0 0.025 0.0 136-137 1.1125 0.0 0.0 0.025 0.0 138-139 1.25 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAAGCC 10 0.006830828 145.0 3 >>END_MODULE Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133156 spots for SRR7169124.sra Written 1133156 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra Read 1133142 spots for SRR7169124.sra Written 1133142 spots for SRR7169124.sra SRR ids: ['SRR7169124.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t3_kvhm7 SRR7169124.sra spots: 22662854 blocks: [[1, 1133142], [1133143, 2266284], [2266285, 3399426], [3399427, 4532568], [4532569, 5665710], [5665711, 6798852], [6798853, 7931994], [7931995, 9065136], [9065137, 10198278], [10198279, 11331420], [11331421, 12464562], [12464563, 13597704], [13597705, 14730846], [14730847, 15863988], [15863989, 16997130], [16997131, 18130272], [18130273, 19263414], [19263415, 20396556], [20396557, 21529698], [21529699, 22662854]] SRR7169124 file size 7657997 SRR7169124 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169124 SRR7169124_1.fastq SRR7169124_2.fastq Input file: SRR7169124_1.fastq Paired file: SRR7169124_2.fastq trimmed: SRR7169124-trimmed-pair1.fastq, SRR7169124-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:46:51 2025 >> started Mon Feb 10 22:47:15 2025 >> done (23.350s) 22662854 read pairs processed; of these: 21930 ( 0.10%) short read pairs filtered out after trimming by size control 15694 ( 0.07%) empty read pairs filtered out after trimming by size control 22625230 (99.83%) read pairs available; of these: 11166895 (49.36%) trimmed read pairs available after processing 11458335 (50.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 5 0.00% 21 8 0.00% 22 6 0.00% 23 5 0.00% 24 10 0.00% 25 2 0.00% 26 6 0.00% 27 11 0.00% 28 7 0.00% 29 10 0.00% 30 16 0.00% 31 6 0.00% 32 8 0.00% 33 8 0.00% 34 15 0.00% 35 12 0.00% 36 12 0.00% 37 13 0.00% 38 12 0.00% 39 15 0.00% 40 14 0.00% 41 15 0.00% 42 10 0.00% 43 22 0.00% 44 16 0.00% 45 21 0.00% 46 25 0.00% 47 33 0.00% 48 29 0.00% 49 30 0.00% 50 39 0.00% 51 43 0.00% 52 52 0.00% 53 49 0.00% 54 50 0.00% 55 44 0.00% 56 56 0.00% 57 64 0.00% 58 82 0.00% 59 79 0.00% 60 88 0.00% 61 96 0.00% 62 98 0.00% 63 118 0.00% 64 141 0.00% 65 158 0.00% 66 164 0.00% 67 173 0.00% 68 213 0.00% 69 237 0.00% 70 283 0.00% 71 350 0.00% 72 327 0.00% 73 352 0.00% 74 395 0.00% 75 406 0.00% 76 466 0.00% 77 519 0.00% 78 564 0.00% 79 653 0.00% 80 752 0.00% 81 915 0.00% 82 1011 0.00% 83 1195 0.01% 84 2211 0.01% 85 2762 0.01% 86 2896 0.01% 87 2879 0.01% 88 3093 0.01% 89 3223 0.01% 90 3413 0.02% 91 3643 0.02% 92 4023 0.02% 93 4138 0.02% 94 4154 0.02% 95 4530 0.02% 96 4791 0.02% 97 5137 0.02% 98 5515 0.02% 99 5797 0.03% 100 5975 0.03% 101 6496 0.03% 102 7015 0.03% 103 7330 0.03% 104 7731 0.03% 105 8092 0.04% 106 8749 0.04% 107 9514 0.04% 108 9911 0.04% 109 10554 0.05% 110 11290 0.05% 111 12011 0.05% 112 12742 0.06% 113 13833 0.06% 114 14277 0.06% 115 15412 0.07% 116 16356 0.07% 117 17159 0.08% 118 18202 0.08% 119 19281 0.09% 120 20210 0.09% 121 21495 0.10% 122 22774 0.10% 123 24741 0.11% 124 26458 0.12% 125 28547 0.13% 126 30813 0.14% 127 33091 0.15% 128 35750 0.16% 129 38151 0.17% 130 41090 0.18% 131 44497 0.20% 132 48681 0.22% 133 53512 0.24% 134 58131 0.26% 135 63702 0.28% 136 69754 0.31% 137 77328 0.34% 138 86074 0.38% 139 96387 0.43% 140 108222 0.48% 141 123012 0.54% 142 145607 0.64% 143 168794 0.75% 144 206237 0.91% 145 256316 1.13% 146 331691 1.47% 147 467941 2.07% 148 723367 3.20% 149 1412441 6.24% 150 5997300 26.51% 151 11458335 50.64% 22625230 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=33 prefix-density=0.22 prefix-fanout=2.6 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTG criterion=fanout-score sequence-density=0.13 sequence-density-rank=9 fanout-score=100.32 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=19.2 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=38 prefix-density=0.39 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=54.96 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=13.9 sequence=TGTTGGTGGTGG SRR7169124 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:47:59 Started mapping on | Feb 10 22:47:59 Finished on | Feb 10 22:50:09 Mapping speed, Million of reads per hour | 626.54 Number of input reads | 22625230 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 21508536 Uniquely mapped reads % | 95.06% Average mapped length | 296.92 Number of splices: Total | 20974790 Number of splices: Annotated (sjdb) | 20653310 Number of splices: GT/AG | 20683046 Number of splices: GC/AG | 236143 Number of splices: AT/AC | 16143 Number of splices: Non-canonical | 39458 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 391188 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 58337 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.90% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 748884 748884 748884 N_multimapping 391188 391188 391188 N_noFeature 430644 21293636 524318 N_ambiguous 213295 1107 91260 UnstrandedReadsAssigned:20864597 PositiveStrandReadsAssigned:213793 NegativeStrandReadsAssigned:20892958 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169124 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169124-trimmed-pair1.fastq SRR7169124-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,625,230 reads, 20,753,085 reads pseudoaligned [quant] estimated average fragment length: 288.629 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52401 SRR7169124.ke.tsv 34699 SRR7169124.se.tsv 87100 total ==> SRR7169124.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1730.37 342 9.33607 Potri.005G024800.1.v4.1 1035 747.371 27 1.70649 Potri.004G059700.1.v4.1 961 673.445 2 0.140283 Potri.007G009000.2.v4.1 1416 1128.37 0 0 Potri.003G141000.2.v4.1 2943 2655.37 441.032 7.84553 Potri.016G087400.1.v4.1 270 57.8355 1601 1307.6 Potri.015G069301.1.v4.1 564 285.06 0 0 Potri.010G195200.1.v4.1 1773 1485.37 27 0.85863 Potri.012G127500.1.v4.1 977 689.4 7094 486.068 ==> SRR7169124.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1542 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 262 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169124 completed mapping pipeline successfully