Starting /dee2/code/volunteer_pipeline.sh SRR7169125 current disk space = 3057597030400 free memory = 1410108176 SRR7169125 SRAfilesize 544ae03a67aa5361324b7c3fc272f5cf SRR7169125.sra SRR7169125.sra file validated SRR7169125 is paired end SRR7169125 is conventional basespace SRR7169125 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169125_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0605 34.0 33.0 34.0 33.0 34.0 2 33.46375 34.0 34.0 34.0 33.0 34.0 3 33.46475 34.0 34.0 34.0 33.0 34.0 4 33.53225 34.0 34.0 34.0 33.0 34.0 5 33.4755 34.0 34.0 34.0 33.0 34.0 6 37.085 38.0 37.0 38.0 36.0 38.0 7 37.374 38.0 38.0 38.0 37.0 38.0 8 37.394 38.0 38.0 38.0 37.0 38.0 9 37.50425 38.0 38.0 38.0 37.0 38.0 10-14 37.48785 38.0 38.0 38.0 37.0 38.0 15-19 37.402 38.0 38.0 38.0 37.0 38.0 20-24 37.3601 38.0 38.0 38.0 37.0 38.0 25-29 37.3519 38.0 38.0 38.0 37.0 38.0 30-34 37.28625 38.0 38.0 38.0 37.0 38.0 35-39 37.20285 38.0 38.0 38.0 36.6 38.0 40-44 36.84765 38.0 38.0 38.0 35.0 38.0 45-49 36.66985 38.0 38.0 38.0 34.6 38.0 50-54 36.60465 38.0 38.0 38.0 34.0 38.0 55-59 36.457699999999996 38.0 37.8 38.0 34.0 38.0 60-64 36.373400000000004 38.0 37.2 38.0 33.6 38.0 65-69 36.3039 38.0 37.0 38.0 33.8 38.0 70-74 36.2331 38.0 37.0 38.0 33.0 38.0 75-79 36.0852 38.0 37.0 38.0 33.0 38.0 80-84 35.95465 38.0 37.0 38.0 32.0 38.0 85-89 35.7891 38.0 37.0 38.0 31.0 38.0 90-94 35.64835 38.0 36.4 38.0 30.2 38.0 95-99 35.368700000000004 38.0 36.0 38.0 29.0 38.0 100-104 35.03254999999999 38.0 36.0 38.0 28.2 38.0 105-109 34.9009 38.0 35.8 38.0 27.4 38.0 110-114 34.7494 38.0 35.0 38.0 27.0 38.0 115-119 34.3518 38.0 34.8 38.0 24.8 38.0 120-124 34.0428 38.0 34.0 38.0 23.4 38.0 125-129 33.720150000000004 38.0 34.0 38.0 22.2 38.0 130-134 33.22735 38.0 34.0 38.0 17.4 38.0 135-139 32.5454 37.6 32.8 38.0 14.8 38.0 140-144 31.7057 36.0 31.2 38.0 14.0 38.0 145-149 30.896349999999995 36.0 31.0 38.0 8.6 38.0 150-151 26.649250000000002 34.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 3.0 15 4.0 16 4.0 17 5.0 18 2.0 19 6.0 20 17.0 21 22.0 22 9.0 23 21.0 24 24.0 25 21.0 26 37.0 27 35.0 28 45.0 29 50.0 30 67.0 31 88.0 32 108.0 33 154.0 34 238.0 35 449.0 36 1049.0 37 1539.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.860759493670884 13.594936708860757 8.632911392405063 30.911392405063292 2 23.799999999999997 14.274999999999999 32.625 29.299999999999997 3 20.0 19.025 27.900000000000002 33.074999999999996 4 21.525 27.400000000000002 22.85 28.225 5 22.425 31.45 24.474999999999998 21.65 6 20.0 33.900000000000006 23.599999999999998 22.5 7 15.625 28.375 38.275 17.724999999999998 8 17.75 28.175 29.4 24.675 9 16.275000000000002 25.974999999999998 33.375 24.375 10-14 20.095 29.57 27.200000000000003 23.135 15-19 19.835 28.999999999999996 27.33 23.835 20-24 19.425 29.03 27.544999999999998 24.0 25-29 19.575 29.24 27.134999999999998 24.05 30-34 20.3 28.425 27.700000000000003 23.575 35-39 20.419999999999998 28.865000000000002 27.01 23.705000000000002 40-44 20.080000000000002 28.79 27.27 23.86 45-49 20.080000000000002 28.53 27.47 23.919999999999998 50-54 20.59 28.895 27.125 23.39 55-59 20.07 28.74 27.35 23.84 60-64 20.385 28.660000000000004 27.265 23.69 65-69 20.315 28.144999999999996 27.495000000000005 24.044999999999998 70-74 20.435 28.884999999999998 27.250000000000004 23.43 75-79 20.54 28.29 27.455000000000002 23.715 80-84 20.455000000000002 28.139999999999997 27.33 24.075 85-89 20.18 28.144999999999996 27.284999999999997 24.39 90-94 20.52 28.675 27.02 23.785 95-99 19.950000000000003 28.63 27.544999999999998 23.875 100-104 20.855 28.15 27.08 23.915 105-109 20.630000000000003 28.53 27.04 23.799999999999997 110-114 20.28 28.395 27.560000000000002 23.765 115-119 20.57 27.875 27.595 23.96 120-124 20.599999999999998 27.384999999999998 27.555000000000003 24.46 125-129 20.935000000000002 27.49 27.639999999999997 23.935000000000002 130-134 21.23 28.1 27.37 23.3 135-139 21.060000000000002 27.794999999999998 27.54 23.605 140-144 20.625 27.875 27.200000000000003 24.3 145-149 21.17 28.08 27.29 23.46 150-151 20.6625 27.9125 27.35 24.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 2.0 23 3.0 24 4.5 25 4.0 26 4.5 27 6.5 28 9.5 29 13.0 30 16.0 31 26.0 32 32.0 33 41.0 34 54.0 35 60.5 36 76.5 37 109.0 38 122.5 39 132.5 40 171.0 41 199.0 42 235.0 43 267.5 44 274.5 45 272.0 46 270.5 47 257.5 48 227.0 49 201.0 50 171.0 51 150.5 52 137.0 53 112.5 54 87.5 55 68.0 56 48.0 57 33.0 58 25.5 59 19.0 60 13.0 61 8.0 62 6.0 63 4.5 64 3.0 65 3.0 66 2.0 67 1.0 68 1.5 69 2.5 70 2.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.4875 0.0 0.0 0.0 0.0 124-125 0.5625 0.0 0.0 0.0 0.0 126-127 0.5874999999999999 0.0 0.0 0.0 0.0 128-129 0.6625000000000001 0.0 0.0 0.0 0.0 130-131 0.75 0.0 0.0 0.0 0.0 132-133 0.875 0.0 0.0 0.0 0.0 134-135 1.025 0.0 0.0 0.0 0.0 136-137 1.1124999999999998 0.0 0.0 0.0 0.0 138-139 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGATT 10 0.006832588 144.9875 2 >>END_MODULE SRR7169125 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169125_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.707 33.0 33.0 34.0 32.0 34.0 2 32.75475 34.0 33.0 34.0 32.0 34.0 3 32.77325 34.0 33.0 34.0 32.0 34.0 4 32.75275 34.0 33.0 34.0 32.0 34.0 5 32.707 34.0 33.0 34.0 32.0 34.0 6 36.81825 38.0 38.0 38.0 36.0 38.0 7 36.8375 38.0 38.0 38.0 36.0 38.0 8 36.85725 38.0 38.0 38.0 36.0 38.0 9 36.77325 38.0 38.0 38.0 36.0 38.0 10-14 36.740300000000005 38.0 38.0 38.0 36.2 38.0 15-19 36.7119 38.0 38.0 38.0 36.2 38.0 20-24 36.66625 38.0 38.0 38.0 36.0 38.0 25-29 36.65814999999999 38.0 38.0 38.0 36.0 38.0 30-34 36.6514 38.0 38.0 38.0 36.0 38.0 35-39 36.60455 38.0 38.0 38.0 36.0 38.0 40-44 36.484950000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.5603 38.0 38.0 38.0 36.0 38.0 50-54 36.5412 38.0 38.0 38.0 36.0 38.0 55-59 36.478750000000005 38.0 38.0 38.0 35.6 38.0 60-64 36.414699999999996 38.0 38.0 38.0 35.2 38.0 65-69 36.3286 38.0 38.0 38.0 35.0 38.0 70-74 36.20855 38.0 38.0 38.0 34.2 38.0 75-79 36.20425 38.0 38.0 38.0 34.2 38.0 80-84 36.1708 38.0 38.0 38.0 34.0 38.0 85-89 36.1476 38.0 38.0 38.0 34.2 38.0 90-94 36.031850000000006 38.0 38.0 38.0 34.0 38.0 95-99 35.904199999999996 38.0 38.0 38.0 33.8 38.0 100-104 35.672700000000006 38.0 38.0 38.0 32.6 38.0 105-109 35.52445 38.0 38.0 38.0 31.0 38.0 110-114 35.43135 38.0 38.0 38.0 31.2 38.0 115-119 35.240300000000005 38.0 37.2 38.0 29.6 38.0 120-124 34.9868 38.0 36.8 38.0 28.0 38.0 125-129 34.86084999999999 38.0 36.4 38.0 28.0 38.0 130-134 34.66325 38.0 36.0 38.0 27.4 38.0 135-139 34.141299999999994 38.0 35.8 38.0 22.8 38.0 140-144 33.522450000000006 38.0 35.0 38.0 17.0 38.0 145-149 33.0071 38.0 35.0 38.0 13.8 38.0 150-151 29.82825 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 13.0 4 5.0 5 5.0 6 4.0 7 2.0 8 1.0 9 3.0 10 2.0 11 4.0 12 3.0 13 3.0 14 6.0 15 9.0 16 4.0 17 4.0 18 9.0 19 10.0 20 9.0 21 14.0 22 14.0 23 14.0 24 18.0 25 13.0 26 21.0 27 24.0 28 31.0 29 37.0 30 37.0 31 68.0 32 68.0 33 83.0 34 112.0 35 181.0 36 463.0 37 2684.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.875 23.9 12.9 22.325 2 27.05 26.924999999999997 28.675 17.349999999999998 3 21.375 29.049999999999997 31.2 18.375 4 23.95 32.550000000000004 23.9 19.6 5 25.05 35.449999999999996 22.05 17.45 6 21.349999999999998 36.199999999999996 24.625 17.825 7 21.125 23.1 36.575 19.2 8 21.9 26.424999999999997 26.724999999999998 24.95 9 21.65 26.025 29.4 22.925 10-14 23.365 28.21 26.474999999999998 21.95 15-19 23.91 27.565 27.845 20.68 20-24 23.400000000000002 28.105000000000004 26.93 21.565 25-29 23.485 28.305000000000003 26.795 21.415 30-34 23.455000000000002 28.205000000000002 26.965 21.375 35-39 23.49 28.044999999999998 27.334999999999997 21.13 40-44 23.544999999999998 28.499999999999996 26.695 21.26 45-49 23.665 27.41 27.67 21.255 50-54 23.395 27.845 28.025 20.735 55-59 23.87 27.55 27.37 21.21 60-64 23.765 27.805000000000003 27.584999999999997 20.845 65-69 23.700290493839525 27.76219573274567 27.136131423419812 21.40138234999499 70-74 23.84318443876272 27.76357346969469 27.12688624855868 21.26635584298391 75-79 23.796644127222642 27.87377911344853 27.32281492612071 21.006761833208117 80-84 23.395 28.110000000000003 27.46 21.035 85-89 24.34 27.755000000000003 27.1 20.805 90-94 23.815 27.700000000000003 27.275 21.21 95-99 23.724999999999998 27.625 27.694999999999997 20.955 100-104 23.76 27.73 27.685 20.825 105-109 23.89 27.055 27.779999999999998 21.275 110-114 23.849999999999998 27.58 27.88 20.69 115-119 24.485 27.644999999999996 27.169999999999998 20.7 120-124 23.515 27.46 27.96 21.065 125-129 24.415 27.36 27.46 20.765 130-134 23.69 27.839999999999996 27.625 20.845 135-139 23.951346481129242 27.275002502753026 27.615376914606067 21.15827410151166 140-144 24.233452100165604 27.736237266020975 27.259497164650977 20.770813469162444 145-149 25.084319154291467 27.868109740750064 27.183488547696953 19.864082557261515 150-151 24.599267954057808 27.476965795784423 28.032310993310617 19.891455256847156 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.5 24 2.0 25 2.0 26 1.5 27 2.0 28 4.0 29 5.5 30 9.5 31 13.5 32 12.5 33 21.5 34 37.0 35 43.0 36 54.5 37 76.5 38 115.0 39 159.0 40 188.5 41 224.0 42 249.5 43 278.0 44 290.5 45 287.5 46 281.0 47 257.0 48 245.0 49 229.5 50 203.0 51 164.0 52 130.5 53 112.5 54 85.0 55 55.5 56 42.5 57 27.0 58 15.5 59 15.5 60 9.5 61 5.5 62 8.0 63 9.0 64 6.5 65 4.5 66 4.0 67 2.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.16999999999999998 70-74 0.265 75-79 0.17500000000000002 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.11 140-144 0.365 145-149 0.675 150-151 0.9625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5625 0.0 0.0 0.0 0.0 126-127 0.5874999999999999 0.0 0.0 0.0 0.0 128-129 0.675 0.0 0.0 0.0 0.0 130-131 0.775 0.0 0.0 0.0 0.0 132-133 0.8999999999999999 0.0 0.0 0.0 0.0 134-135 1.05 0.0 0.0 0.0 0.0 136-137 1.125 0.0 0.0 0.0 0.0 138-139 1.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGGAA 10 0.006836113 144.9625 1 >>END_MODULE Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715577 spots for SRR7169125.sra Written 715577 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra Read 715570 spots for SRR7169125.sra Written 715570 spots for SRR7169125.sra SRR ids: ['SRR7169125.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__0olo74t SRR7169125.sra spots: 14311407 blocks: [[1, 715570], [715571, 1431140], [1431141, 2146710], [2146711, 2862280], [2862281, 3577850], [3577851, 4293420], [4293421, 5008990], [5008991, 5724560], [5724561, 6440130], [6440131, 7155700], [7155701, 7871270], [7871271, 8586840], [8586841, 9302410], [9302411, 10017980], [10017981, 10733550], [10733551, 11449120], [11449121, 12164690], [12164691, 12880260], [12880261, 13595830], [13595831, 14311407]] SRR7169125 file size 4827965 SRR7169125 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169125 SRR7169125_1.fastq SRR7169125_2.fastq Input file: SRR7169125_1.fastq Paired file: SRR7169125_2.fastq trimmed: SRR7169125-trimmed-pair1.fastq, SRR7169125-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:49:24 2025 >> started Mon Feb 10 22:49:52 2025 >> done (27.416s) 14311407 read pairs processed; of these: 36946 ( 0.26%) short read pairs filtered out after trimming by size control 25196 ( 0.18%) empty read pairs filtered out after trimming by size control 14249265 (99.57%) read pairs available; of these: 7561244 (53.06%) trimmed read pairs available after processing 6688021 (46.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 9 0.00% 20 6 0.00% 21 3 0.00% 22 7 0.00% 23 11 0.00% 24 7 0.00% 25 8 0.00% 26 8 0.00% 27 16 0.00% 28 15 0.00% 29 14 0.00% 30 15 0.00% 31 11 0.00% 32 15 0.00% 33 15 0.00% 34 15 0.00% 35 18 0.00% 36 14 0.00% 37 21 0.00% 38 29 0.00% 39 23 0.00% 40 16 0.00% 41 21 0.00% 42 33 0.00% 43 27 0.00% 44 26 0.00% 45 38 0.00% 46 43 0.00% 47 44 0.00% 48 39 0.00% 49 58 0.00% 50 45 0.00% 51 63 0.00% 52 59 0.00% 53 79 0.00% 54 74 0.00% 55 70 0.00% 56 88 0.00% 57 99 0.00% 58 108 0.00% 59 123 0.00% 60 124 0.00% 61 125 0.00% 62 157 0.00% 63 156 0.00% 64 195 0.00% 65 209 0.00% 66 225 0.00% 67 285 0.00% 68 319 0.00% 69 355 0.00% 70 362 0.00% 71 377 0.00% 72 379 0.00% 73 439 0.00% 74 539 0.00% 75 522 0.00% 76 572 0.00% 77 671 0.00% 78 714 0.01% 79 812 0.01% 80 916 0.01% 81 1019 0.01% 82 1251 0.01% 83 1414 0.01% 84 2856 0.02% 85 3532 0.02% 86 3606 0.03% 87 3705 0.03% 88 3803 0.03% 89 3686 0.03% 90 3692 0.03% 91 3816 0.03% 92 4072 0.03% 93 4156 0.03% 94 4457 0.03% 95 4706 0.03% 96 4907 0.03% 97 5196 0.04% 98 5490 0.04% 99 5747 0.04% 100 6183 0.04% 101 6549 0.05% 102 6838 0.05% 103 7175 0.05% 104 7783 0.05% 105 8221 0.06% 106 8886 0.06% 107 9343 0.07% 108 9659 0.07% 109 10190 0.07% 110 10613 0.07% 111 11417 0.08% 112 11835 0.08% 113 12503 0.09% 114 13352 0.09% 115 13916 0.10% 116 14836 0.10% 117 15750 0.11% 118 16772 0.12% 119 17681 0.12% 120 18433 0.13% 121 19493 0.14% 122 20785 0.15% 123 22321 0.16% 124 23661 0.17% 125 25722 0.18% 126 27284 0.19% 127 29217 0.21% 128 31199 0.22% 129 33686 0.24% 130 35530 0.25% 131 38675 0.27% 132 41884 0.29% 133 45277 0.32% 134 49329 0.35% 135 53432 0.37% 136 59335 0.42% 137 65417 0.46% 138 72812 0.51% 139 81848 0.57% 140 90257 0.63% 141 101117 0.71% 142 115433 0.81% 143 132149 0.93% 144 157135 1.10% 145 191805 1.35% 146 244829 1.72% 147 341830 2.40% 148 522673 3.67% 149 976538 6.85% 150 3591631 25.21% 151 6688021 46.94% 14249265 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=42 prefix-density=0.23 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=20 fanout-score=58.28 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=11.6 sequence=TCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGAC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=40 prefix-density=0.20 prefix-fanout=2.1 sequence=ATTGAATGGCCAGTTCAGATGGATTTCTTCTCAGATGAACCGCGTGAGGAATGGAGAGCTCTACCGTTACATTTGTGATACCAAGGGAGCTTTCGTGCAGCCTGCTTTGTATGAGGCTTTTGGATTGACTGTTGTTGAGGCCATGACATGTGGTTTGCCAACCTTTGCTACTTGCAATGGTGGTCCTGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAG criterion=fanout-score sequence-density=0.13 sequence-density-rank=17 fanout-score=41.48 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=10.6 sequence=TGTTGGTGGTGG SRR7169125 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:50:50 Started mapping on | Feb 10 22:50:51 Finished on | Feb 10 22:53:14 Mapping speed, Million of reads per hour | 358.72 Number of input reads | 14249265 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13148852 Uniquely mapped reads % | 92.28% Average mapped length | 295.19 Number of splices: Total | 12196370 Number of splices: Annotated (sjdb) | 12000846 Number of splices: GT/AG | 12023807 Number of splices: GC/AG | 137234 Number of splices: AT/AC | 10063 Number of splices: Non-canonical | 25266 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 231250 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 15539 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.96% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 899729 899729 899729 N_multimapping 231250 231250 231250 N_noFeature 245991 12984098 313339 N_ambiguous 150087 689 52241 UnstrandedReadsAssigned:12752774 PositiveStrandReadsAssigned:164065 NegativeStrandReadsAssigned:12783272 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169125 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169125-trimmed-pair1.fastq SRR7169125-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,249,265 reads, 12,707,034 reads pseudoaligned [quant] estimated average fragment length: 266.605 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,018 rounds 52401 SRR7169125.ke.tsv 34699 SRR7169125.se.tsv 87100 total ==> SRR7169125.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.39 175 6.83616 Potri.005G024800.1.v4.1 1035 769.395 25 2.22432 Potri.004G059700.1.v4.1 961 695.418 1 0.0984374 Potri.007G009000.2.v4.1 1416 1150.39 0 0 Potri.003G141000.2.v4.1 2943 2677.39 206.031 5.26778 Potri.016G087400.1.v4.1 270 62.8417 1359 1480.39 Potri.015G069301.1.v4.1 564 303.823 0 0 Potri.010G195200.1.v4.1 1773 1507.39 15 0.681193 Potri.012G127500.1.v4.1 977 711.395 4586 441.296 ==> SRR7169125.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1401 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 201 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 25 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169125 completed mapping pipeline successfully