Starting /dee2/code/volunteer_pipeline.sh SRR7169126 current disk space = 3057493872640 free memory = 1480979548 SRR7169126 SRAfilesize 5d8533023ae4cd8303a4433965e734b4 SRR7169126.sra SRR7169126.sra file validated SRR7169126 is paired end SRR7169126 is conventional basespace SRR7169126 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169126_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5765 34.0 33.0 34.0 32.0 34.0 2 33.27875 34.0 33.0 34.0 33.0 34.0 3 33.32475 34.0 33.0 34.0 33.0 34.0 4 33.43275 34.0 33.0 34.0 33.0 34.0 5 33.3955 34.0 33.0 34.0 33.0 34.0 6 37.092 38.0 37.0 38.0 36.0 38.0 7 37.326 38.0 38.0 38.0 36.0 38.0 8 37.416 38.0 38.0 38.0 37.0 38.0 9 37.4445 38.0 38.0 38.0 37.0 38.0 10-14 37.04855 38.0 38.0 38.0 35.8 38.0 15-19 37.0924 38.0 38.0 38.0 36.0 38.0 20-24 37.301849999999995 38.0 38.0 38.0 36.6 38.0 25-29 37.14905 38.0 38.0 38.0 36.2 38.0 30-34 37.160250000000005 38.0 38.0 38.0 36.6 38.0 35-39 37.1271 38.0 38.0 38.0 36.2 38.0 40-44 36.99829999999999 38.0 38.0 38.0 35.8 38.0 45-49 36.77635 38.0 38.0 38.0 34.6 38.0 50-54 36.6096 38.0 38.0 38.0 34.0 38.0 55-59 36.2913 38.0 37.2 38.0 33.4 38.0 60-64 36.467600000000004 38.0 37.6 38.0 34.0 38.0 65-69 36.18035 38.0 37.2 38.0 33.0 38.0 70-74 36.12304999999999 38.0 37.0 38.0 32.4 38.0 75-79 36.12495 38.0 37.0 38.0 32.8 38.0 80-84 36.129450000000006 38.0 37.0 38.0 33.0 38.0 85-89 35.86435 38.0 36.8 38.0 31.0 38.0 90-94 35.63505 38.0 36.4 38.0 30.2 38.0 95-99 35.7166 38.0 36.4 38.0 30.6 38.0 100-104 35.1175 38.0 35.8 38.0 28.0 38.0 105-109 34.45205 38.0 34.8 38.0 23.2 38.0 110-114 34.9389 38.0 35.4 38.0 27.4 38.0 115-119 35.09265 38.0 35.2 38.0 28.0 38.0 120-124 34.83104999999999 38.0 35.0 38.0 27.0 38.0 125-129 34.1008 38.0 34.0 38.0 23.2 38.0 130-134 34.313250000000004 38.0 34.6 38.0 24.6 38.0 135-139 33.80035 38.0 34.0 38.0 22.2 38.0 140-144 32.68775 37.2 33.2 38.0 15.4 38.0 145-149 32.10915 36.6 33.0 38.0 13.8 38.0 150-151 28.178375000000003 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 3.0 17 2.0 18 3.0 19 1.0 20 5.0 21 12.0 22 12.0 23 13.0 24 11.0 25 19.0 26 34.0 27 36.0 28 58.0 29 62.0 30 60.0 31 104.0 32 123.0 33 165.0 34 240.0 35 414.0 36 910.0 37 1708.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.68110740835684 12.612150730581902 10.792104588567033 32.91463727249423 2 23.400000000000002 14.85 31.525 30.225 3 20.525 20.7 27.250000000000004 31.525 4 22.3 28.199999999999996 23.425 26.075 5 22.375 33.074999999999996 23.45 21.099999999999998 6 19.975 35.099999999999994 24.099999999999998 20.825 7 15.7 26.400000000000002 40.400000000000006 17.5 8 17.150000000000002 26.75 30.325000000000003 25.775 9 17.2 25.924999999999997 32.800000000000004 24.075 10-14 19.509999999999998 30.095 27.175 23.22 15-19 19.435 28.975 27.77 23.82 20-24 19.725 29.125 27.715 23.435 25-29 20.24 28.955 27.43 23.375 30-34 20.01 28.994999999999997 27.310000000000002 23.685000000000002 35-39 19.689999999999998 28.49 27.575 24.245 40-44 19.725 28.585 27.62 24.07 45-49 20.365 28.38 27.775 23.48 50-54 19.85 27.889999999999997 27.97 24.29 55-59 19.7 28.904999999999998 27.395000000000003 24.0 60-64 19.975 28.925 27.61 23.49 65-69 20.005 28.499999999999996 27.18 24.315 70-74 20.14902980596119 28.680736147229446 27.730546109221844 23.439687937587518 75-79 20.061003050152507 28.14140707035352 27.896394819740987 23.90119505975299 80-84 20.30101505075254 28.531426571328566 27.631381569078457 23.53617680884044 85-89 20.125 28.625 28.044999999999998 23.205000000000002 90-94 20.535 28.215 27.515 23.735 95-99 19.875 28.945 27.175 24.005000000000003 100-104 20.65 28.194999999999997 27.500000000000004 23.655 105-109 20.175 28.365000000000002 27.439999999999998 24.02 110-114 19.95199519951995 27.96279627962796 28.26282628262826 23.82238223822382 115-119 19.99599979999 28.39141957097855 27.631381569078457 23.981199059953 120-124 20.2970297029703 28.70787078707871 27.647764776477647 23.347334733473346 125-129 20.553082962444368 28.189228384257635 27.699154873230984 23.55853378006701 130-134 20.535 27.785 28.110000000000003 23.57 135-139 20.53 28.134999999999998 27.655 23.68 140-144 20.695 28.215 27.284999999999997 23.805 145-149 20.885 27.744999999999997 27.805000000000003 23.565 150-151 20.962500000000002 28.375 27.775 22.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.5 23 2.5 24 3.0 25 2.5 26 5.0 27 8.5 28 7.0 29 11.0 30 17.0 31 24.5 32 35.0 33 37.0 34 51.0 35 70.5 36 88.5 37 113.0 38 139.0 39 150.5 40 177.0 41 208.5 42 243.0 43 275.0 44 281.0 45 280.0 46 267.0 47 259.5 48 237.5 49 209.5 50 170.5 51 138.5 52 114.0 53 90.5 54 78.0 55 54.5 56 36.0 57 26.5 58 18.5 59 12.0 60 11.5 61 9.5 62 7.0 63 6.5 64 5.0 65 4.0 66 3.5 67 1.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.02 75-79 0.005 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.005 120-124 0.01 125-129 0.015 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.0625 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.15 0.0 0.0 0.0 0.0 122-123 0.175 0.0 0.0 0.0 0.0 124-125 0.225 0.0 0.0 0.0 0.0 126-127 0.2875 0.0 0.0 0.0 0.0 128-129 0.375 0.0 0.0 0.0 0.0 130-131 0.4125 0.0 0.0 0.0 0.0 132-133 0.4625 0.0 0.0 0.0 0.0 134-135 0.4875 0.0 0.0 0.0 0.0 136-137 0.55 0.0 0.0 0.0 0.0 138-139 0.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACATT 10 0.006836113 144.9625 6 ATTTCCC 10 0.006836113 144.9625 6 >>END_MODULE SRR7169126 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169126_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74175 33.0 33.0 34.0 32.0 34.0 2 32.998 34.0 33.0 34.0 32.0 34.0 3 32.88925 34.0 33.0 34.0 32.0 34.0 4 32.84525 34.0 33.0 34.0 32.0 34.0 5 32.85 34.0 33.0 34.0 32.0 34.0 6 37.03575 38.0 38.0 38.0 37.0 38.0 7 36.981 38.0 38.0 38.0 36.0 38.0 8 36.98925 38.0 38.0 38.0 36.0 38.0 9 36.741 38.0 38.0 38.0 36.0 38.0 10-14 36.7453 38.0 38.0 38.0 35.8 38.0 15-19 36.831450000000004 38.0 38.0 38.0 36.0 38.0 20-24 36.75605 38.0 38.0 38.0 36.0 38.0 25-29 36.87285 38.0 38.0 38.0 36.0 38.0 30-34 36.89495 38.0 38.0 38.0 36.0 38.0 35-39 36.5104 38.0 38.0 38.0 34.6 38.0 40-44 36.61175 38.0 38.0 38.0 35.0 38.0 45-49 36.7927 38.0 38.0 38.0 35.8 38.0 50-54 36.74215 38.0 38.0 38.0 36.0 38.0 55-59 36.5752 38.0 38.0 38.0 35.0 38.0 60-64 36.6347 38.0 38.0 38.0 35.6 38.0 65-69 36.50945 38.0 38.0 38.0 34.8 38.0 70-74 36.17535 38.0 38.0 38.0 33.4 38.0 75-79 36.3396 38.0 38.0 38.0 34.0 38.0 80-84 36.29225 38.0 38.0 38.0 34.0 38.0 85-89 35.9969 38.0 38.0 38.0 32.6 38.0 90-94 35.93225 38.0 38.0 38.0 32.4 38.0 95-99 36.02235 38.0 38.0 38.0 33.2 38.0 100-104 35.9728 38.0 38.0 38.0 33.0 38.0 105-109 35.646950000000004 38.0 37.4 38.0 31.2 38.0 110-114 35.3021 38.0 37.0 38.0 29.4 38.0 115-119 35.02945 38.0 36.6 38.0 27.6 38.0 120-124 35.27935 38.0 36.6 38.0 30.0 38.0 125-129 34.97895 38.0 36.0 38.0 28.2 38.0 130-134 34.3293 38.0 35.0 38.0 23.8 38.0 135-139 33.796400000000006 38.0 34.8 38.0 20.6 38.0 140-144 33.99855 38.0 35.0 38.0 22.4 38.0 145-149 33.60565 38.0 34.8 38.0 18.8 38.0 150-151 30.194 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 5.0 4 2.0 5 6.0 6 1.0 7 1.0 8 3.0 9 1.0 10 3.0 11 2.0 12 3.0 13 2.0 14 2.0 15 5.0 16 9.0 17 3.0 18 8.0 19 10.0 20 8.0 21 15.0 22 6.0 23 14.0 24 18.0 25 22.0 26 32.0 27 34.0 28 28.0 29 56.0 30 44.0 31 49.0 32 96.0 33 101.0 34 153.0 35 232.0 36 530.0 37 2491.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.561544246678366 23.18876911506643 12.409125094008523 23.84056154424668 2 28.025 27.275 27.400000000000002 17.299999999999997 3 20.5 27.900000000000002 33.125 18.475 4 23.525 33.575 24.099999999999998 18.8 5 25.05 36.375 21.2 17.375 6 20.95 37.5 23.724999999999998 17.825 7 20.849999999999998 22.5 36.95 19.7 8 22.225 25.974999999999998 27.35 24.45 9 22.3 23.75 29.95 24.0 10-14 23.33116655832792 28.981449072453625 26.71633581679084 20.97104855242762 15-19 23.022302230223023 28.147814781478147 27.59275927592759 21.237123712371236 20-24 22.817281728172816 27.907790779077907 28.107810781078108 21.167116711671166 25-29 22.88186455936781 28.55856757027108 27.268180454136242 21.291387416224865 30-34 23.04191257377213 28.128438531559468 27.513253976192857 21.31639491847554 35-39 23.034606921384277 28.155631126225245 27.625525105021005 21.184236847369473 40-44 23.030363663648643 28.422790255615027 27.717472862788256 20.829373217948078 45-49 23.21696508952686 27.71331399419826 28.078423527058117 20.991297389216765 50-54 23.448206872405343 28.15485419896964 27.74971239933977 20.647226529285252 55-59 23.369999999999997 28.535 27.275 20.82 60-64 23.829765953190638 28.14062812562512 27.900580116023203 20.12902580516103 65-69 23.36967393478696 27.770554110822165 27.830566113222645 21.029205841168235 70-74 23.613542031304696 27.999199879981994 27.82417362604391 20.5630844626694 75-79 23.170792698174544 27.551887971993 28.457114278569644 20.820205051262818 80-84 23.195437947076183 28.27272272522635 27.772497623930768 20.759341703766694 85-89 23.986199309965496 27.801390069503473 27.726386319315964 20.48602430121506 90-94 22.8607151787947 28.1470367591898 28.177044261065266 20.81520380095024 95-99 23.688290901815638 27.899764917721203 27.479617866253186 20.932326314209973 100-104 23.792379237923793 27.85778577857786 27.732773277327734 20.617061706170617 105-109 23.289315726290518 27.961184473789512 28.061224489795915 20.688275310124048 110-114 23.35434173669468 28.416366546618647 27.3609443777511 20.868347338935575 115-119 23.86096524131033 28.387096774193548 27.396849212303074 20.355088772193046 120-124 23.86477295459092 27.945589117823566 27.660532106421282 20.529105821164233 125-129 24.18104526131533 27.85696424106027 27.2768192048012 20.685171292823206 130-134 23.686317685917327 27.619857872084875 27.96516865178661 20.72865579021119 135-139 23.349339735894358 27.85614245698279 28.15126050420168 20.64325730292117 140-144 24.16087239257666 27.412335550997952 28.072632684708122 20.354159371717273 145-149 24.438441142628445 28.125469007954372 27.350042523387863 20.086047326029316 150-151 23.05093229883619 27.455887873858092 28.444500062570395 21.04867976473533 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 2.0 26 2.5 27 5.0 28 6.0 29 6.0 30 9.5 31 16.0 32 21.5 33 32.0 34 46.5 35 62.0 36 79.0 37 99.5 38 126.0 39 169.5 40 210.5 41 228.5 42 259.5 43 286.5 44 291.5 45 296.0 46 280.0 47 242.5 48 231.0 49 211.0 50 163.5 51 127.5 52 113.5 53 104.0 54 75.0 55 51.0 56 36.0 57 22.5 58 20.0 59 15.5 60 10.5 61 8.0 62 4.5 63 5.5 64 5.0 65 4.5 66 4.0 67 1.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.01 20-24 0.01 25-29 0.03 30-34 0.03 35-39 0.02 40-44 0.045 45-49 0.03 50-54 0.034999999999999996 55-59 0.0 60-64 0.02 65-69 0.02 70-74 0.015 75-79 0.025 80-84 0.045 85-89 0.005 90-94 0.025 95-99 0.034999999999999996 100-104 0.01 105-109 0.04 110-114 0.04 115-119 0.025 120-124 0.02 125-129 0.025 130-134 0.09 135-139 0.04 140-144 0.045 145-149 0.055 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.0625 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.15 0.0 0.0 0.0 0.0 122-123 0.2 0.0 0.0 0.0 0.0 124-125 0.2375 0.0 0.0 0.0 0.0 126-127 0.2875 0.0 0.0 0.0 0.0 128-129 0.35 0.0 0.0 0.0 0.0 130-131 0.3875 0.0 0.0 0.0 0.0 132-133 0.4375 0.0 0.0 0.0 0.0 134-135 0.4625 0.0 0.0 0.0 0.0 136-137 0.5 0.0 0.0 0.0 0.0 138-139 0.5375000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGAGG 10 0.006577216 146.82278 1 TCTCCTC 10 0.006832588 144.9875 7 >>END_MODULE Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953901 spots for SRR7169126.sra Written 953901 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra Read 953882 spots for SRR7169126.sra Written 953882 spots for SRR7169126.sra SRR ids: ['SRR7169126.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6kwh2doy SRR7169126.sra spots: 19077659 blocks: [[1, 953882], [953883, 1907764], [1907765, 2861646], [2861647, 3815528], [3815529, 4769410], [4769411, 5723292], [5723293, 6677174], [6677175, 7631056], [7631057, 8584938], [8584939, 9538820], [9538821, 10492702], [10492703, 11446584], [11446585, 12400466], [12400467, 13354348], [13354349, 14308230], [14308231, 15262112], [15262113, 16215994], [16215995, 17169876], [17169877, 18123758], [18123759, 19077659]] SRR7169126 file size 6443092 SRR7169126 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169126 SRR7169126_1.fastq SRR7169126_2.fastq Input file: SRR7169126_1.fastq Paired file: SRR7169126_2.fastq trimmed: SRR7169126-trimmed-pair1.fastq, SRR7169126-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:44:18 2025 >> started Mon Feb 10 23:44:39 2025 >> done (20.841s) 19077659 read pairs processed; of these: 26683 ( 0.14%) short read pairs filtered out after trimming by size control 14684 ( 0.08%) empty read pairs filtered out after trimming by size control 19036292 (99.78%) read pairs available; of these: 9306350 (48.89%) trimmed read pairs available after processing 9729942 (51.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 2 0.00% 21 6 0.00% 22 3 0.00% 23 7 0.00% 24 9 0.00% 25 6 0.00% 26 3 0.00% 27 9 0.00% 28 12 0.00% 29 81 0.00% 30 8 0.00% 31 17 0.00% 32 10 0.00% 33 15 0.00% 34 7 0.00% 35 10 0.00% 36 16 0.00% 37 18 0.00% 38 17 0.00% 39 10 0.00% 40 11 0.00% 41 17 0.00% 42 12 0.00% 43 23 0.00% 44 27 0.00% 45 28 0.00% 46 24 0.00% 47 42 0.00% 48 36 0.00% 49 40 0.00% 50 35 0.00% 51 24 0.00% 52 29 0.00% 53 41 0.00% 54 43 0.00% 55 47 0.00% 56 67 0.00% 57 57 0.00% 58 105 0.00% 59 67 0.00% 60 77 0.00% 61 103 0.00% 62 102 0.00% 63 141 0.00% 64 149 0.00% 65 169 0.00% 66 299 0.00% 67 242 0.00% 68 193 0.00% 69 314 0.00% 70 312 0.00% 71 317 0.00% 72 318 0.00% 73 315 0.00% 74 352 0.00% 75 372 0.00% 76 456 0.00% 77 536 0.00% 78 513 0.00% 79 631 0.00% 80 673 0.00% 81 815 0.00% 82 922 0.00% 83 1209 0.01% 84 2331 0.01% 85 2901 0.02% 86 2910 0.02% 87 3026 0.02% 88 2926 0.02% 89 3024 0.02% 90 3144 0.02% 91 3169 0.02% 92 3330 0.02% 93 3521 0.02% 94 3822 0.02% 95 3956 0.02% 96 4108 0.02% 97 4309 0.02% 98 4559 0.02% 99 4775 0.03% 100 5178 0.03% 101 5365 0.03% 102 5792 0.03% 103 6073 0.03% 104 6578 0.03% 105 7130 0.04% 106 7369 0.04% 107 8017 0.04% 108 8289 0.04% 109 8878 0.05% 110 9570 0.05% 111 10249 0.05% 112 10895 0.06% 113 11830 0.06% 114 12565 0.07% 115 13562 0.07% 116 14336 0.08% 117 15187 0.08% 118 16240 0.09% 119 17062 0.09% 120 18305 0.10% 121 19339 0.10% 122 20951 0.11% 123 22592 0.12% 124 24358 0.13% 125 25987 0.14% 126 28083 0.15% 127 30235 0.16% 128 31992 0.17% 129 34303 0.18% 130 37203 0.20% 131 40683 0.21% 132 43952 0.23% 133 47914 0.25% 134 52691 0.28% 135 57349 0.30% 136 63481 0.33% 137 69968 0.37% 138 78475 0.41% 139 87841 0.46% 140 98534 0.52% 141 113066 0.59% 142 132040 0.69% 143 150719 0.79% 144 182855 0.96% 145 227467 1.19% 146 294659 1.55% 147 403903 2.12% 148 617386 3.24% 149 1203320 6.32% 150 4780143 25.11% 151 9729942 51.11% 19036292 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=40 prefix-density=0.15 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=13 fanout-score=242.61 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=28.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=42 prefix-density=0.33 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=282.80 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=29.0 sequence=AAGAAGAAGAAA SRR7169126 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:45:21 Started mapping on | Feb 10 23:45:22 Finished on | Feb 10 23:47:21 Mapping speed, Million of reads per hour | 575.89 Number of input reads | 19036292 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17921726 Uniquely mapped reads % | 94.15% Average mapped length | 296.52 Number of splices: Total | 17159362 Number of splices: Annotated (sjdb) | 16875740 Number of splices: GT/AG | 16901916 Number of splices: GC/AG | 206783 Number of splices: AT/AC | 13820 Number of splices: Non-canonical | 36843 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 346004 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 13510 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.92% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 795637 795637 795637 N_multimapping 346004 346004 346004 N_noFeature 463653 17748592 540769 N_ambiguous 175528 1402 78457 UnstrandedReadsAssigned:17282545 PositiveStrandReadsAssigned:171732 NegativeStrandReadsAssigned:17302500 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169126 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169126-trimmed-pair1.fastq SRR7169126-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,036,292 reads, 17,179,726 reads pseudoaligned [quant] estimated average fragment length: 282.245 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52401 SRR7169126.ke.tsv 34699 SRR7169126.se.tsv 87100 total ==> SRR7169126.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.76 329 10.6037 Potri.005G024800.1.v4.1 1035 753.755 96 7.12924 Potri.004G059700.1.v4.1 961 679.799 1 0.0823421 Potri.007G009000.2.v4.1 1416 1134.76 0 0 Potri.003G141000.2.v4.1 2943 2661.76 312.103 6.56345 Potri.016G087400.1.v4.1 270 57.2481 1091 1066.76 Potri.015G069301.1.v4.1 564 289.419 0 0 Potri.010G195200.1.v4.1 1773 1491.76 106 3.9775 Potri.012G127500.1.v4.1 977 695.78 9487 763.236 ==> SRR7169126.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1905 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 371 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169126 completed mapping pipeline successfully