Starting /dee2/code/volunteer_pipeline.sh SRR7169127 current disk space = 3057733685248 free memory = 1082155064 SRR7169127 SRAfilesize ddf0d3b5a287ebfe582fbed1f0fdc32c SRR7169127.sra SRR7169127.sra file validated SRR7169127 is paired end SRR7169127 is conventional basespace SRR7169127 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169127_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.10375 34.0 34.0 34.0 33.0 34.0 2 33.539 34.0 34.0 34.0 33.0 34.0 3 33.5215 34.0 34.0 34.0 33.0 34.0 4 33.627 34.0 34.0 34.0 33.0 34.0 5 33.60025 34.0 34.0 34.0 33.0 34.0 6 37.392 38.0 38.0 38.0 37.0 38.0 7 37.55825 38.0 38.0 38.0 37.0 38.0 8 37.621 38.0 38.0 38.0 38.0 38.0 9 37.65025 38.0 38.0 38.0 38.0 38.0 10-14 37.67865 38.0 38.0 38.0 38.0 38.0 15-19 37.6562 38.0 38.0 38.0 38.0 38.0 20-24 37.59075 38.0 38.0 38.0 38.0 38.0 25-29 37.5697 38.0 38.0 38.0 38.0 38.0 30-34 37.5262 38.0 38.0 38.0 38.0 38.0 35-39 37.4846 38.0 38.0 38.0 37.8 38.0 40-44 37.266650000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.241949999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.1989 38.0 38.0 38.0 36.2 38.0 55-59 37.01555 38.0 38.0 38.0 36.0 38.0 60-64 37.030150000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.98635 38.0 38.0 38.0 36.0 38.0 70-74 36.918699999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.8432 38.0 38.0 38.0 35.2 38.0 80-84 36.67295 38.0 38.0 38.0 34.8 38.0 85-89 36.5316 38.0 38.0 38.0 34.2 38.0 90-94 36.47580000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.2353 38.0 38.0 38.0 34.0 38.0 100-104 36.057100000000005 38.0 37.4 38.0 33.2 38.0 105-109 35.91865 38.0 37.0 38.0 32.6 38.0 110-114 35.7894 38.0 37.0 38.0 31.8 38.0 115-119 35.581900000000005 38.0 37.0 38.0 31.0 38.0 120-124 35.2596 38.0 36.0 38.0 29.0 38.0 125-129 35.1565 38.0 36.0 38.0 28.8 38.0 130-134 34.7829 38.0 35.6 38.0 27.6 38.0 135-139 34.346999999999994 38.0 35.0 38.0 24.6 38.0 140-144 33.731399999999994 38.0 35.0 38.0 21.8 38.0 145-149 33.24525 38.0 34.6 38.0 18.2 38.0 150-151 29.8185 36.5 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 0.0 15 0.0 16 6.0 17 4.0 18 6.0 19 7.0 20 2.0 21 7.0 22 5.0 23 8.0 24 12.0 25 16.0 26 27.0 27 41.0 28 26.0 29 35.0 30 47.0 31 48.0 32 76.0 33 87.0 34 125.0 35 224.0 36 666.0 37 2519.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.91372748033494 14.00659731032733 10.149708195889367 35.92996701344836 2 23.125 14.75 32.475 29.65 3 19.275000000000002 18.375 26.6 35.75 4 22.825 25.8 23.025000000000002 28.349999999999998 5 23.5 30.15 24.125 22.225 6 19.925 35.55 23.175 21.349999999999998 7 14.374999999999998 28.675 38.775 18.175 8 17.625 28.625 30.55 23.200000000000003 9 16.6 27.025 33.525 22.85 10-14 19.03 30.814999999999998 27.24 22.915 15-19 19.195 29.955 27.815 23.035 20-24 19.75 29.609999999999996 27.605 23.035 25-29 19.66 30.025000000000002 26.83 23.485 30-34 19.81 29.4 27.38 23.41 35-39 19.56 29.404999999999998 27.495000000000005 23.54 40-44 19.965 29.735 27.084999999999997 23.215 45-49 20.175 28.904999999999998 27.07 23.849999999999998 50-54 20.46 29.494999999999997 26.63 23.415 55-59 19.75 29.785 26.655 23.810000000000002 60-64 19.445 29.28 27.525 23.75 65-69 20.06 29.330000000000002 27.26 23.35 70-74 19.915 29.48 27.215 23.39 75-79 19.794999999999998 29.099999999999998 26.87 24.235 80-84 20.165 28.854999999999997 27.134999999999998 23.845 85-89 20.474999999999998 28.694999999999997 27.565 23.265 90-94 20.19 29.049999999999997 26.974999999999998 23.785 95-99 20.255000000000003 29.12 27.245 23.380000000000003 100-104 21.26 28.444999999999997 26.924999999999997 23.369999999999997 105-109 20.815 28.96 27.055 23.169999999999998 110-114 20.73 28.215 27.575 23.48 115-119 20.57 28.055000000000003 27.485 23.89 120-124 20.73 28.71 26.955000000000002 23.605 125-129 20.3 28.535 27.01 24.154999999999998 130-134 21.27 28.53 27.034999999999997 23.165 135-139 20.630000000000003 27.965 28.03 23.375 140-144 20.885 27.955000000000002 27.43 23.73 145-149 20.665 28.470000000000002 26.97 23.895 150-151 21.099999999999998 28.525 26.937499999999996 23.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.5 15 1.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 3.0 24 3.5 25 5.5 26 9.0 27 10.0 28 14.5 29 21.5 30 31.5 31 36.0 32 36.5 33 48.0 34 68.0 35 93.0 36 109.5 37 122.0 38 146.5 39 170.0 40 191.0 41 207.5 42 217.5 43 224.0 44 233.5 45 241.5 46 234.0 47 229.0 48 220.0 49 185.5 50 162.5 51 148.5 52 130.5 53 104.5 54 80.5 55 62.0 56 47.0 57 45.0 58 31.0 59 17.0 60 11.5 61 8.5 62 9.5 63 6.5 64 1.5 65 1.5 66 2.0 67 3.0 68 2.5 69 1.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.7125 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 1.0125 0.0 0.0 0.0 0.0 132-133 1.1749999999999998 0.0 0.0 0.0 0.0 134-135 1.3 0.0 0.0 0.0 0.0 136-137 1.4 0.0 0.0 0.0 0.0 138-139 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGCCAA 10 0.006830828 145.0 8 CCATATT 10 0.006830828 145.0 3 CGAGATG 10 0.006830828 145.0 145 >>END_MODULE SRR7169127 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169127_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83325 33.0 33.0 34.0 32.0 34.0 2 32.9855 34.0 33.0 34.0 32.0 34.0 3 32.954 34.0 33.0 34.0 32.0 34.0 4 32.92475 34.0 33.0 34.0 32.0 34.0 5 32.9005 34.0 33.0 34.0 32.0 34.0 6 37.09725 38.0 38.0 38.0 37.0 38.0 7 37.022 38.0 38.0 38.0 37.0 38.0 8 37.1045 38.0 38.0 38.0 37.0 38.0 9 37.06425 38.0 38.0 38.0 37.0 38.0 10-14 37.0345 38.0 38.0 38.0 37.0 38.0 15-19 37.06785 38.0 38.0 38.0 37.0 38.0 20-24 37.009249999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.0461 38.0 38.0 38.0 37.0 38.0 30-34 37.051 38.0 38.0 38.0 37.0 38.0 35-39 36.958 38.0 38.0 38.0 37.0 38.0 40-44 36.8907 38.0 38.0 38.0 36.6 38.0 45-49 36.93125 38.0 38.0 38.0 37.0 38.0 50-54 36.88555000000001 38.0 38.0 38.0 36.4 38.0 55-59 36.84775 38.0 38.0 38.0 36.0 38.0 60-64 36.8288 38.0 38.0 38.0 36.2 38.0 65-69 36.73535 38.0 38.0 38.0 36.2 38.0 70-74 36.63215 38.0 38.0 38.0 36.0 38.0 75-79 36.5673 38.0 38.0 38.0 35.4 38.0 80-84 36.623900000000006 38.0 38.0 38.0 35.6 38.0 85-89 36.583200000000005 38.0 38.0 38.0 35.6 38.0 90-94 36.5283 38.0 38.0 38.0 35.0 38.0 95-99 36.41225000000001 38.0 38.0 38.0 34.4 38.0 100-104 36.21395 38.0 38.0 38.0 34.0 38.0 105-109 36.0655 38.0 38.0 38.0 34.0 38.0 110-114 35.93820000000001 38.0 38.0 38.0 33.2 38.0 115-119 35.857099999999996 38.0 38.0 38.0 33.2 38.0 120-124 35.6209 38.0 38.0 38.0 32.2 38.0 125-129 35.3659 38.0 37.6 38.0 30.6 38.0 130-134 35.258500000000005 38.0 37.2 38.0 31.0 38.0 135-139 34.833800000000004 38.0 36.2 38.0 28.0 38.0 140-144 34.13895 38.0 35.8 38.0 23.6 38.0 145-149 33.39805 38.0 35.0 38.0 16.6 38.0 150-151 30.1535 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 3.0 4 2.0 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 2.0 11 3.0 12 2.0 13 3.0 14 2.0 15 8.0 16 4.0 17 3.0 18 4.0 19 9.0 20 7.0 21 5.0 22 9.0 23 15.0 24 17.0 25 16.0 26 25.0 27 26.0 28 36.0 29 33.0 30 47.0 31 73.0 32 71.0 33 64.0 34 105.0 35 146.0 36 399.0 37 2844.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.225 22.625 14.6 27.55 2 27.474999999999998 27.575 27.6 17.349999999999998 3 21.575 28.925 29.525000000000002 19.975 4 22.95 33.825 23.925 19.3 5 25.15 34.1 23.45 17.299999999999997 6 21.5 37.25 23.599999999999998 17.65 7 19.55 22.85 39.025 18.575 8 22.775000000000002 24.925 27.525 24.775 9 22.625 25.575 28.425 23.375 10-14 24.435000000000002 28.415000000000003 26.195 20.955 15-19 24.065 27.694999999999997 27.51 20.73 20-24 23.54 28.115000000000002 26.790000000000003 21.555 25-29 23.775 27.805000000000003 27.3 21.12 30-34 23.835 27.495000000000005 27.525 21.145 35-39 23.855 27.55 27.71 20.885 40-44 24.13 27.445000000000004 27.125 21.3 45-49 23.655 27.575 27.42 21.349999999999998 50-54 23.35 27.985 27.395000000000003 21.27 55-59 24.355 27.400000000000002 26.96 21.285 60-64 23.669999999999998 27.615000000000002 27.465 21.25 65-69 24.161780183431063 27.474565228286473 27.665012780033077 20.698641808249384 70-74 23.874529485570893 27.352572145545796 27.432873274780427 21.340025094102884 75-79 24.3812005210943 27.141998196212047 27.512776831345825 20.96402445134783 80-84 23.775 27.97 27.43 20.825 85-89 24.055 27.735 27.815 20.395 90-94 23.95 27.810000000000002 27.534999999999997 20.705000000000002 95-99 23.794999999999998 27.810000000000002 27.99 20.405 100-104 23.765 27.339999999999996 28.084999999999997 20.810000000000002 105-109 24.065 27.755000000000003 27.884999999999998 20.294999999999998 110-114 23.68 27.575 27.74 21.005 115-119 24.3 27.61 27.985 20.105 120-124 23.97 27.644999999999996 28.294999999999998 20.09 125-129 23.97 27.765 27.865000000000002 20.4 130-134 23.75 27.855 27.544999999999998 20.849999999999998 135-139 23.69580454590968 27.030139180935215 28.537098227696006 20.736958045459097 140-144 24.035175879396988 27.814070351758797 27.758793969849243 20.391959798994975 145-149 24.354765392191524 27.875145209354006 27.61250568210516 20.15758371634931 150-151 24.572730725408277 28.066843904291684 27.421192556019747 19.939232814280288 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 2.0 23 2.0 24 1.0 25 2.0 26 4.0 27 3.0 28 6.5 29 9.5 30 9.5 31 16.0 32 21.5 33 28.0 34 38.0 35 46.0 36 59.5 37 74.0 38 103.0 39 146.5 40 190.0 41 217.5 42 234.5 43 264.0 44 284.0 45 278.0 46 279.5 47 275.0 48 245.5 49 216.0 50 189.5 51 174.5 52 149.0 53 111.0 54 79.5 55 63.0 56 48.5 57 33.0 58 22.5 59 15.5 60 12.0 61 9.0 62 8.5 63 8.5 64 6.5 65 3.5 66 2.0 67 1.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.23500000000000001 70-74 0.375 75-79 0.21 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.13 140-144 0.5 145-149 1.005 150-151 1.2625000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.6625 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.8374999999999999 0.0 0.0 0.0 0.0 130-131 0.95 0.0 0.0 0.0 0.0 132-133 1.15 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138-139 1.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAAGT 10 0.006830828 145.0 9 >>END_MODULE Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765260 spots for SRR7169127.sra Written 765260 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra Read 765246 spots for SRR7169127.sra Written 765246 spots for SRR7169127.sra SRR ids: ['SRR7169127.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oy8qd67n SRR7169127.sra spots: 15304934 blocks: [[1, 765246], [765247, 1530492], [1530493, 2295738], [2295739, 3060984], [3060985, 3826230], [3826231, 4591476], [4591477, 5356722], [5356723, 6121968], [6121969, 6887214], [6887215, 7652460], [7652461, 8417706], [8417707, 9182952], [9182953, 9948198], [9948199, 10713444], [10713445, 11478690], [11478691, 12243936], [12243937, 13009182], [13009183, 13774428], [13774429, 14539674], [14539675, 15304934]] SRR7169127 file size 5164639 SRR7169127 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169127 SRR7169127_1.fastq SRR7169127_2.fastq Input file: SRR7169127_1.fastq Paired file: SRR7169127_2.fastq trimmed: SRR7169127-trimmed-pair1.fastq, SRR7169127-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:17:40 2025 >> started Mon Feb 10 23:17:57 2025 >> done (16.812s) 15304934 read pairs processed; of these: 17465 ( 0.11%) short read pairs filtered out after trimming by size control 14382 ( 0.09%) empty read pairs filtered out after trimming by size control 15273087 (99.79%) read pairs available; of these: 6759459 (44.26%) trimmed read pairs available after processing 8513628 (55.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 6 0.00% 21 3 0.00% 22 7 0.00% 23 6 0.00% 24 13 0.00% 25 8 0.00% 26 11 0.00% 27 10 0.00% 28 9 0.00% 29 5 0.00% 30 7 0.00% 31 7 0.00% 32 13 0.00% 33 10 0.00% 34 7 0.00% 35 15 0.00% 36 14 0.00% 37 15 0.00% 38 8 0.00% 39 12 0.00% 40 22 0.00% 41 23 0.00% 42 24 0.00% 43 27 0.00% 44 22 0.00% 45 29 0.00% 46 28 0.00% 47 26 0.00% 48 28 0.00% 49 41 0.00% 50 46 0.00% 51 38 0.00% 52 56 0.00% 53 53 0.00% 54 54 0.00% 55 49 0.00% 56 70 0.00% 57 73 0.00% 58 70 0.00% 59 65 0.00% 60 96 0.00% 61 83 0.00% 62 92 0.00% 63 97 0.00% 64 134 0.00% 65 125 0.00% 66 137 0.00% 67 163 0.00% 68 196 0.00% 69 246 0.00% 70 295 0.00% 71 249 0.00% 72 299 0.00% 73 302 0.00% 74 318 0.00% 75 372 0.00% 76 405 0.00% 77 413 0.00% 78 540 0.00% 79 559 0.00% 80 681 0.00% 81 677 0.00% 82 792 0.01% 83 953 0.01% 84 1739 0.01% 85 2289 0.01% 86 2352 0.02% 87 2576 0.02% 88 2783 0.02% 89 2851 0.02% 90 3021 0.02% 91 3051 0.02% 92 3269 0.02% 93 3193 0.02% 94 3419 0.02% 95 3723 0.02% 96 3975 0.03% 97 4292 0.03% 98 4596 0.03% 99 4660 0.03% 100 5016 0.03% 101 5518 0.04% 102 5925 0.04% 103 6485 0.04% 104 6725 0.04% 105 7521 0.05% 106 7714 0.05% 107 8445 0.06% 108 8818 0.06% 109 9589 0.06% 110 9916 0.06% 111 10396 0.07% 112 10950 0.07% 113 11882 0.08% 114 12481 0.08% 115 13424 0.09% 116 14080 0.09% 117 15055 0.10% 118 15686 0.10% 119 16384 0.11% 120 16942 0.11% 121 17955 0.12% 122 19190 0.13% 123 20725 0.14% 124 21459 0.14% 125 22965 0.15% 126 24381 0.16% 127 26244 0.17% 128 27663 0.18% 129 29916 0.20% 130 31268 0.20% 131 33235 0.22% 132 36164 0.24% 133 38987 0.26% 134 41737 0.27% 135 46013 0.30% 136 49894 0.33% 137 54035 0.35% 138 59301 0.39% 139 65874 0.43% 140 71385 0.47% 141 78765 0.52% 142 88978 0.58% 143 99078 0.65% 144 115987 0.76% 145 140487 0.92% 146 174401 1.14% 147 241896 1.58% 148 374653 2.45% 149 742996 4.86% 150 3683822 24.12% 151 8513628 55.74% 15273087 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=37 prefix-density=0.22 prefix-fanout=2.5 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=59.12 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=4.4 sequence=AATAGCAGCAAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTAAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTATTATCAGTACTCATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGGATTGTGCGCTTGGTCTTGATG criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=7.23 fanout-score-rank=14 prefix-density=0.45 prefix-fanout=4.1 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.06 sequence-density-rank=39 fanout-score=34.20 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=11.6 sequence=TTCTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCGACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7169127 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:18:45 Started mapping on | Feb 10 23:18:45 Finished on | Feb 10 23:21:36 Mapping speed, Million of reads per hour | 321.54 Number of input reads | 15273087 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13896246 Uniquely mapped reads % | 90.99% Average mapped length | 296.61 Number of splices: Total | 11672561 Number of splices: Annotated (sjdb) | 11467664 Number of splices: GT/AG | 11509670 Number of splices: GC/AG | 125400 Number of splices: AT/AC | 9489 Number of splices: Non-canonical | 28002 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 256398 % of reads mapped to multiple loci | 1.68% Number of reads mapped to too many loci | 17801 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.17% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1136858 1136858 1136858 N_multimapping 256398 256398 256398 N_noFeature 301660 13706027 366490 N_ambiguous 186700 1167 60440 UnstrandedReadsAssigned:13407886 PositiveStrandReadsAssigned:189052 NegativeStrandReadsAssigned:13469316 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169127 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169127-trimmed-pair1.fastq SRR7169127-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,273,087 reads, 13,432,595 reads pseudoaligned [quant] estimated average fragment length: 257.287 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR7169127.ke.tsv 34699 SRR7169127.se.tsv 87100 total ==> SRR7169127.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.71 222 7.96071 Potri.005G024800.1.v4.1 1035 778.713 29 2.35264 Potri.004G059700.1.v4.1 961 704.725 3 0.268928 Potri.007G009000.2.v4.1 1416 1159.71 0 0 Potri.003G141000.2.v4.1 2943 2686.71 182.03 4.28012 Potri.016G087400.1.v4.1 270 63.0081 1270 1273.33 Potri.015G069301.1.v4.1 564 310.973 0 0 Potri.010G195200.1.v4.1 1773 1516.71 10 0.416515 Potri.012G127500.1.v4.1 977 720.719 3165 277.423 ==> SRR7169127.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1725 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 244 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169127 completed mapping pipeline successfully