Starting /dee2/code/volunteer_pipeline.sh SRR7169128 current disk space = 3057582993408 free memory = 1476699496 SRR7169128 SRAfilesize 1ef95ddf051362bad5af541fd23ad2ca SRR7169128.sra SRR7169128.sra file validated SRR7169128 is paired end SRR7169128 is conventional basespace SRR7169128 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169128_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.706 34.0 33.0 34.0 32.0 34.0 2 33.25225 34.0 33.0 34.0 32.0 34.0 3 33.31225 34.0 33.0 34.0 33.0 34.0 4 33.35175 34.0 33.0 34.0 33.0 34.0 5 33.41225 34.0 33.0 34.0 33.0 34.0 6 36.9145 38.0 37.0 38.0 35.0 38.0 7 37.336 38.0 38.0 38.0 37.0 38.0 8 37.4455 38.0 38.0 38.0 37.0 38.0 9 37.427 38.0 38.0 38.0 37.0 38.0 10-14 37.3979 38.0 38.0 38.0 37.0 38.0 15-19 37.34955000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.2377 38.0 38.0 38.0 36.6 38.0 25-29 37.232099999999996 38.0 38.0 38.0 36.8 38.0 30-34 37.22365 38.0 38.0 38.0 36.6 38.0 35-39 36.987049999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.9958 38.0 38.0 38.0 35.8 38.0 45-49 36.80485 38.0 38.0 38.0 35.0 38.0 50-54 36.708450000000006 38.0 38.0 38.0 34.4 38.0 55-59 36.592349999999996 38.0 38.0 38.0 34.0 38.0 60-64 36.65955 38.0 38.0 38.0 34.4 38.0 65-69 36.50085 38.0 38.0 38.0 34.0 38.0 70-74 36.3695 38.0 37.6 38.0 33.6 38.0 75-79 36.31035 38.0 37.0 38.0 33.8 38.0 80-84 35.8486 38.0 36.8 38.0 31.0 38.0 85-89 36.06705 38.0 37.0 38.0 32.6 38.0 90-94 35.8352 38.0 37.0 38.0 31.2 38.0 95-99 35.5969 38.0 36.6 38.0 30.2 38.0 100-104 35.277 38.0 36.0 38.0 29.0 38.0 105-109 34.797399999999996 38.0 35.2 38.0 26.2 38.0 110-114 34.7998 38.0 35.2 38.0 26.0 38.0 115-119 35.15315 38.0 35.8 38.0 28.2 38.0 120-124 34.3283 38.0 34.6 38.0 24.4 38.0 125-129 34.0039 38.0 34.0 38.0 22.6 38.0 130-134 33.89 38.0 34.0 38.0 23.0 38.0 135-139 33.481049999999996 38.0 33.8 38.0 19.0 38.0 140-144 32.57895 37.6 33.2 38.0 14.4 38.0 145-149 31.4978 36.0 31.6 38.0 11.4 38.0 150-151 27.505000000000003 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 6.0 14 0.0 15 2.0 16 1.0 17 4.0 18 3.0 19 6.0 20 5.0 21 10.0 22 13.0 23 13.0 24 14.0 25 21.0 26 29.0 27 48.0 28 52.0 29 48.0 30 81.0 31 89.0 32 103.0 33 165.0 34 236.0 35 381.0 36 885.0 37 1784.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.213976026523845 13.823004335628667 9.512879367508289 35.4501402703392 2 22.225 16.925 34.225 26.625 3 17.45 20.9 28.1 33.550000000000004 4 22.0 29.049999999999997 23.825 25.124999999999996 5 22.650000000000002 32.35 24.775 20.225 6 20.549999999999997 34.55 24.45 20.45 7 14.85 26.950000000000003 40.175 18.025 8 18.675 25.924999999999997 30.475 24.925 9 17.349999999999998 24.474999999999998 33.125 25.05 10-14 19.6 29.794999999999998 26.884999999999998 23.72 15-19 19.535 29.304999999999996 27.63 23.53 20-24 19.77 29.03 27.439999999999998 23.76 25-29 20.005 29.04 27.474999999999998 23.48 30-34 19.975 29.310000000000002 26.724999999999998 23.990000000000002 35-39 20.65 28.375 27.705000000000002 23.27 40-44 20.39 28.785 27.37 23.455000000000002 45-49 20.419999999999998 28.43 27.36 23.79 50-54 19.814999999999998 29.07 27.634999999999998 23.48 55-59 20.150000000000002 28.57 27.650000000000002 23.630000000000003 60-64 20.669999999999998 28.565 27.36 23.405 65-69 20.175 28.58 27.21 24.035 70-74 20.275000000000002 28.075 27.58 24.07 75-79 20.665 28.08 27.175 24.08 80-84 19.98 28.655 27.834999999999997 23.53 85-89 19.950000000000003 28.875 27.49 23.685000000000002 90-94 20.24 28.54 27.52 23.7 95-99 20.615 27.985 27.644999999999996 23.755000000000003 100-104 20.04 27.750000000000004 27.785 24.425 105-109 20.57 28.794999999999998 26.97 23.665 110-114 20.815 27.865000000000002 27.060000000000002 24.26 115-119 20.625 28.1 27.21 24.065 120-124 20.305 28.475 27.445000000000004 23.775 125-129 20.96 27.515 27.400000000000002 24.125 130-134 20.235 27.665 28.025 24.075 135-139 20.46 28.415000000000003 27.305 23.82 140-144 21.235 28.610000000000003 26.985 23.169999999999998 145-149 20.955 27.96 27.675 23.41 150-151 20.4125 27.825 27.975 23.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.5 25 4.5 26 6.0 27 5.5 28 9.0 29 13.0 30 16.5 31 25.0 32 32.0 33 39.0 34 54.0 35 66.5 36 77.0 37 98.5 38 126.5 39 159.0 40 191.5 41 202.0 42 232.0 43 263.0 44 270.5 45 276.5 46 288.0 47 290.0 48 247.5 49 201.5 50 175.0 51 147.5 52 118.5 53 101.0 54 74.5 55 47.5 56 38.0 57 32.5 58 22.0 59 13.5 60 8.0 61 5.0 62 4.5 63 1.5 64 0.5 65 1.5 66 1.5 67 0.5 68 0.5 69 1.5 70 1.5 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.037500000000000006 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.11249999999999999 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.2375 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.3 0.0 0.0 0.0 0.0 120-121 0.3125 0.0 0.0 0.0 0.0 122-123 0.3625 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.48750000000000004 0.0 0.0 0.0 0.0 128-129 0.5375000000000001 0.0 0.0 0.0 0.0 130-131 0.6125 0.0 0.0 0.0 0.0 132-133 0.675 0.0 0.0 0.0 0.0 134-135 0.7124999999999999 0.0 0.0 0.0 0.0 136-137 0.7875000000000001 0.0 0.0 0.0 0.0 138-139 0.9125000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169128 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169128_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85625 33.0 33.0 34.0 32.0 34.0 2 32.904 34.0 33.0 34.0 32.0 34.0 3 32.9325 34.0 33.0 34.0 32.0 34.0 4 32.70875 34.0 33.0 34.0 32.0 34.0 5 32.88775 34.0 33.0 34.0 32.0 34.0 6 37.0085 38.0 38.0 38.0 36.0 38.0 7 37.074 38.0 38.0 38.0 37.0 38.0 8 37.03475 38.0 38.0 38.0 37.0 38.0 9 36.833 38.0 38.0 38.0 36.0 38.0 10-14 36.83875 38.0 38.0 38.0 35.8 38.0 15-19 37.01615 38.0 38.0 38.0 36.4 38.0 20-24 36.90405 38.0 38.0 38.0 36.2 38.0 25-29 36.82575 38.0 38.0 38.0 36.0 38.0 30-34 36.942750000000004 38.0 38.0 38.0 36.4 38.0 35-39 36.79915 38.0 38.0 38.0 35.8 38.0 40-44 36.623850000000004 38.0 38.0 38.0 35.2 38.0 45-49 36.8086 38.0 38.0 38.0 36.0 38.0 50-54 36.82404999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.80075 38.0 38.0 38.0 36.0 38.0 60-64 36.6919 38.0 38.0 38.0 35.2 38.0 65-69 36.736149999999995 38.0 38.0 38.0 35.4 38.0 70-74 36.6019 38.0 38.0 38.0 35.0 38.0 75-79 36.5137 38.0 38.0 38.0 34.6 38.0 80-84 36.31705000000001 38.0 38.0 38.0 33.8 38.0 85-89 36.20975 38.0 38.0 38.0 33.8 38.0 90-94 36.0803 38.0 38.0 38.0 32.8 38.0 95-99 36.2739 38.0 38.0 38.0 33.8 38.0 100-104 36.0312 38.0 38.0 38.0 33.2 38.0 105-109 35.93405 38.0 37.6 38.0 32.8 38.0 110-114 35.589800000000004 38.0 37.0 38.0 30.6 38.0 115-119 35.528200000000005 38.0 37.0 38.0 31.0 38.0 120-124 35.42545 38.0 37.0 38.0 31.0 38.0 125-129 35.07945 38.0 36.0 38.0 28.2 38.0 130-134 34.6634 38.0 35.8 38.0 25.8 38.0 135-139 34.42565 38.0 35.0 38.0 24.6 38.0 140-144 34.104699999999994 38.0 35.0 38.0 23.0 38.0 145-149 33.4841 38.0 35.0 38.0 19.8 38.0 150-151 30.049125 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 2.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 4.0 12 4.0 13 3.0 14 2.0 15 9.0 16 3.0 17 5.0 18 4.0 19 2.0 20 10.0 21 14.0 22 11.0 23 17.0 24 13.0 25 19.0 26 26.0 27 25.0 28 48.0 29 37.0 30 54.0 31 76.0 32 68.0 33 88.0 34 163.0 35 248.0 36 458.0 37 2576.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.550000000000004 23.0 12.575 25.874999999999996 2 26.375 27.775 29.825000000000003 16.025 3 19.384692346173086 30.465232616308153 31.21560780390195 18.934467233616807 4 22.26113056528264 35.16758379189594 24.637318659329665 17.933966983491743 5 23.905976494123532 36.434108527131784 22.255563890972745 17.404351087771943 6 22.425 37.75 22.05 17.775 7 20.875 22.725 37.3 19.1 8 21.325 25.95 27.400000000000002 25.324999999999996 9 22.275 24.325 30.65 22.75 10-14 23.200000000000003 27.939999999999998 27.3 21.560000000000002 15-19 22.884999999999998 28.144999999999996 27.575 21.395 20-24 22.770000000000003 27.884999999999998 28.02 21.325 25-29 23.175 28.1 28.08 20.645 30-34 23.705000000000002 27.63 27.965 20.7 35-39 22.765 28.07 27.665 21.5 40-44 22.919999999999998 28.299999999999997 27.67 21.11 45-49 23.255 28.34 27.534999999999997 20.87 50-54 23.400000000000002 28.32 27.6 20.68 55-59 23.505000000000003 27.860000000000003 27.935 20.7 60-64 23.44 28.1 27.74 20.72 65-69 23.755000000000003 27.42 27.915 20.91 70-74 23.895 27.74 27.61 20.755000000000003 75-79 23.685000000000002 28.07 27.265 20.979999999999997 80-84 24.09 27.22 27.615000000000002 21.075 85-89 23.630000000000003 28.09 27.965 20.315 90-94 23.52 27.77 27.950000000000003 20.76 95-99 23.330000000000002 27.800000000000004 27.834999999999997 21.035 100-104 23.41 27.79 27.884999999999998 20.915 105-109 23.595 27.33 28.16 20.915 110-114 24.08 27.735 27.62 20.565 115-119 23.435 28.110000000000003 27.560000000000002 20.895 120-124 23.95 27.42 27.644999999999996 20.985 125-129 23.69 26.735 28.299999999999997 21.275 130-134 23.674999999999997 28.000000000000004 27.79 20.535 135-139 23.400000000000002 27.465 28.294999999999998 20.84 140-144 24.3 28.18 26.915 20.605 145-149 23.615 28.115000000000002 27.32 20.95 150-151 23.674999999999997 27.05 28.199999999999996 21.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 1.5 27 3.0 28 4.5 29 4.5 30 7.5 31 14.0 32 22.0 33 27.5 34 30.0 35 43.5 36 73.5 37 107.5 38 138.5 39 171.5 40 203.5 41 231.5 42 271.0 43 280.0 44 276.5 45 292.0 46 281.5 47 264.5 48 260.5 49 231.5 50 177.5 51 149.5 52 119.5 53 84.0 54 61.0 55 41.5 56 32.0 57 26.5 58 20.0 59 11.5 60 7.0 61 6.5 62 5.5 63 4.0 64 2.5 65 2.5 66 2.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.05 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0125 0.0 0.0 0.0 0.0 104-105 0.037500000000000006 0.0 0.0 0.0 0.0 106-107 0.07500000000000001 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.21250000000000002 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.275 0.0 0.0 0.0 0.0 120-121 0.2875 0.0 0.0 0.0 0.0 122-123 0.3375 0.0 0.0 0.0 0.0 124-125 0.35 0.0 0.0 0.0 0.0 126-127 0.4625 0.0 0.0 0.0 0.0 128-129 0.5375000000000001 0.0 0.0 0.0 0.0 130-131 0.6 0.0 0.0 0.0 0.0 132-133 0.6625000000000001 0.0 0.0 0.0 0.0 134-135 0.7124999999999999 0.0 0.0 0.0 0.0 136-137 0.7875000000000001 0.0 0.0 0.0 0.0 138-139 0.9125000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAAAG 10 0.006830828 145.0 8 TTCAGGC 10 0.006830828 145.0 2 CACAGAG 10 0.006830828 145.0 1 >>END_MODULE Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820330 spots for SRR7169128.sra Written 820330 spots for SRR7169128.sra Read 820342 spots for SRR7169128.sra Written 820342 spots for SRR7169128.sra SRR ids: ['SRR7169128.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rpb3_nqr SRR7169128.sra spots: 16406612 blocks: [[1, 820330], [820331, 1640660], [1640661, 2460990], [2460991, 3281320], [3281321, 4101650], [4101651, 4921980], [4921981, 5742310], [5742311, 6562640], [6562641, 7382970], [7382971, 8203300], [8203301, 9023630], [9023631, 9843960], [9843961, 10664290], [10664291, 11484620], [11484621, 12304950], [12304951, 13125280], [13125281, 13945610], [13945611, 14765940], [14765941, 15586270], [15586271, 16406612]] SRR7169128 file size 5537962 SRR7169128 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169128 SRR7169128_1.fastq SRR7169128_2.fastq Input file: SRR7169128_1.fastq Paired file: SRR7169128_2.fastq trimmed: SRR7169128-trimmed-pair1.fastq, SRR7169128-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:37:16 2025 >> started Mon Feb 10 23:37:34 2025 >> done (18.940s) 16406612 read pairs processed; of these: 16219 ( 0.10%) short read pairs filtered out after trimming by size control 11763 ( 0.07%) empty read pairs filtered out after trimming by size control 16378630 (99.83%) read pairs available; of these: 6964693 (42.52%) trimmed read pairs available after processing 9413937 (57.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 0 0.00% 21 7 0.00% 22 4 0.00% 23 3 0.00% 24 4 0.00% 25 1 0.00% 26 8 0.00% 27 8 0.00% 28 3 0.00% 29 6 0.00% 30 15 0.00% 31 10 0.00% 32 9 0.00% 33 10 0.00% 34 6 0.00% 35 8 0.00% 36 11 0.00% 37 13 0.00% 38 10 0.00% 39 13 0.00% 40 12 0.00% 41 9 0.00% 42 22 0.00% 43 9 0.00% 44 14 0.00% 45 22 0.00% 46 14 0.00% 47 23 0.00% 48 23 0.00% 49 16 0.00% 50 30 0.00% 51 34 0.00% 52 27 0.00% 53 47 0.00% 54 39 0.00% 55 41 0.00% 56 38 0.00% 57 49 0.00% 58 54 0.00% 59 52 0.00% 60 59 0.00% 61 56 0.00% 62 78 0.00% 63 73 0.00% 64 79 0.00% 65 93 0.00% 66 97 0.00% 67 122 0.00% 68 155 0.00% 69 136 0.00% 70 173 0.00% 71 207 0.00% 72 202 0.00% 73 243 0.00% 74 252 0.00% 75 282 0.00% 76 264 0.00% 77 362 0.00% 78 394 0.00% 79 435 0.00% 80 465 0.00% 81 541 0.00% 82 655 0.00% 83 817 0.00% 84 1568 0.01% 85 2011 0.01% 86 2104 0.01% 87 2233 0.01% 88 2327 0.01% 89 2378 0.01% 90 2396 0.01% 91 2563 0.02% 92 2617 0.02% 93 2852 0.02% 94 2847 0.02% 95 3089 0.02% 96 3374 0.02% 97 3481 0.02% 98 3707 0.02% 99 3876 0.02% 100 4081 0.02% 101 4451 0.03% 102 4678 0.03% 103 5103 0.03% 104 5529 0.03% 105 5795 0.04% 106 6195 0.04% 107 6487 0.04% 108 6905 0.04% 109 7218 0.04% 110 7581 0.05% 111 8141 0.05% 112 8650 0.05% 113 9340 0.06% 114 10058 0.06% 115 10780 0.07% 116 11459 0.07% 117 12337 0.08% 118 12508 0.08% 119 13446 0.08% 120 14013 0.09% 121 14920 0.09% 122 15705 0.10% 123 17028 0.10% 124 18256 0.11% 125 19692 0.12% 126 20969 0.13% 127 22519 0.14% 128 23899 0.15% 129 25607 0.16% 130 27402 0.17% 131 29492 0.18% 132 32000 0.20% 133 34694 0.21% 134 37818 0.23% 135 41209 0.25% 136 45661 0.28% 137 49382 0.30% 138 54737 0.33% 139 60610 0.37% 140 67260 0.41% 141 75196 0.46% 142 86123 0.53% 143 100510 0.61% 144 119775 0.73% 145 146734 0.90% 146 189836 1.16% 147 261983 1.60% 148 404664 2.47% 149 793325 4.84% 150 3902540 23.83% 151 9413937 57.48% 16378630 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=38 prefix-density=0.22 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=37 fanout-score=89.79 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=15.2 sequence=TTCTTCAAGAATTTTAAGCAGTGTGCGTCGCTCCAATCATGGCATATCCACTTCATGAAAACGGCATCTGCTTTGGGCACGCTAACAAACATGTCCCCACCAACATGCTCCACACCGGGATAAGATGGGGCATCCTCAATGACGTGGGGCAGATCAAAGTTAATGCCCTTAATTGAAGGGTATTTAGAGACGATGGTGTTAACGACAGCTCCAGTCCCACCACCAACA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=9.69 fanout-score-rank=10 prefix-density=0.35 prefix-fanout=6.2 sequence=TCAATGCTGTTGGAGGTGGTACTGGTTCTGGTCTTGGGTCACTTCTCCTGGAGAGGCTCTCTGTTGACTATGGCAAA criterion=fanout-score sequence-density=0.14 sequence-density-rank=10 fanout-score=41.94 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=11.4 sequence=TGTTGGTGGTGG SRR7169128 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:38:23 Started mapping on | Feb 10 23:38:23 Finished on | Feb 10 23:40:28 Mapping speed, Million of reads per hour | 471.70 Number of input reads | 16378630 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15312102 Uniquely mapped reads % | 93.49% Average mapped length | 297.38 Number of splices: Total | 14488987 Number of splices: Annotated (sjdb) | 14247824 Number of splices: GT/AG | 14287288 Number of splices: GC/AG | 160667 Number of splices: AT/AC | 12169 Number of splices: Non-canonical | 28863 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264765 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 105880 % of reads mapped to too many loci | 0.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.15% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 818880 818880 818880 N_multimapping 264765 264765 264765 N_noFeature 335470 15129076 408344 N_ambiguous 176635 822 65906 UnstrandedReadsAssigned:14799997 PositiveStrandReadsAssigned:182204 NegativeStrandReadsAssigned:14837852 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169128 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169128-trimmed-pair1.fastq SRR7169128-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,378,630 reads, 14,782,275 reads pseudoaligned [quant] estimated average fragment length: 282.729 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR7169128.ke.tsv 34699 SRR7169128.se.tsv 87100 total ==> SRR7169128.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.27 273 10.0318 Potri.005G024800.1.v4.1 1035 753.271 34 2.87979 Potri.004G059700.1.v4.1 961 679.342 3 0.281751 Potri.007G009000.2.v4.1 1416 1134.27 0 0 Potri.003G141000.2.v4.1 2943 2661.27 237.032 5.68265 Potri.016G087400.1.v4.1 270 58.5201 1161.52 1266.35 Potri.015G069301.1.v4.1 564 290.923 0 0 Potri.010G195200.1.v4.1 1773 1491.27 21 0.898453 Potri.012G127500.1.v4.1 977 695.323 4368 400.801 ==> SRR7169128.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1639 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169128 completed mapping pipeline successfully