Starting /dee2/code/volunteer_pipeline.sh SRR7169129 current disk space = 3057702645760 free memory = 1018750040 SRR7169129 SRAfilesize 021ccb4b8d06b3996925b08a593f5e32 SRR7169129.sra SRR7169129.sra file validated SRR7169129 is paired end SRR7169129 is conventional basespace SRR7169129 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169129_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2215 34.0 33.0 34.0 33.0 34.0 2 33.51825 34.0 34.0 34.0 33.0 34.0 3 33.50375 34.0 34.0 34.0 33.0 34.0 4 33.5325 34.0 34.0 34.0 33.0 34.0 5 33.49125 34.0 34.0 34.0 33.0 34.0 6 37.1345 38.0 38.0 38.0 36.0 38.0 7 37.41675 38.0 38.0 38.0 37.0 38.0 8 37.4615 38.0 38.0 38.0 37.0 38.0 9 37.57425 38.0 38.0 38.0 37.0 38.0 10-14 37.53425 38.0 38.0 38.0 37.8 38.0 15-19 37.460950000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.39515 38.0 38.0 38.0 37.0 38.0 25-29 37.35735 38.0 38.0 38.0 37.0 38.0 30-34 37.369 38.0 38.0 38.0 37.0 38.0 35-39 37.219300000000004 38.0 38.0 38.0 36.6 38.0 40-44 36.86725 38.0 38.0 38.0 35.4 38.0 45-49 36.69690000000001 38.0 38.0 38.0 34.2 38.0 50-54 36.62595 38.0 38.0 38.0 34.0 38.0 55-59 36.4716 38.0 37.8 38.0 34.0 38.0 60-64 36.4622 38.0 38.0 38.0 34.0 38.0 65-69 36.4013 38.0 37.4 38.0 33.8 38.0 70-74 36.30050000000001 38.0 37.0 38.0 33.8 38.0 75-79 36.1021 38.0 37.0 38.0 33.0 38.0 80-84 35.9499 38.0 37.0 38.0 32.8 38.0 85-89 35.676100000000005 38.0 37.0 38.0 31.0 38.0 90-94 35.4718 38.0 36.2 38.0 29.8 38.0 95-99 35.3321 38.0 36.0 38.0 29.0 38.0 100-104 35.084050000000005 38.0 36.0 38.0 28.8 38.0 105-109 34.84925 38.0 35.8 38.0 27.4 38.0 110-114 34.64085 38.0 35.0 38.0 26.8 38.0 115-119 34.327749999999995 38.0 35.0 38.0 24.6 38.0 120-124 33.94955 38.0 34.2 38.0 21.4 38.0 125-129 33.665600000000005 38.0 34.0 38.0 20.6 38.0 130-134 33.1012 38.0 34.0 38.0 15.0 38.0 135-139 32.49775 37.6 32.6 38.0 14.6 38.0 140-144 31.7001 36.2 31.6 38.0 14.0 38.0 145-149 31.05625 36.0 31.0 38.0 8.8 38.0 150-151 26.904 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 3.0 13 0.0 14 3.0 15 2.0 16 4.0 17 5.0 18 8.0 19 12.0 20 10.0 21 11.0 22 14.0 23 20.0 24 23.0 25 23.0 26 42.0 27 27.0 28 40.0 29 51.0 30 74.0 31 69.0 32 92.0 33 166.0 34 255.0 35 443.0 36 1097.0 37 1503.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.106592573882295 14.725940894165193 11.012882040919424 32.15458449103309 2 24.825 15.15 28.95 31.075000000000003 3 19.950000000000003 17.549999999999997 25.575 36.925000000000004 4 21.6 25.75 24.25 28.4 5 23.225 28.925 23.974999999999998 23.875 6 19.950000000000003 33.85 24.725 21.475 7 15.675 31.0 36.85 16.475 8 16.525000000000002 31.05 29.925 22.5 9 16.125 27.950000000000003 33.175 22.75 10-14 18.695 32.185 27.1 22.02 15-19 19.585 30.425 27.025 22.965 20-24 19.89 30.375000000000004 27.095000000000002 22.64 25-29 19.919999999999998 30.04 27.255000000000003 22.785 30-34 19.345000000000002 30.245 26.950000000000003 23.46 35-39 19.54 30.4 26.87 23.189999999999998 40-44 19.525000000000002 29.765000000000004 27.01 23.7 45-49 19.875 30.135 26.88 23.11 50-54 19.85 30.049999999999997 26.484999999999996 23.615 55-59 20.285 29.995 26.284999999999997 23.435 60-64 19.74 29.904999999999998 26.650000000000002 23.705000000000002 65-69 19.84 30.305 26.345000000000002 23.51 70-74 20.055 29.959999999999997 26.495 23.49 75-79 19.895 29.435 26.41 24.26 80-84 20.57 29.62 26.605 23.205000000000002 85-89 20.015 29.904999999999998 26.815 23.265 90-94 20.355 29.354999999999997 26.6 23.69 95-99 20.11 28.515 26.974999999999998 24.4 100-104 20.175 29.104999999999997 27.325 23.395 105-109 19.93 28.999999999999996 26.779999999999998 24.29 110-114 20.4 28.73 26.43 24.44 115-119 20.474999999999998 29.409999999999997 26.6 23.515 120-124 20.375 29.345 26.810000000000002 23.47 125-129 20.369999999999997 28.360000000000003 27.29 23.98 130-134 20.49 28.939999999999998 26.275 24.295 135-139 20.349999999999998 29.270000000000003 26.545 23.835 140-144 20.805 28.225 26.88 24.09 145-149 20.825 28.665000000000003 26.43 24.08 150-151 20.75 27.775 27.3375 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.0 7 1.0 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 2.0 17 1.5 18 0.5 19 1.0 20 1.5 21 2.5 22 2.0 23 2.0 24 4.5 25 6.0 26 7.0 27 11.0 28 16.0 29 27.0 30 37.5 31 51.0 32 58.0 33 59.0 34 73.5 35 100.0 36 114.5 37 120.0 38 137.5 39 151.5 40 173.0 41 189.0 42 203.0 43 229.0 44 251.5 45 246.5 46 224.5 47 225.0 48 219.5 49 187.5 50 160.5 51 130.5 52 103.5 53 93.5 54 77.5 55 66.5 56 59.0 57 39.0 58 24.0 59 22.0 60 20.0 61 16.0 62 12.0 63 7.5 64 5.5 65 4.5 66 3.5 67 3.5 68 3.0 69 3.0 70 2.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19069296914516 98.05 2 0.6575619625695498 1.3 3 0.12645422357106728 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025290844714213456 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATATAATCTCGTATGC 11 0.27499999999999997 TruSeq Adapter, Index 9 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.6625000000000001 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.9125 0.0 0.0 0.0 0.0 130-131 1.1125 0.0 0.0 0.0 0.0 132-133 1.2875 0.0 0.0 0.0 0.0 134-135 1.4874999999999998 0.0 0.0 0.0 0.0 136-137 1.575 0.0 0.0 0.0 0.0 138-139 1.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169129 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169129_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90525 33.0 33.0 34.0 32.0 34.0 2 33.0065 34.0 33.0 34.0 32.0 34.0 3 32.9565 34.0 33.0 34.0 32.0 34.0 4 32.9305 34.0 33.0 34.0 33.0 34.0 5 32.8975 34.0 33.0 34.0 32.0 34.0 6 37.06175 38.0 38.0 38.0 37.0 38.0 7 36.94625 38.0 38.0 38.0 37.0 38.0 8 36.96775 38.0 38.0 38.0 37.0 38.0 9 36.977 38.0 38.0 38.0 37.0 38.0 10-14 36.928700000000006 38.0 38.0 38.0 37.0 38.0 15-19 36.8895 38.0 38.0 38.0 37.0 38.0 20-24 36.883 38.0 38.0 38.0 37.0 38.0 25-29 36.84375 38.0 38.0 38.0 36.8 38.0 30-34 36.79774999999999 38.0 38.0 38.0 37.0 38.0 35-39 36.7877 38.0 38.0 38.0 36.4 38.0 40-44 36.73455 38.0 38.0 38.0 36.2 38.0 45-49 36.7231 38.0 38.0 38.0 36.0 38.0 50-54 36.694900000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.6521 38.0 38.0 38.0 36.0 38.0 60-64 36.6357 38.0 38.0 38.0 36.0 38.0 65-69 36.52255 38.0 38.0 38.0 35.8 38.0 70-74 36.42335 38.0 38.0 38.0 35.2 38.0 75-79 36.3485 38.0 38.0 38.0 35.0 38.0 80-84 36.333000000000006 38.0 38.0 38.0 34.6 38.0 85-89 36.29995 38.0 38.0 38.0 34.8 38.0 90-94 36.1733 38.0 38.0 38.0 34.0 38.0 95-99 36.04855 38.0 38.0 38.0 34.0 38.0 100-104 35.90815 38.0 38.0 38.0 33.8 38.0 105-109 35.7718 38.0 38.0 38.0 33.0 38.0 110-114 35.622699999999995 38.0 38.0 38.0 32.8 38.0 115-119 35.4435 38.0 37.8 38.0 31.4 38.0 120-124 35.26715 38.0 37.4 38.0 30.6 38.0 125-129 35.0071 38.0 36.8 38.0 28.6 38.0 130-134 34.87445 38.0 36.4 38.0 28.8 38.0 135-139 34.51345 38.0 36.0 38.0 26.8 38.0 140-144 33.95865 38.0 35.0 38.0 22.6 38.0 145-149 33.250299999999996 38.0 35.0 38.0 13.2 38.0 150-151 29.856625 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 6.0 4 1.0 5 5.0 6 1.0 7 3.0 8 2.0 9 2.0 10 3.0 11 3.0 12 1.0 13 5.0 14 6.0 15 8.0 16 7.0 17 15.0 18 7.0 19 13.0 20 13.0 21 11.0 22 7.0 23 18.0 24 15.0 25 19.0 26 18.0 27 17.0 28 35.0 29 23.0 30 31.0 31 46.0 32 65.0 33 83.0 34 105.0 35 172.0 36 415.0 37 2801.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.175 22.475 16.025 23.325000000000003 2 29.75 26.0 26.05 18.2 3 21.349999999999998 29.349999999999998 30.525000000000002 18.775 4 23.599999999999998 33.0 24.325 19.075 5 26.25 33.1 22.825 17.825 6 21.425 36.449999999999996 23.425 18.7 7 21.5 24.025 34.825 19.650000000000002 8 23.7 26.450000000000003 25.324999999999996 24.525 9 21.575 26.950000000000003 28.549999999999997 22.925 10-14 24.365000000000002 28.475 25.474999999999998 21.685 15-19 24.32 27.27 27.075 21.335 20-24 24.64 27.805000000000003 26.424999999999997 21.13 25-29 24.01 28.21 27.015 20.765 30-34 24.42 28.025 27.065 20.49 35-39 24.13 27.589999999999996 27.325 20.955 40-44 24.77 27.63 27.01 20.59 45-49 24.39 27.35 26.855 21.404999999999998 50-54 24.275 27.43 27.639999999999997 20.655 55-59 24.349999999999998 26.784999999999997 27.800000000000004 21.065 60-64 23.9 27.12 27.750000000000004 21.23 65-69 23.193193193193192 27.852852852852855 27.967967967967965 20.985985985985987 70-74 24.13655020522575 28.010811893082387 27.089798778656522 20.76283912303534 75-79 23.366029426483838 27.60484435992393 28.2754479031128 20.753678310479433 80-84 24.08 27.22 27.72 20.979999999999997 85-89 23.615 27.565 27.47 21.349999999999998 90-94 24.38 27.605 27.435 20.580000000000002 95-99 24.15 27.755000000000003 27.74 20.355 100-104 24.525 27.224999999999998 27.584999999999997 20.665 105-109 24.36 27.76 27.67 20.21 110-114 24.195 27.0 28.17 20.635 115-119 24.19 26.71 28.115000000000002 20.985 120-124 24.205 27.37 27.865000000000002 20.560000000000002 125-129 23.685000000000002 27.839999999999996 27.68 20.794999999999998 130-134 24.6 26.52 28.49 20.39 135-139 24.414648789273564 26.64598759255553 28.61717030218131 20.322193315989594 140-144 24.181991281254696 27.38387533196372 28.00521120408879 20.42892218269279 145-149 23.702065638035887 26.994019198874202 28.95411368548022 20.349801477609688 150-151 24.826717076244485 27.22117202268431 27.82608695652174 20.126023944549466 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.0 26 1.0 27 3.0 28 5.5 29 8.5 30 10.5 31 14.0 32 24.0 33 31.5 34 37.0 35 44.5 36 58.5 37 74.5 38 106.0 39 128.5 40 153.5 41 205.0 42 243.5 43 270.0 44 277.5 45 278.5 46 299.0 47 295.5 48 252.0 49 215.0 50 182.0 51 150.0 52 130.5 53 112.5 54 89.5 55 70.5 56 58.5 57 51.0 58 35.5 59 18.0 60 12.0 61 14.0 62 12.0 63 5.0 64 2.0 65 1.5 66 2.0 67 1.0 68 0.0 69 1.5 70 2.5 71 1.5 72 1.5 73 1.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.1 70-74 0.11 75-79 0.09 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.06 140-144 0.215 145-149 0.515 150-151 0.8125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11459650898053 97.95 2 0.7589172780166962 1.5 3 0.10118897040222614 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025297242600556536 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 10 0.25 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.5874999999999999 0.0 0.0 0.0 0.0 122-123 0.675 0.0 0.0 0.0 0.0 124-125 0.7124999999999999 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 0.9874999999999999 0.0 0.0 0.0 0.0 130-131 1.1625 0.0 0.0 0.0 0.0 132-133 1.3375 0.0 0.0 0.0 0.0 134-135 1.4874999999999998 0.0 0.0 0.0 0.0 136-137 1.5499999999999998 0.0 0.0 0.0 0.0 138-139 1.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660728 spots for SRR7169129.sra Written 660728 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra Read 660718 spots for SRR7169129.sra Written 660718 spots for SRR7169129.sra SRR ids: ['SRR7169129.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7fu_obo2 SRR7169129.sra spots: 13214370 blocks: [[1, 660718], [660719, 1321436], [1321437, 1982154], [1982155, 2642872], [2642873, 3303590], [3303591, 3964308], [3964309, 4625026], [4625027, 5285744], [5285745, 5946462], [5946463, 6607180], [6607181, 7267898], [7267899, 7928616], [7928617, 8589334], [8589335, 9250052], [9250053, 9910770], [9910771, 10571488], [10571489, 11232206], [11232207, 11892924], [11892925, 12553642], [12553643, 13214370]] SRR7169129 file size 4456216 SRR7169129 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169129 SRR7169129_1.fastq SRR7169129_2.fastq Input file: SRR7169129_1.fastq Paired file: SRR7169129_2.fastq trimmed: SRR7169129-trimmed-pair1.fastq, SRR7169129-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:21:05 2025 >> started Mon Feb 10 23:21:20 2025 >> done (15.097s) 13214370 read pairs processed; of these: 27803 ( 0.21%) short read pairs filtered out after trimming by size control 71762 ( 0.54%) empty read pairs filtered out after trimming by size control 13114805 (99.25%) read pairs available; of these: 6983518 (53.25%) trimmed read pairs available after processing 6131287 (46.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 8 0.00% 20 9 0.00% 21 8 0.00% 22 7 0.00% 23 5 0.00% 24 10 0.00% 25 13 0.00% 26 11 0.00% 27 16 0.00% 28 12 0.00% 29 8 0.00% 30 15 0.00% 31 14 0.00% 32 13 0.00% 33 13 0.00% 34 12 0.00% 35 16 0.00% 36 22 0.00% 37 15 0.00% 38 21 0.00% 39 18 0.00% 40 16 0.00% 41 52 0.00% 42 29 0.00% 43 45 0.00% 44 35 0.00% 45 57 0.00% 46 50 0.00% 47 62 0.00% 48 72 0.00% 49 76 0.00% 50 93 0.00% 51 88 0.00% 52 85 0.00% 53 70 0.00% 54 99 0.00% 55 91 0.00% 56 98 0.00% 57 124 0.00% 58 125 0.00% 59 138 0.00% 60 156 0.00% 61 185 0.00% 62 321 0.00% 63 727 0.01% 64 312 0.00% 65 211 0.00% 66 225 0.00% 67 202 0.00% 68 228 0.00% 69 335 0.00% 70 403 0.00% 71 399 0.00% 72 377 0.00% 73 382 0.00% 74 469 0.00% 75 460 0.00% 76 478 0.00% 77 522 0.00% 78 654 0.00% 79 701 0.01% 80 800 0.01% 81 877 0.01% 82 1041 0.01% 83 1278 0.01% 84 2397 0.02% 85 2997 0.02% 86 3010 0.02% 87 3402 0.03% 88 3584 0.03% 89 3487 0.03% 90 3523 0.03% 91 3534 0.03% 92 3709 0.03% 93 3861 0.03% 94 4029 0.03% 95 4191 0.03% 96 4676 0.04% 97 5022 0.04% 98 5256 0.04% 99 5561 0.04% 100 5842 0.04% 101 6166 0.05% 102 6353 0.05% 103 6840 0.05% 104 7294 0.06% 105 8129 0.06% 106 8623 0.07% 107 9351 0.07% 108 9698 0.07% 109 10118 0.08% 110 10817 0.08% 111 11276 0.09% 112 11572 0.09% 113 12638 0.10% 114 13020 0.10% 115 13843 0.11% 116 14816 0.11% 117 15266 0.12% 118 16049 0.12% 119 17139 0.13% 120 17717 0.14% 121 18255 0.14% 122 19732 0.15% 123 21442 0.16% 124 22415 0.17% 125 23729 0.18% 126 25559 0.19% 127 27308 0.21% 128 28851 0.22% 129 31027 0.24% 130 33140 0.25% 131 35509 0.27% 132 37882 0.29% 133 41059 0.31% 134 44109 0.34% 135 47845 0.36% 136 52969 0.40% 137 57696 0.44% 138 64324 0.49% 139 72699 0.55% 140 79797 0.61% 141 89200 0.68% 142 102140 0.78% 143 116837 0.89% 144 140013 1.07% 145 170775 1.30% 146 219324 1.67% 147 308508 2.35% 148 476857 3.64% 149 899142 6.86% 150 3367044 25.67% 151 6131287 46.75% 13114805 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=33 prefix-density=0.28 prefix-fanout=2.4 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=88.34 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=9.8 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=6.07 fanout-score-rank=15 prefix-density=0.48 prefix-fanout=3.7 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=155.36 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.4 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7169129 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:22:07 Started mapping on | Feb 10 23:22:08 Finished on | Feb 10 23:24:53 Mapping speed, Million of reads per hour | 286.14 Number of input reads | 13114805 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 11650032 Uniquely mapped reads % | 88.83% Average mapped length | 295.20 Number of splices: Total | 9549796 Number of splices: Annotated (sjdb) | 9380510 Number of splices: GT/AG | 9412107 Number of splices: GC/AG | 107312 Number of splices: AT/AC | 7713 Number of splices: Non-canonical | 22664 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 227035 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 112313 % of reads mapped to too many loci | 0.86% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.43% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1261834 1261834 1261834 N_multimapping 227035 227035 227035 N_noFeature 214476 11487072 273779 N_ambiguous 150906 951 46568 UnstrandedReadsAssigned:11284650 PositiveStrandReadsAssigned:162009 NegativeStrandReadsAssigned:11329685 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169129 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169129-trimmed-pair1.fastq SRR7169129-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,114,805 reads, 11,368,134 reads pseudoaligned [quant] estimated average fragment length: 254.675 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR7169129.ke.tsv 34699 SRR7169129.se.tsv 87100 total ==> SRR7169129.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.33 161 6.00071 Potri.005G024800.1.v4.1 1035 781.325 42 3.53486 Potri.004G059700.1.v4.1 961 707.331 1 0.0929678 Potri.007G009000.2.v4.1 1416 1162.33 0 0 Potri.003G141000.2.v4.1 2943 2689.33 234 5.72173 Potri.016G087400.1.v4.1 270 62.8606 1283.95 1343.15 Potri.015G069301.1.v4.1 564 312.576 0 0 Potri.010G195200.1.v4.1 1773 1519.33 24 1.03876 Potri.012G127500.1.v4.1 977 723.331 3166 287.825 ==> SRR7169129.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 927 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 282 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 25 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169129 completed mapping pipeline successfully