Starting /dee2/code/volunteer_pipeline.sh SRR7169130 current disk space = 3057575624704 free memory = 1262037944 SRR7169130 SRAfilesize a040a012340110b68f7c3921df362925 SRR7169130.sra SRR7169130.sra file validated SRR7169130 is paired end SRR7169130 is conventional basespace SRR7169130 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169130_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8165 34.0 33.0 34.0 33.0 34.0 2 33.37475 34.0 33.0 34.0 33.0 34.0 3 33.426 34.0 34.0 34.0 33.0 34.0 4 33.49975 34.0 34.0 34.0 33.0 34.0 5 33.44125 34.0 34.0 34.0 33.0 34.0 6 36.94825 38.0 37.0 38.0 36.0 38.0 7 37.35675 38.0 38.0 38.0 37.0 38.0 8 37.453 38.0 38.0 38.0 37.0 38.0 9 37.484 38.0 38.0 38.0 37.0 38.0 10-14 37.4953 38.0 38.0 38.0 37.8 38.0 15-19 37.4521 38.0 38.0 38.0 37.2 38.0 20-24 37.41015 38.0 38.0 38.0 37.0 38.0 25-29 37.35975 38.0 38.0 38.0 37.0 38.0 30-34 37.33445 38.0 38.0 38.0 37.0 38.0 35-39 37.241749999999996 38.0 38.0 38.0 36.6 38.0 40-44 36.976099999999995 38.0 38.0 38.0 35.8 38.0 45-49 36.845150000000004 38.0 38.0 38.0 35.8 38.0 50-54 36.7555 38.0 38.0 38.0 34.6 38.0 55-59 36.7124 38.0 38.0 38.0 34.6 38.0 60-64 36.6674 38.0 38.0 38.0 34.6 38.0 65-69 36.50765 38.0 38.0 38.0 34.0 38.0 70-74 36.47705 38.0 38.0 38.0 34.0 38.0 75-79 36.42405 38.0 38.0 38.0 34.0 38.0 80-84 36.2668 38.0 37.2 38.0 33.6 38.0 85-89 36.094350000000006 38.0 37.0 38.0 32.6 38.0 90-94 35.9123 38.0 37.0 38.0 32.4 38.0 95-99 35.83434999999999 38.0 37.0 38.0 31.8 38.0 100-104 35.56695 38.0 36.2 38.0 30.2 38.0 105-109 35.28655 38.0 36.0 38.0 29.0 38.0 110-114 35.142399999999995 38.0 36.0 38.0 28.6 38.0 115-119 34.7543 38.0 35.0 38.0 27.2 38.0 120-124 34.45775 38.0 35.0 38.0 25.8 38.0 125-129 34.0709 38.0 34.4 38.0 23.6 38.0 130-134 33.763450000000006 38.0 34.0 38.0 22.2 38.0 135-139 33.4774 38.0 34.0 38.0 19.8 38.0 140-144 32.80805 38.0 33.6 38.0 14.4 38.0 145-149 31.92595 38.0 33.0 38.0 11.4 38.0 150-151 27.726125 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 5.0 15 1.0 16 1.0 17 5.0 18 4.0 19 10.0 20 9.0 21 13.0 22 8.0 23 11.0 24 19.0 25 17.0 26 38.0 27 31.0 28 39.0 29 36.0 30 59.0 31 84.0 32 99.0 33 129.0 34 212.0 35 366.0 36 907.0 37 1892.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.228105906313644 13.594704684317719 9.164969450101832 34.0122199592668 2 22.5 15.049999999999999 33.375 29.075 3 19.875 18.975 27.975 33.175 4 21.9 26.700000000000003 23.75 27.650000000000002 5 21.525 31.65 25.374999999999996 21.45 6 21.099999999999998 34.65 22.900000000000002 21.349999999999998 7 14.85 27.575 39.4 18.175 8 17.849999999999998 27.05 31.025000000000002 24.075 9 17.5 25.525 32.95 24.025 10-14 19.545 29.595 27.560000000000002 23.3 15-19 19.994999999999997 28.754999999999995 27.77 23.48 20-24 20.03 28.575 27.529999999999998 23.865 25-29 19.97 28.405 27.365000000000002 24.26 30-34 20.59 28.71 27.195000000000004 23.505000000000003 35-39 19.57 28.345 27.565 24.52 40-44 20.09 28.799999999999997 27.73 23.380000000000003 45-49 19.93 27.965 27.36 24.745 50-54 19.725 28.435 27.439999999999998 24.4 55-59 19.845 28.410000000000004 27.305 24.44 60-64 20.015 28.825 27.544999999999998 23.615 65-69 20.585 28.02 27.445000000000004 23.95 70-74 19.8 28.155 27.589999999999996 24.455 75-79 19.955000000000002 28.23 27.125 24.69 80-84 19.835 28.384999999999998 27.439999999999998 24.34 85-89 20.330000000000002 28.349999999999998 27.384999999999998 23.935000000000002 90-94 20.66 28.185 27.12 24.035 95-99 20.369999999999997 28.625 27.055 23.95 100-104 20.415 27.98 27.715 23.89 105-109 20.34 28.305000000000003 26.669999999999998 24.685000000000002 110-114 20.84 27.355 27.834999999999997 23.97 115-119 20.39 27.465 27.935 24.21 120-124 20.669999999999998 27.675 27.534999999999997 24.12 125-129 20.715 27.13 27.889999999999997 24.265 130-134 20.580000000000002 27.169999999999998 28.050000000000004 24.2 135-139 20.53 27.779999999999998 27.689999999999998 24.0 140-144 20.855 27.744999999999997 27.05 24.349999999999998 145-149 20.375 26.815 27.77 25.040000000000003 150-151 21.4125 27.950000000000003 26.487500000000004 24.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.5 21 2.0 22 1.5 23 0.0 24 1.5 25 4.0 26 5.5 27 6.5 28 9.0 29 16.0 30 20.5 31 25.5 32 32.0 33 38.5 34 55.5 35 70.0 36 80.0 37 100.5 38 124.5 39 161.5 40 183.0 41 195.5 42 236.0 43 260.5 44 252.0 45 251.5 46 260.5 47 254.5 48 226.5 49 188.5 50 168.5 51 155.0 52 142.0 53 117.5 54 86.5 55 62.0 56 47.0 57 41.0 58 29.0 59 17.5 60 17.0 61 16.5 62 10.5 63 8.0 64 4.0 65 1.5 66 3.5 67 3.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7999999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.7250000000000001 0.0 0.0 0.0 0.0 124-125 0.8625 0.0 0.0 0.0 0.0 126-127 1.0125 0.0 0.0 0.0 0.0 128-129 1.15 0.0 0.0 0.0 0.0 130-131 1.2625000000000002 0.0 0.0 0.0 0.0 132-133 1.3624999999999998 0.0 0.0 0.0 0.0 134-135 1.5375 0.0 0.0 0.0 0.0 136-137 1.675 0.0 0.0 0.0 0.0 138-139 1.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAACC 10 0.006830828 145.0 3 >>END_MODULE SRR7169130 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169130_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.56275 33.0 33.0 34.0 32.0 34.0 2 32.64125 33.0 33.0 34.0 32.0 34.0 3 32.76275 34.0 33.0 34.0 32.0 34.0 4 32.6275 34.0 33.0 34.0 32.0 34.0 5 32.72075 34.0 33.0 34.0 32.0 34.0 6 36.82675 38.0 38.0 38.0 36.0 38.0 7 36.86025 38.0 38.0 38.0 37.0 38.0 8 36.817 38.0 38.0 38.0 36.0 38.0 9 36.675 38.0 38.0 38.0 36.0 38.0 10-14 36.732 38.0 38.0 38.0 36.0 38.0 15-19 36.7062 38.0 38.0 38.0 36.0 38.0 20-24 36.64245 38.0 38.0 38.0 36.0 38.0 25-29 36.72285 38.0 38.0 38.0 36.0 38.0 30-34 36.649 38.0 38.0 38.0 36.0 38.0 35-39 36.531600000000005 38.0 38.0 38.0 35.8 38.0 40-44 36.4905 38.0 38.0 38.0 35.2 38.0 45-49 36.50385 38.0 38.0 38.0 35.2 38.0 50-54 36.4765 38.0 38.0 38.0 35.2 38.0 55-59 36.4845 38.0 38.0 38.0 35.0 38.0 60-64 36.45785 38.0 38.0 38.0 35.2 38.0 65-69 36.351150000000004 38.0 38.0 38.0 34.8 38.0 70-74 36.292899999999996 38.0 38.0 38.0 34.4 38.0 75-79 36.121300000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.18365 38.0 38.0 38.0 34.0 38.0 85-89 35.95739999999999 38.0 38.0 38.0 33.4 38.0 90-94 35.9171 38.0 38.0 38.0 33.0 38.0 95-99 35.8792 38.0 38.0 38.0 33.2 38.0 100-104 35.7174 38.0 38.0 38.0 32.8 38.0 105-109 35.5342 38.0 38.0 38.0 31.0 38.0 110-114 35.334849999999996 38.0 37.4 38.0 29.8 38.0 115-119 35.230549999999994 38.0 37.2 38.0 29.8 38.0 120-124 35.079699999999995 38.0 37.0 38.0 28.6 38.0 125-129 34.7959 38.0 36.0 38.0 27.8 38.0 130-134 34.4346 38.0 36.0 38.0 24.6 38.0 135-139 34.2436 38.0 35.8 38.0 23.8 38.0 140-144 33.9659 38.0 35.2 38.0 22.2 38.0 145-149 32.87465 38.0 35.0 38.0 11.4 38.0 150-151 29.303125 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 9.0 4 6.0 5 0.0 6 3.0 7 1.0 8 3.0 9 2.0 10 4.0 11 4.0 12 4.0 13 4.0 14 2.0 15 5.0 16 10.0 17 8.0 18 5.0 19 11.0 20 12.0 21 9.0 22 14.0 23 13.0 24 16.0 25 16.0 26 30.0 27 36.0 28 27.0 29 42.0 30 47.0 31 62.0 32 74.0 33 90.0 34 109.0 35 203.0 36 418.0 37 2678.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.925 22.625 14.274999999999999 24.175 2 28.025 25.924999999999997 28.275 17.775 3 21.099999999999998 28.849999999999998 30.95 19.1 4 24.6 34.1 22.575 18.725 5 26.224999999999998 34.75 21.349999999999998 17.675 6 21.0 36.65 23.425 18.925 7 21.5 22.575 36.55 19.375 8 24.625 25.275 26.224999999999998 23.875 9 21.425 26.05 30.049999999999997 22.475 10-14 24.465 28.455000000000002 25.45 21.63 15-19 23.65 28.675 26.479999999999997 21.195 20-24 23.62 28.17 27.150000000000002 21.060000000000002 25-29 24.035 28.27 26.705000000000002 20.990000000000002 30-34 23.235 28.225 27.215 21.325 35-39 24.04 28.084999999999997 27.04 20.835 40-44 24.32 27.46 26.919999999999998 21.3 45-49 23.79 27.815 27.305 21.09 50-54 23.875 27.529999999999998 27.82 20.775 55-59 24.48 27.735 27.115000000000002 20.669999999999998 60-64 24.445 28.02 26.840000000000003 20.695 65-69 24.119647859143658 27.881152460984392 27.150860344137655 20.848339335734295 70-74 24.968720284270056 27.110755217456585 27.130774235523745 20.789750262749614 75-79 23.736892278360344 28.227384476443728 27.484822638101452 20.550900607094476 80-84 23.935000000000002 27.93 27.41 20.724999999999998 85-89 24.41 27.79 26.88 20.919999999999998 90-94 24.685000000000002 27.71 26.83 20.775 95-99 24.535 27.815 27.35 20.3 100-104 24.515 27.894999999999996 27.07 20.52 105-109 24.62 28.005000000000003 27.125 20.25 110-114 24.654999999999998 28.299999999999997 26.729999999999997 20.315 115-119 24.785 27.800000000000004 27.169999999999998 20.244999999999997 120-124 24.37 27.395000000000003 27.665 20.57 125-129 24.36 28.165000000000003 27.11 20.365 130-134 24.75 27.834999999999997 26.85 20.565 135-139 24.355 27.41 27.644999999999996 20.59 140-144 24.23 27.939999999999998 27.35 20.48 145-149 24.15058303176518 28.146361077603537 27.236630478488138 20.466425412143145 150-151 24.507824331145887 28.21807168096921 27.044422009086322 20.229681978798585 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.5 25 2.0 26 2.0 27 2.0 28 2.0 29 3.5 30 9.0 31 12.5 32 15.5 33 25.5 34 28.5 35 31.0 36 51.5 37 80.0 38 111.5 39 146.5 40 179.5 41 224.5 42 267.5 43 272.0 44 276.0 45 281.0 46 284.0 47 278.0 48 254.5 49 221.5 50 184.5 51 164.0 52 137.0 53 111.0 54 82.0 55 59.5 56 52.5 57 38.5 58 25.0 59 15.5 60 15.0 61 16.0 62 9.5 63 7.0 64 5.0 65 1.5 66 1.5 67 2.5 68 2.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.04 70-74 0.095 75-79 0.345 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.52 150-151 0.95 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.8374999999999999 0.0 0.0 0.0 0.0 126-127 1.0125 0.0 0.0 0.0 0.0 128-129 1.15 0.0 0.0 0.0 0.0 130-131 1.2625000000000002 0.0 0.0 0.0 0.0 132-133 1.3624999999999998 0.0 0.0 0.0 0.0 134-135 1.5375 0.0 0.0 0.0 0.0 136-137 1.7 0.0 0.0 0.0 0.0 138-139 1.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867438 spots for SRR7169130.sra Written 867438 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra Read 867437 spots for SRR7169130.sra Written 867437 spots for SRR7169130.sra SRR ids: ['SRR7169130.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0vanksh4 SRR7169130.sra spots: 17348741 blocks: [[1, 867437], [867438, 1734874], [1734875, 2602311], [2602312, 3469748], [3469749, 4337185], [4337186, 5204622], [5204623, 6072059], [6072060, 6939496], [6939497, 7806933], [7806934, 8674370], [8674371, 9541807], [9541808, 10409244], [10409245, 11276681], [11276682, 12144118], [12144119, 13011555], [13011556, 13878992], [13878993, 14746429], [14746430, 15613866], [15613867, 16481303], [16481304, 17348741]] SRR7169130 file size 5857218 SRR7169130 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169130 SRR7169130_1.fastq SRR7169130_2.fastq Input file: SRR7169130_1.fastq Paired file: SRR7169130_2.fastq trimmed: SRR7169130-trimmed-pair1.fastq, SRR7169130-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:05:15 2025 >> started Mon Feb 10 23:05:33 2025 >> done (17.897s) 17348741 read pairs processed; of these: 29381 ( 0.17%) short read pairs filtered out after trimming by size control 24439 ( 0.14%) empty read pairs filtered out after trimming by size control 17294921 (99.69%) read pairs available; of these: 7645130 (44.20%) trimmed read pairs available after processing 9649791 (55.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 8 0.00% 20 7 0.00% 21 5 0.00% 22 11 0.00% 23 6 0.00% 24 8 0.00% 25 8 0.00% 26 4 0.00% 27 10 0.00% 28 11 0.00% 29 13 0.00% 30 9 0.00% 31 11 0.00% 32 11 0.00% 33 13 0.00% 34 13 0.00% 35 9 0.00% 36 18 0.00% 37 13 0.00% 38 13 0.00% 39 18 0.00% 40 15 0.00% 41 15 0.00% 42 24 0.00% 43 22 0.00% 44 23 0.00% 45 30 0.00% 46 39 0.00% 47 26 0.00% 48 48 0.00% 49 37 0.00% 50 42 0.00% 51 46 0.00% 52 55 0.00% 53 63 0.00% 54 58 0.00% 55 78 0.00% 56 73 0.00% 57 68 0.00% 58 105 0.00% 59 90 0.00% 60 103 0.00% 61 122 0.00% 62 106 0.00% 63 135 0.00% 64 164 0.00% 65 173 0.00% 66 198 0.00% 67 207 0.00% 68 230 0.00% 69 271 0.00% 70 342 0.00% 71 342 0.00% 72 336 0.00% 73 390 0.00% 74 422 0.00% 75 452 0.00% 76 570 0.00% 77 563 0.00% 78 678 0.00% 79 683 0.00% 80 816 0.00% 81 925 0.01% 82 1056 0.01% 83 1320 0.01% 84 2681 0.02% 85 3236 0.02% 86 3249 0.02% 87 3335 0.02% 88 3456 0.02% 89 3403 0.02% 90 3524 0.02% 91 3636 0.02% 92 3964 0.02% 93 4153 0.02% 94 4422 0.03% 95 4568 0.03% 96 4834 0.03% 97 5141 0.03% 98 5405 0.03% 99 5888 0.03% 100 5966 0.03% 101 6220 0.04% 102 6832 0.04% 103 7254 0.04% 104 7774 0.04% 105 8144 0.05% 106 8936 0.05% 107 9087 0.05% 108 9750 0.06% 109 10277 0.06% 110 10850 0.06% 111 11378 0.07% 112 12394 0.07% 113 13171 0.08% 114 13851 0.08% 115 14923 0.09% 116 15891 0.09% 117 16770 0.10% 118 17747 0.10% 119 18326 0.11% 120 19587 0.11% 121 20782 0.12% 122 22139 0.13% 123 23751 0.14% 124 25050 0.14% 125 27114 0.16% 126 28452 0.16% 127 30282 0.18% 128 32112 0.19% 129 34166 0.20% 130 36443 0.21% 131 38890 0.22% 132 41953 0.24% 133 45719 0.26% 134 48511 0.28% 135 52856 0.31% 136 57168 0.33% 137 62543 0.36% 138 68898 0.40% 139 76171 0.44% 140 83391 0.48% 141 91848 0.53% 142 102084 0.59% 143 115394 0.67% 144 135535 0.78% 145 164703 0.95% 146 206939 1.20% 147 287461 1.66% 148 432895 2.50% 149 850541 4.92% 150 4079511 23.59% 151 9649791 55.80% 17294921 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=34 prefix-density=0.16 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=141.95 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=15.8 sequence=TTCTTCAAGAATTTTAAGCAGTGTGCGTCGCTCCAATCATGGCATATCCACTTCATGAAAACGGCATCTGCTTTGGGCACACTAACAAACATGTCCCCACCAACATGCTCCACACCGGGATAAGATGGGGCATCCTCAATGACGTGGGGCAGATCAAAGTTAATGCCCTTAATTGAAGGGTATTTAGAGACGATGGTGTTAACGACAGCTCCAGTCCCACCACCAACA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=6.57 fanout-score-rank=27 prefix-density=0.39 prefix-fanout=3.4 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.10 sequence-density-rank=14 fanout-score=296.10 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=30.4 sequence=AAGAAGAAGAAA SRR7169130 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:06:20 Started mapping on | Feb 10 23:06:20 Finished on | Feb 10 23:08:13 Mapping speed, Million of reads per hour | 550.99 Number of input reads | 17294921 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16100599 Uniquely mapped reads % | 93.09% Average mapped length | 296.49 Number of splices: Total | 15246791 Number of splices: Annotated (sjdb) | 14977754 Number of splices: GT/AG | 15002333 Number of splices: GC/AG | 195981 Number of splices: AT/AC | 13205 Number of splices: Non-canonical | 35272 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 352554 % of reads mapped to multiple loci | 2.04% Number of reads mapped to too many loci | 37787 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.59% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 867563 867563 867563 N_multimapping 352554 352554 352554 N_noFeature 381305 15911285 469446 N_ambiguous 176697 1676 74211 UnstrandedReadsAssigned:15542597 PositiveStrandReadsAssigned:187638 NegativeStrandReadsAssigned:15556942 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169130 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169130-trimmed-pair1.fastq SRR7169130-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,294,921 reads, 15,520,687 reads pseudoaligned [quant] estimated average fragment length: 265.038 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR7169130.ke.tsv 34699 SRR7169130.se.tsv 87100 total ==> SRR7169130.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.96 347 11.1118 Potri.005G024800.1.v4.1 1035 770.962 100 7.28523 Potri.004G059700.1.v4.1 961 697.005 11 0.886406 Potri.007G009000.2.v4.1 1416 1151.96 0 0 Potri.003G141000.2.v4.1 2943 2678.96 273 5.72364 Potri.016G087400.1.v4.1 270 62.4699 1187 1067.23 Potri.015G069301.1.v4.1 564 304.294 0 0 Potri.010G195200.1.v4.1 1773 1508.96 95 3.53607 Potri.012G127500.1.v4.1 977 712.973 17950 1414.06 ==> SRR7169130.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1967 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 451 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR7169130 completed mapping pipeline successfully