Starting /dee2/code/volunteer_pipeline.sh SRR7169131 current disk space = 3057574100992 free memory = 1419122880 SRR7169131 SRAfilesize bbedff5d74a06db5d33881aa7c3b4eae SRR7169131.sra SRR7169131.sra file validated SRR7169131 is paired end SRR7169131 is conventional basespace SRR7169131 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169131_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76675 34.0 33.0 34.0 32.0 34.0 2 33.3165 34.0 33.0 34.0 33.0 34.0 3 33.33275 34.0 33.0 34.0 32.0 34.0 4 33.41075 34.0 33.0 34.0 33.0 34.0 5 33.42675 34.0 34.0 34.0 33.0 34.0 6 36.96725 38.0 37.0 38.0 36.0 38.0 7 37.311 38.0 38.0 38.0 37.0 38.0 8 37.3725 38.0 38.0 38.0 37.0 38.0 9 37.4395 38.0 38.0 38.0 37.0 38.0 10-14 37.38505 38.0 38.0 38.0 37.0 38.0 15-19 37.3467 38.0 38.0 38.0 37.0 38.0 20-24 37.23315 38.0 38.0 38.0 36.8 38.0 25-29 37.23175 38.0 38.0 38.0 36.4 38.0 30-34 37.20635 38.0 38.0 38.0 36.6 38.0 35-39 36.9902 38.0 38.0 38.0 35.8 38.0 40-44 36.9247 38.0 38.0 38.0 35.6 38.0 45-49 36.770199999999996 38.0 38.0 38.0 34.8 38.0 50-54 36.63895 38.0 38.0 38.0 34.2 38.0 55-59 36.55595 38.0 38.0 38.0 34.0 38.0 60-64 36.63355 38.0 38.0 38.0 34.0 38.0 65-69 36.47155 38.0 37.8 38.0 33.8 38.0 70-74 36.2132 38.0 37.0 38.0 33.2 38.0 75-79 36.1769 38.0 37.0 38.0 33.2 38.0 80-84 35.70465 38.0 36.8 38.0 30.2 38.0 85-89 35.969500000000004 38.0 37.0 38.0 32.2 38.0 90-94 35.7718 38.0 37.0 38.0 31.0 38.0 95-99 35.5297 38.0 36.6 38.0 30.2 38.0 100-104 35.1766 38.0 36.0 38.0 28.6 38.0 105-109 34.615249999999996 38.0 35.0 38.0 25.2 38.0 110-114 34.521950000000004 38.0 34.8 38.0 24.8 38.0 115-119 34.9751 38.0 35.2 38.0 27.8 38.0 120-124 34.104699999999994 38.0 34.4 38.0 23.6 38.0 125-129 33.7796 38.0 34.0 38.0 21.4 38.0 130-134 33.67245 38.0 34.0 38.0 22.2 38.0 135-139 33.185249999999996 37.8 33.6 38.0 16.6 38.0 140-144 32.118849999999995 36.6 31.8 38.0 14.4 38.0 145-149 31.011350000000004 36.0 31.0 38.0 8.8 38.0 150-151 26.85875 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 1.0 14 4.0 15 3.0 16 5.0 17 2.0 18 5.0 19 4.0 20 7.0 21 5.0 22 12.0 23 17.0 24 16.0 25 30.0 26 25.0 27 39.0 28 53.0 29 66.0 30 73.0 31 83.0 32 123.0 33 162.0 34 258.0 35 416.0 36 993.0 37 1596.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.35381085903645 13.229671170022941 9.355085393831251 33.06143257710936 2 23.65 14.7 34.325 27.325 3 19.325 21.975 28.825 29.875 4 23.0 28.275 24.3 24.425 5 21.925 34.1 25.3 18.675 6 18.575 34.875 25.15 21.4 7 15.7 26.450000000000003 39.425 18.425 8 17.0 26.924999999999997 30.0 26.075 9 17.224999999999998 24.85 33.6 24.325 10-14 20.330000000000002 30.185000000000002 26.0 23.485 15-19 20.44 28.849999999999998 27.465 23.244999999999997 20-24 19.38 29.075 27.310000000000002 24.235 25-29 20.205000000000002 29.604999999999997 26.905 23.285 30-34 20.315 29.705 26.72 23.26 35-39 20.205000000000002 29.53 26.745 23.52 40-44 20.125 29.160000000000004 27.375 23.34 45-49 19.955000000000002 28.910000000000004 26.755000000000003 24.38 50-54 19.895 29.054999999999996 27.115000000000002 23.935000000000002 55-59 20.990000000000002 28.244999999999997 27.345000000000002 23.419999999999998 60-64 19.705000000000002 28.93 27.48 23.885 65-69 20.41 28.665000000000003 27.52 23.405 70-74 20.205000000000002 28.93 27.400000000000002 23.465 75-79 20.44 28.57 27.665 23.325000000000003 80-84 20.419999999999998 28.88 26.534999999999997 24.165 85-89 20.685000000000002 28.310000000000002 27.395000000000003 23.61 90-94 20.585 28.904999999999998 27.08 23.43 95-99 20.3 28.405 27.644999999999996 23.65 100-104 20.23 28.115000000000002 27.544999999999998 24.11 105-109 20.835 28.08 27.1 23.985 110-114 20.294999999999998 28.645 27.265 23.794999999999998 115-119 20.225 28.58 27.46 23.735 120-124 20.375 28.665000000000003 27.295 23.665 125-129 20.3 28.249999999999996 27.77 23.68 130-134 20.525 28.000000000000004 27.43 24.044999999999998 135-139 20.1 27.589999999999996 27.855 24.455 140-144 20.95 28.28 27.115000000000002 23.655 145-149 20.330000000000002 28.555000000000003 27.04 24.075 150-151 19.7125 28.675 27.55 24.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 0.5 22 0.0 23 1.0 24 1.5 25 1.0 26 1.0 27 2.5 28 6.0 29 10.0 30 16.0 31 29.0 32 45.5 33 53.5 34 51.5 35 64.5 36 87.0 37 110.5 38 129.5 39 150.0 40 191.5 41 240.0 42 239.5 43 230.0 44 267.5 45 267.5 46 259.5 47 254.5 48 232.5 49 203.5 50 166.5 51 146.5 52 134.0 53 112.0 54 84.5 55 58.0 56 36.0 57 27.5 58 23.5 59 18.5 60 10.5 61 5.5 62 6.5 63 5.0 64 0.5 65 0.5 66 4.0 67 4.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.037500000000000006 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.0625 0.0 0.0 0.0 0.0 108-109 0.1125 0.0 0.0 0.0 0.0 110-111 0.1625 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.45 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5625 0.0 0.0 0.0 0.0 126-127 0.65 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.725 0.0 0.0 0.0 0.0 132-133 0.8374999999999999 0.0 0.0 0.0 0.0 134-135 0.9375 0.0 0.0 0.0 0.0 136-137 1.0125 0.0 0.0 0.0 0.0 138-139 1.0750000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169131 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169131_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9775 33.0 33.0 34.0 32.0 34.0 2 33.01375 34.0 33.0 34.0 32.0 34.0 3 33.024 34.0 33.0 34.0 32.0 34.0 4 32.8145 34.0 33.0 34.0 32.0 34.0 5 32.97175 34.0 33.0 34.0 32.0 34.0 6 37.04725 38.0 38.0 38.0 37.0 38.0 7 37.183 38.0 38.0 38.0 37.0 38.0 8 37.16625 38.0 38.0 38.0 37.0 38.0 9 36.976 38.0 38.0 38.0 36.0 38.0 10-14 36.9162 38.0 38.0 38.0 36.4 38.0 15-19 37.0907 38.0 38.0 38.0 37.0 38.0 20-24 36.98965 38.0 38.0 38.0 36.8 38.0 25-29 36.9356 38.0 38.0 38.0 36.4 38.0 30-34 36.96225 38.0 38.0 38.0 36.6 38.0 35-39 36.923500000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.814949999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.925650000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.898649999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.856350000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.70085 38.0 38.0 38.0 35.4 38.0 65-69 36.71825 38.0 38.0 38.0 36.0 38.0 70-74 36.6605 38.0 38.0 38.0 35.4 38.0 75-79 36.6042 38.0 38.0 38.0 34.8 38.0 80-84 36.399649999999994 38.0 38.0 38.0 34.0 38.0 85-89 36.3608 38.0 38.0 38.0 34.0 38.0 90-94 36.1862 38.0 38.0 38.0 33.6 38.0 95-99 36.3083 38.0 38.0 38.0 34.0 38.0 100-104 36.093 38.0 38.0 38.0 33.8 38.0 105-109 35.98720000000001 38.0 37.8 38.0 33.6 38.0 110-114 35.6306 38.0 37.0 38.0 31.4 38.0 115-119 35.57475000000001 38.0 37.0 38.0 31.0 38.0 120-124 35.492650000000005 38.0 37.0 38.0 30.6 38.0 125-129 35.10245 38.0 36.0 38.0 28.8 38.0 130-134 34.6567 38.0 35.8 38.0 26.0 38.0 135-139 34.486599999999996 38.0 35.2 38.0 25.8 38.0 140-144 34.15560000000001 38.0 35.0 38.0 23.4 38.0 145-149 33.5636 38.0 34.8 38.0 20.4 38.0 150-151 30.006249999999998 36.0 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 1.0 5 2.0 6 0.0 7 1.0 8 1.0 9 3.0 10 1.0 11 2.0 12 2.0 13 4.0 14 1.0 15 9.0 16 1.0 17 6.0 18 5.0 19 8.0 20 8.0 21 8.0 22 8.0 23 12.0 24 13.0 25 25.0 26 15.0 27 29.0 28 34.0 29 41.0 30 42.0 31 48.0 32 89.0 33 95.0 34 135.0 35 262.0 36 480.0 37 2598.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.925 23.7 11.1 26.275 2 27.750000000000004 25.95 28.825 17.474999999999998 3 19.80495123780945 28.832208052013 32.30807701925482 19.05476369092273 4 22.661330665332667 34.29214607303652 24.487243621810904 18.55927963981991 5 23.5 35.325 22.075 19.1 6 20.349999999999998 37.925 23.549999999999997 18.175 7 19.6 21.3 39.1 20.0 8 21.099999999999998 25.45 27.35 26.1 9 22.275 25.324999999999996 28.95 23.45 10-14 23.59 28.665000000000003 26.77 20.974999999999998 15-19 22.915 27.689999999999998 28.075 21.32 20-24 23.355 27.500000000000004 27.87 21.275 25-29 23.380000000000003 27.92 27.900000000000002 20.8 30-34 23.119999999999997 27.935 27.735 21.21 35-39 22.84 29.015 27.18 20.965 40-44 23.04 28.185 27.76 21.015 45-49 23.025000000000002 28.134999999999998 27.939999999999998 20.9 50-54 22.725 28.310000000000002 28.16 20.805 55-59 23.355 27.735 28.46 20.45 60-64 22.84 27.665 28.095 21.4 65-69 23.47 27.61 27.91 21.01 70-74 22.869999999999997 27.47 28.4 21.26 75-79 23.405 27.405 28.694999999999997 20.495 80-84 23.745 27.095000000000002 28.465 20.695 85-89 24.03 27.939999999999998 27.860000000000003 20.169999999999998 90-94 23.724999999999998 27.42 27.985 20.87 95-99 23.265 27.74 28.355000000000004 20.64 100-104 23.915 27.779999999999998 27.6 20.705000000000002 105-109 23.380000000000003 27.310000000000002 28.17 21.14 110-114 24.3 27.515 27.655 20.53 115-119 23.525 27.735 27.944999999999997 20.794999999999998 120-124 23.27 27.544999999999998 28.139999999999997 21.044999999999998 125-129 23.34 27.505000000000003 27.894999999999996 21.26 130-134 23.57 27.589999999999996 28.365000000000002 20.474999999999998 135-139 23.645 27.785 27.855 20.715 140-144 23.7 28.21 27.794999999999998 20.294999999999998 145-149 23.98 27.744999999999997 27.88 20.395 150-151 24.175 27.625 28.1 20.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.5 25 4.0 26 6.5 27 5.0 28 3.5 29 5.0 30 10.0 31 19.5 32 21.0 33 33.5 34 51.5 35 60.0 36 78.5 37 112.0 38 145.0 39 166.5 40 182.0 41 205.5 42 246.0 43 275.0 44 293.0 45 313.0 46 284.5 47 259.0 48 233.0 49 198.0 50 183.0 51 147.5 52 118.5 53 95.0 54 63.5 55 43.0 56 36.0 57 27.5 58 16.5 59 11.0 60 8.5 61 5.5 62 5.5 63 5.5 64 4.5 65 4.0 66 3.5 67 3.5 68 3.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62330487192365 99.175 2 0.3515821195379206 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.025113008538422906 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTACAAGCGCAAATCACTCGAAGCAGAAGCTTACTCATTTTAATTACTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.037500000000000006 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.0625 0.0 0.0 0.0 0.0 108-109 0.1125 0.0 0.0 0.0 0.0 110-111 0.1625 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.45 0.0 0.0 0.0 0.0 124-125 0.5375 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.6625000000000001 0.0 0.0 0.0 0.0 130-131 0.7124999999999999 0.0 0.0 0.0 0.0 132-133 0.8374999999999999 0.0 0.0 0.0 0.0 134-135 0.9375 0.0 0.0 0.0 0.0 136-137 1.0125 0.0 0.0 0.0 0.0 138-139 1.0750000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATGTT 10 0.006830828 145.0 145 >>END_MODULE Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860968 spots for SRR7169131.sra Written 860968 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra Read 860958 spots for SRR7169131.sra Written 860958 spots for SRR7169131.sra SRR ids: ['SRR7169131.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hvfysdqu SRR7169131.sra spots: 17219170 blocks: [[1, 860958], [860959, 1721916], [1721917, 2582874], [2582875, 3443832], [3443833, 4304790], [4304791, 5165748], [5165749, 6026706], [6026707, 6887664], [6887665, 7748622], [7748623, 8609580], [8609581, 9470538], [9470539, 10331496], [10331497, 11192454], [11192455, 12053412], [12053413, 12914370], [12914371, 13775328], [13775329, 14636286], [14636287, 15497244], [15497245, 16358202], [16358203, 17219170]] SRR7169131 file size 5813311 SRR7169131 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169131 SRR7169131_1.fastq SRR7169131_2.fastq Input file: SRR7169131_1.fastq Paired file: SRR7169131_2.fastq trimmed: SRR7169131-trimmed-pair1.fastq, SRR7169131-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:08:49 2025 >> started Mon Feb 10 23:09:18 2025 >> done (29.302s) 17219170 read pairs processed; of these: 28017 ( 0.16%) short read pairs filtered out after trimming by size control 31353 ( 0.18%) empty read pairs filtered out after trimming by size control 17159800 (99.66%) read pairs available; of these: 7449502 (43.41%) trimmed read pairs available after processing 9710298 (56.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 5 0.00% 21 5 0.00% 22 6 0.00% 23 5 0.00% 24 7 0.00% 25 7 0.00% 26 6 0.00% 27 15 0.00% 28 4 0.00% 29 4 0.00% 30 11 0.00% 31 7 0.00% 32 10 0.00% 33 6 0.00% 34 9 0.00% 35 8 0.00% 36 7 0.00% 37 18 0.00% 38 9 0.00% 39 8 0.00% 40 12 0.00% 41 11 0.00% 42 15 0.00% 43 12 0.00% 44 11 0.00% 45 14 0.00% 46 19 0.00% 47 23 0.00% 48 20 0.00% 49 26 0.00% 50 27 0.00% 51 29 0.00% 52 30 0.00% 53 35 0.00% 54 23 0.00% 55 36 0.00% 56 45 0.00% 57 46 0.00% 58 49 0.00% 59 57 0.00% 60 60 0.00% 61 64 0.00% 62 80 0.00% 63 66 0.00% 64 102 0.00% 65 111 0.00% 66 126 0.00% 67 135 0.00% 68 139 0.00% 69 140 0.00% 70 173 0.00% 71 181 0.00% 72 203 0.00% 73 220 0.00% 74 249 0.00% 75 274 0.00% 76 334 0.00% 77 378 0.00% 78 412 0.00% 79 457 0.00% 80 530 0.00% 81 584 0.00% 82 676 0.00% 83 867 0.01% 84 2071 0.01% 85 2850 0.02% 86 2581 0.02% 87 2793 0.02% 88 2703 0.02% 89 2805 0.02% 90 2911 0.02% 91 2913 0.02% 92 2942 0.02% 93 3167 0.02% 94 3264 0.02% 95 3370 0.02% 96 3784 0.02% 97 3838 0.02% 98 4081 0.02% 99 4218 0.02% 100 4522 0.03% 101 4808 0.03% 102 5196 0.03% 103 5566 0.03% 104 5928 0.03% 105 6250 0.04% 106 6777 0.04% 107 6996 0.04% 108 7311 0.04% 109 7846 0.05% 110 8513 0.05% 111 8914 0.05% 112 9727 0.06% 113 10141 0.06% 114 10915 0.06% 115 11693 0.07% 116 12348 0.07% 117 13332 0.08% 118 13678 0.08% 119 14446 0.08% 120 15071 0.09% 121 16050 0.09% 122 17617 0.10% 123 18409 0.11% 124 19765 0.12% 125 21164 0.12% 126 22571 0.13% 127 23910 0.14% 128 25672 0.15% 129 27488 0.16% 130 29369 0.17% 131 32130 0.19% 132 34489 0.20% 133 37807 0.22% 134 40189 0.23% 135 44114 0.26% 136 48480 0.28% 137 52933 0.31% 138 57717 0.34% 139 64158 0.37% 140 71259 0.42% 141 80513 0.47% 142 92384 0.54% 143 107286 0.63% 144 128177 0.75% 145 157302 0.92% 146 204075 1.19% 147 281989 1.64% 148 438046 2.55% 149 859742 5.01% 150 4147162 24.17% 151 9710298 56.59% 17159800 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=41 prefix-density=0.16 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=40 fanout-score=197.06 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=17.9 sequence=TCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=36 prefix-density=0.27 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=57.61 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=14.4 sequence=TGTTGGTGGTGG SRR7169131 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:10:17 Started mapping on | Feb 10 23:10:18 Finished on | Feb 10 23:13:05 Mapping speed, Million of reads per hour | 369.91 Number of input reads | 17159800 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15897702 Uniquely mapped reads % | 92.65% Average mapped length | 297.11 Number of splices: Total | 15338680 Number of splices: Annotated (sjdb) | 15099211 Number of splices: GT/AG | 15114236 Number of splices: GC/AG | 181326 Number of splices: AT/AC | 11783 Number of splices: Non-canonical | 31335 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 290034 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 82059 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.11% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 996777 996777 996777 N_multimapping 290034 290034 290034 N_noFeature 382670 15738300 450690 N_ambiguous 161973 1143 69723 UnstrandedReadsAssigned:15353059 PositiveStrandReadsAssigned:158259 NegativeStrandReadsAssigned:15377289 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169131 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169131-trimmed-pair1.fastq SRR7169131-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,159,800 reads, 15,295,357 reads pseudoaligned [quant] estimated average fragment length: 278.133 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52401 SRR7169131.ke.tsv 34699 SRR7169131.se.tsv 87100 total ==> SRR7169131.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.87 272 9.8141 Potri.005G024800.1.v4.1 1035 757.867 44 3.64676 Potri.004G059700.1.v4.1 961 683.898 2 0.18369 Potri.007G009000.2.v4.1 1416 1138.87 0 0 Potri.003G141000.2.v4.1 2943 2665.87 285.059 6.7165 Potri.016G087400.1.v4.1 270 59.337 907.658 960.825 Potri.015G069301.1.v4.1 564 293.486 0 0 Potri.010G195200.1.v4.1 1773 1495.87 11 0.461899 Potri.012G127500.1.v4.1 977 699.89 6997 627.956 ==> SRR7169131.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1148 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169131 completed mapping pipeline successfully