Starting /dee2/code/volunteer_pipeline.sh SRR7169132 current disk space = 3057357664256 free memory = 1576501968 SRR7169132 SRAfilesize 67031cfe430756a34ad3ce327565a7b3 SRR7169132.sra SRR7169132.sra file validated SRR7169132 is paired end SRR7169132 is conventional basespace SRR7169132 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169132_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1955 34.0 33.0 34.0 33.0 34.0 2 33.5375 34.0 34.0 34.0 33.0 34.0 3 33.514 34.0 34.0 34.0 33.0 34.0 4 33.5495 34.0 34.0 34.0 33.0 34.0 5 33.541 34.0 34.0 34.0 33.0 34.0 6 37.1705 38.0 38.0 38.0 36.0 38.0 7 37.2835 38.0 38.0 38.0 37.0 38.0 8 37.395 38.0 38.0 38.0 37.0 38.0 9 37.4655 38.0 38.0 38.0 37.0 38.0 10-14 37.435900000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.3748 38.0 38.0 38.0 37.0 38.0 20-24 37.310900000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.27065 38.0 38.0 38.0 37.0 38.0 30-34 37.24135 38.0 38.0 38.0 36.8 38.0 35-39 37.1126 38.0 38.0 38.0 36.2 38.0 40-44 36.70795 38.0 38.0 38.0 34.6 38.0 45-49 36.5642 38.0 38.0 38.0 34.0 38.0 50-54 36.394450000000006 38.0 37.6 38.0 34.0 38.0 55-59 36.21685 38.0 37.0 38.0 33.2 38.0 60-64 36.198899999999995 38.0 37.0 38.0 33.0 38.0 65-69 36.102850000000004 38.0 37.0 38.0 33.0 38.0 70-74 36.052800000000005 38.0 37.0 38.0 33.0 38.0 75-79 35.903650000000006 38.0 37.0 38.0 31.4 38.0 80-84 35.7099 38.0 36.8 38.0 30.6 38.0 85-89 35.56285 38.0 36.2 38.0 30.2 38.0 90-94 35.27685 38.0 36.0 38.0 29.0 38.0 95-99 35.1165 38.0 36.0 38.0 28.6 38.0 100-104 34.82245 38.0 35.4 38.0 27.0 38.0 105-109 34.6728 38.0 35.2 38.0 26.2 38.0 110-114 34.346050000000005 38.0 35.0 38.0 24.4 38.0 115-119 34.1048 38.0 34.4 38.0 23.0 38.0 120-124 33.713649999999994 38.0 34.0 38.0 19.0 38.0 125-129 33.4486 38.0 34.0 38.0 16.2 38.0 130-134 32.96855000000001 38.0 33.4 38.0 15.0 38.0 135-139 32.279999999999994 37.2 32.2 38.0 14.6 38.0 140-144 31.64145 36.0 31.0 38.0 14.0 38.0 145-149 30.762400000000003 36.0 31.0 38.0 8.8 38.0 150-151 26.43275 34.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 2.0 10 0.0 11 3.0 12 1.0 13 2.0 14 4.0 15 2.0 16 5.0 17 9.0 18 11.0 19 15.0 20 6.0 21 10.0 22 18.0 23 17.0 24 24.0 25 28.0 26 33.0 27 46.0 28 53.0 29 47.0 30 61.0 31 85.0 32 121.0 33 147.0 34 251.0 35 504.0 36 1111.0 37 1381.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.59580913910629 14.592274678111588 11.08305983337541 33.72885634940672 2 23.225 15.75 30.425 30.599999999999998 3 19.275000000000002 22.975 26.950000000000003 30.8 4 21.65 29.275000000000002 24.474999999999998 24.6 5 21.775 33.074999999999996 24.075 21.075 6 19.575 35.199999999999996 25.575 19.650000000000002 7 14.625 27.950000000000003 38.675 18.75 8 18.5 27.875 28.175 25.45 9 16.6 28.575 32.475 22.35 10-14 18.685 30.985000000000003 27.22 23.11 15-19 18.89 30.709999999999997 27.045 23.355 20-24 19.215 29.815 27.689999999999998 23.28 25-29 19.175 30.625000000000004 26.805 23.395 30-34 19.02 29.87 27.37 23.74 35-39 18.985 30.14 26.795 24.08 40-44 19.625 30.025000000000002 26.99 23.36 45-49 19.1 29.635 27.51 23.755000000000003 50-54 19.939999999999998 29.770000000000003 26.97 23.32 55-59 19.535 29.345 27.139999999999997 23.98 60-64 19.42 29.299999999999997 26.915 24.365000000000002 65-69 19.555 29.549999999999997 26.945000000000004 23.95 70-74 19.675 29.505 26.97 23.849999999999998 75-79 19.725 29.87 26.695 23.71 80-84 19.814999999999998 29.21 27.26 23.715 85-89 19.755 28.999999999999996 27.115000000000002 24.13 90-94 20.119999999999997 29.29 27.005000000000003 23.585 95-99 20.125 28.470000000000002 27.295 24.11 100-104 20.150000000000002 28.725 27.245 23.880000000000003 105-109 20.24 28.494999999999997 26.85 24.415 110-114 19.74 28.785 27.76 23.715 115-119 20.064999999999998 28.499999999999996 27.01 24.425 120-124 19.88 28.925 27.305 23.89 125-129 20.330000000000002 28.345 27.584999999999997 23.74 130-134 20.51 28.24 27.275 23.974999999999998 135-139 20.580000000000002 28.005000000000003 27.229999999999997 24.185000000000002 140-144 20.13 28.625 27.51 23.735 145-149 20.244999999999997 28.355000000000004 27.16 24.240000000000002 150-151 20.7875 27.737499999999997 26.937499999999996 24.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.5 18 1.5 19 1.5 20 1.5 21 2.5 22 2.5 23 3.0 24 7.0 25 8.5 26 8.0 27 10.5 28 15.0 29 19.5 30 26.5 31 47.0 32 55.5 33 61.5 34 83.0 35 92.0 36 111.0 37 131.0 38 141.0 39 161.0 40 187.5 41 207.5 42 216.0 43 219.0 44 229.5 45 240.5 46 242.5 47 238.0 48 205.5 49 174.0 50 152.0 51 136.5 52 130.5 53 110.5 54 80.5 55 55.0 56 45.0 57 35.0 58 22.0 59 17.0 60 14.5 61 11.5 62 7.5 63 6.0 64 5.0 65 2.5 66 2.5 67 2.5 68 3.0 69 3.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.42500000000000004 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.6 0.0 0.0 0.0 0.0 126-127 0.725 0.0 0.0 0.0 0.0 128-129 0.7875 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 0.9875 0.0 0.0 0.0 0.0 134-135 1.0875 0.0 0.0 0.0 0.0 136-137 1.25 0.0 0.0 0.0 0.0 138-139 1.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGGTA 10 0.0068343505 144.975 7 CTGGTAT 10 0.0068343505 144.975 8 >>END_MODULE SRR7169132 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169132_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.776 33.0 33.0 34.0 32.0 34.0 2 32.845 34.0 33.0 34.0 32.0 34.0 3 32.82775 34.0 33.0 34.0 32.0 34.0 4 32.7675 34.0 33.0 34.0 32.0 34.0 5 32.77975 34.0 33.0 34.0 32.0 34.0 6 36.9155 38.0 38.0 38.0 37.0 38.0 7 36.85675 38.0 38.0 38.0 36.0 38.0 8 36.962 38.0 38.0 38.0 37.0 38.0 9 36.916 38.0 38.0 38.0 37.0 38.0 10-14 36.84685 38.0 38.0 38.0 36.2 38.0 15-19 36.868700000000004 38.0 38.0 38.0 37.0 38.0 20-24 36.82495 38.0 38.0 38.0 36.4 38.0 25-29 36.80335 38.0 38.0 38.0 36.0 38.0 30-34 36.78165 38.0 38.0 38.0 36.0 38.0 35-39 36.74884999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.66760000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.6819 38.0 38.0 38.0 36.0 38.0 50-54 36.6403 38.0 38.0 38.0 36.0 38.0 55-59 36.56320000000001 38.0 38.0 38.0 35.8 38.0 60-64 36.530100000000004 38.0 38.0 38.0 35.8 38.0 65-69 36.43125 38.0 38.0 38.0 35.0 38.0 70-74 36.422450000000005 38.0 38.0 38.0 35.2 38.0 75-79 36.3198 38.0 38.0 38.0 34.6 38.0 80-84 36.254 38.0 38.0 38.0 34.2 38.0 85-89 36.284549999999996 38.0 38.0 38.0 34.4 38.0 90-94 36.174499999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.08965 38.0 38.0 38.0 34.0 38.0 100-104 35.88055000000001 38.0 38.0 38.0 33.0 38.0 105-109 35.7981 38.0 38.0 38.0 33.0 38.0 110-114 35.58995 38.0 37.6 38.0 31.4 38.0 115-119 35.3374 38.0 37.0 38.0 31.0 38.0 120-124 35.15075 38.0 37.0 38.0 28.8 38.0 125-129 34.882549999999995 38.0 36.2 38.0 28.4 38.0 130-134 34.639300000000006 38.0 36.0 38.0 27.0 38.0 135-139 34.26685 38.0 35.8 38.0 24.6 38.0 140-144 33.66475 38.0 35.0 38.0 19.8 38.0 145-149 33.005 38.0 35.0 38.0 11.4 38.0 150-151 29.756749999999997 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 10.0 4 3.0 5 1.0 6 2.0 7 3.0 8 2.0 9 5.0 10 5.0 11 4.0 12 3.0 13 2.0 14 4.0 15 3.0 16 4.0 17 6.0 18 6.0 19 8.0 20 9.0 21 12.0 22 14.0 23 10.0 24 17.0 25 32.0 26 19.0 27 25.0 28 30.0 29 35.0 30 54.0 31 52.0 32 64.0 33 74.0 34 110.0 35 182.0 36 493.0 37 2680.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.05 22.475 13.775 22.7 2 28.050000000000004 27.175 27.775 17.0 3 21.475 28.525 30.5 19.5 4 24.625 34.9 22.125 18.35 5 25.074999999999996 35.675000000000004 21.975 17.275 6 22.35 37.574999999999996 22.1 17.974999999999998 7 21.925 22.325 35.925000000000004 19.825 8 23.775 26.525 25.374999999999996 24.325 9 23.1 26.200000000000003 28.599999999999998 22.1 10-14 24.62 28.860000000000003 25.465 21.055 15-19 23.955000000000002 26.795 27.725 21.525 20-24 24.005000000000003 28.42 26.450000000000003 21.125 25-29 24.215 28.549999999999997 26.97 20.265 30-34 24.224999999999998 27.625 27.235 20.915 35-39 24.375 27.755000000000003 27.095000000000002 20.775 40-44 24.25 28.694999999999997 26.575 20.48 45-49 23.835 28.42 26.590000000000003 21.154999999999998 50-54 24.08 27.794999999999998 27.755000000000003 20.369999999999997 55-59 24.2 27.32 27.279999999999998 21.2 60-64 24.505 27.700000000000003 27.544999999999998 20.25 65-69 24.295651303608068 27.803633088124908 27.153080118100387 20.74763549016664 70-74 24.504504504504503 27.95795795795796 26.976976976976978 20.56056056056056 75-79 24.480912593185572 27.55290939110422 26.872467103617353 21.09371091209286 80-84 24.240000000000002 27.689999999999998 27.750000000000004 20.32 85-89 24.51 27.700000000000003 27.439999999999998 20.349999999999998 90-94 24.645 27.560000000000002 27.825 19.97 95-99 24.025 28.144999999999996 27.43 20.4 100-104 24.07 27.750000000000004 27.655 20.525 105-109 24.099999999999998 27.21 27.97 20.72 110-114 24.310000000000002 27.115000000000002 27.955000000000002 20.62 115-119 24.89 27.185 27.615000000000002 20.31 120-124 24.075 27.76 27.915 20.25 125-129 25.069999999999997 27.529999999999998 27.68 19.72 130-134 23.985 27.694999999999997 28.07 20.25 135-139 24.562281140570285 27.348674337168582 28.14407203601801 19.94497248624312 140-144 24.449008214786616 27.59967942296133 27.59967942296133 20.351632939290724 145-149 24.903348897926396 27.017121052367326 27.78028819601346 20.299241853692827 150-151 24.33862433862434 27.32426303854875 27.62660619803477 20.71050642479214 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 0.5 25 1.5 26 2.0 27 4.5 28 7.0 29 6.0 30 8.5 31 13.0 32 15.0 33 22.0 34 32.0 35 47.0 36 67.5 37 75.0 38 106.5 39 142.0 40 158.0 41 202.0 42 245.0 43 280.5 44 286.0 45 281.0 46 305.0 47 284.5 48 249.5 49 220.0 50 184.0 51 162.5 52 132.0 53 106.0 54 93.0 55 69.0 56 46.5 57 37.0 58 24.5 59 14.5 60 14.0 61 13.0 62 9.0 63 6.0 64 4.0 65 4.5 66 3.0 67 1.5 68 1.5 69 2.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.08499999999999999 70-74 0.1 75-79 0.065 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.05 140-144 0.18 145-149 0.415 150-151 0.775 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.7625 0.0 0.0 0.0 0.0 130-131 0.85 0.0 0.0 0.0 0.0 132-133 0.95 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.2 0.0 0.0 0.0 0.0 138-139 1.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640003 spots for SRR7169132.sra Written 640003 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra Read 640001 spots for SRR7169132.sra Written 640001 spots for SRR7169132.sra SRR ids: ['SRR7169132.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vh_r_jc9 SRR7169132.sra spots: 12800022 blocks: [[1, 640001], [640002, 1280002], [1280003, 1920003], [1920004, 2560004], [2560005, 3200005], [3200006, 3840006], [3840007, 4480007], [4480008, 5120008], [5120009, 5760009], [5760010, 6400010], [6400011, 7040011], [7040012, 7680012], [7680013, 8320013], [8320014, 8960014], [8960015, 9600015], [9600016, 10240016], [10240017, 10880017], [10880018, 11520018], [11520019, 12160019], [12160020, 12800022]] SRR7169132 file size 4315807 SRR7169132 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169132 SRR7169132_1.fastq SRR7169132_2.fastq Input file: SRR7169132_1.fastq Paired file: SRR7169132_2.fastq trimmed: SRR7169132-trimmed-pair1.fastq, SRR7169132-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:25:07 2025 >> started Tue Feb 11 00:25:22 2025 >> done (14.368s) 12800022 read pairs processed; of these: 27073 ( 0.21%) short read pairs filtered out after trimming by size control 19905 ( 0.16%) empty read pairs filtered out after trimming by size control 12753044 (99.63%) read pairs available; of these: 6941531 (54.43%) trimmed read pairs available after processing 5811513 (45.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 10 0.00% 21 4 0.00% 22 4 0.00% 23 3 0.00% 24 9 0.00% 25 9 0.00% 26 9 0.00% 27 9 0.00% 28 5 0.00% 29 10 0.00% 30 11 0.00% 31 7 0.00% 32 12 0.00% 33 8 0.00% 34 11 0.00% 35 10 0.00% 36 11 0.00% 37 18 0.00% 38 17 0.00% 39 9 0.00% 40 24 0.00% 41 16 0.00% 42 28 0.00% 43 32 0.00% 44 26 0.00% 45 22 0.00% 46 26 0.00% 47 34 0.00% 48 46 0.00% 49 39 0.00% 50 45 0.00% 51 60 0.00% 52 49 0.00% 53 48 0.00% 54 61 0.00% 55 68 0.00% 56 62 0.00% 57 70 0.00% 58 93 0.00% 59 101 0.00% 60 127 0.00% 61 101 0.00% 62 131 0.00% 63 129 0.00% 64 161 0.00% 65 137 0.00% 66 185 0.00% 67 202 0.00% 68 216 0.00% 69 285 0.00% 70 277 0.00% 71 316 0.00% 72 330 0.00% 73 385 0.00% 74 395 0.00% 75 471 0.00% 76 504 0.00% 77 556 0.00% 78 560 0.00% 79 630 0.00% 80 761 0.01% 81 847 0.01% 82 953 0.01% 83 1201 0.01% 84 2195 0.02% 85 2829 0.02% 86 2803 0.02% 87 2850 0.02% 88 2880 0.02% 89 3011 0.02% 90 3118 0.02% 91 3222 0.03% 92 3414 0.03% 93 3617 0.03% 94 3783 0.03% 95 4000 0.03% 96 4411 0.03% 97 4672 0.04% 98 4873 0.04% 99 5257 0.04% 100 5536 0.04% 101 5842 0.05% 102 6133 0.05% 103 6247 0.05% 104 6889 0.05% 105 7582 0.06% 106 8148 0.06% 107 8577 0.07% 108 8861 0.07% 109 9526 0.07% 110 9962 0.08% 111 10646 0.08% 112 11106 0.09% 113 11898 0.09% 114 12586 0.10% 115 13536 0.11% 116 14378 0.11% 117 14635 0.11% 118 15644 0.12% 119 16335 0.13% 120 17278 0.14% 121 18454 0.14% 122 19590 0.15% 123 21007 0.16% 124 22701 0.18% 125 24183 0.19% 126 26174 0.21% 127 27272 0.21% 128 29075 0.23% 129 31167 0.24% 130 33624 0.26% 131 36056 0.28% 132 38989 0.31% 133 42731 0.34% 134 45844 0.36% 135 50008 0.39% 136 55617 0.44% 137 61080 0.48% 138 67736 0.53% 139 75800 0.59% 140 83141 0.65% 141 93435 0.73% 142 107654 0.84% 143 123183 0.97% 144 147774 1.16% 145 180230 1.41% 146 230286 1.81% 147 320783 2.52% 148 490046 3.84% 149 911000 7.14% 150 3237606 25.39% 151 5811513 45.57% 12753044 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=37 prefix-density=0.39 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=39.08 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.6 sequence=CATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACG criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=6.46 fanout-score-rank=17 prefix-density=0.35 prefix-fanout=4.5 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGC criterion=fanout-score sequence-density=0.14 sequence-density-rank=20 fanout-score=40.35 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=11.0 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCGCACAATCCAGTT SRR7169132 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:26:15 Started mapping on | Feb 11 00:26:15 Finished on | Feb 11 00:27:45 Mapping speed, Million of reads per hour | 510.12 Number of input reads | 12753044 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 11695733 Uniquely mapped reads % | 91.71% Average mapped length | 294.96 Number of splices: Total | 9778242 Number of splices: Annotated (sjdb) | 9607446 Number of splices: GT/AG | 9641781 Number of splices: GC/AG | 105479 Number of splices: AT/AC | 7710 Number of splices: Non-canonical | 23272 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.46 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 218691 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 54825 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.06% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 861860 861860 861860 N_multimapping 218691 218691 218691 N_noFeature 232469 11505391 291742 N_ambiguous 183872 776 52292 UnstrandedReadsAssigned:11279392 PositiveStrandReadsAssigned:189566 NegativeStrandReadsAssigned:11351699 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169132 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169132-trimmed-pair1.fastq SRR7169132-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,753,044 reads, 11,357,258 reads pseudoaligned [quant] estimated average fragment length: 260.894 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR7169132.ke.tsv 34699 SRR7169132.se.tsv 87100 total ==> SRR7169132.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.11 175 7.06349 Potri.005G024800.1.v4.1 1035 775.106 19 1.73948 Potri.004G059700.1.v4.1 961 701.106 1 0.101214 Potri.007G009000.2.v4.1 1416 1156.11 0 0 Potri.003G141000.2.v4.1 2943 2683.11 229 6.05653 Potri.016G087400.1.v4.1 270 62.6315 971 1100.15 Potri.015G069301.1.v4.1 564 307.784 0 0 Potri.010G195200.1.v4.1 1773 1513.11 7 0.328288 Potri.012G127500.1.v4.1 977 717.106 2161 213.844 ==> SRR7169132.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 932 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 198 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169132 completed mapping pipeline successfully