Starting /dee2/code/volunteer_pipeline.sh SRR7169133 current disk space = 3057683939328 free memory = 1428140840 SRR7169133 SRAfilesize 607e2fdc990d6fd676b74448dd3dc21c SRR7169133.sra SRR7169133.sra file validated SRR7169133 is paired end SRR7169133 is conventional basespace SRR7169133 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169133_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1585 34.0 33.0 34.0 33.0 34.0 2 33.497 34.0 34.0 34.0 33.0 34.0 3 33.48225 34.0 34.0 34.0 33.0 34.0 4 33.5175 34.0 34.0 34.0 33.0 34.0 5 33.5335 34.0 34.0 34.0 33.0 34.0 6 37.15225 38.0 38.0 38.0 36.0 38.0 7 37.3705 38.0 38.0 38.0 37.0 38.0 8 37.48425 38.0 38.0 38.0 37.0 38.0 9 37.54625 38.0 38.0 38.0 37.0 38.0 10-14 37.47515 38.0 38.0 38.0 37.4 38.0 15-19 37.40895 38.0 38.0 38.0 37.0 38.0 20-24 37.32345 38.0 38.0 38.0 37.0 38.0 25-29 37.3312 38.0 38.0 38.0 37.0 38.0 30-34 37.2913 38.0 38.0 38.0 37.0 38.0 35-39 37.21945000000001 38.0 38.0 38.0 36.8 38.0 40-44 36.8639 38.0 38.0 38.0 35.0 38.0 45-49 36.7054 38.0 38.0 38.0 34.4 38.0 50-54 36.5554 38.0 38.0 38.0 34.0 38.0 55-59 36.47265 38.0 38.0 38.0 34.0 38.0 60-64 36.43745 38.0 37.8 38.0 33.8 38.0 65-69 36.3835 38.0 37.2 38.0 33.8 38.0 70-74 36.359249999999996 38.0 37.6 38.0 34.0 38.0 75-79 36.141149999999996 38.0 37.0 38.0 33.0 38.0 80-84 36.1108 38.0 37.0 38.0 33.2 38.0 85-89 35.9 38.0 37.0 38.0 32.0 38.0 90-94 35.66199999999999 38.0 36.8 38.0 30.6 38.0 95-99 35.454499999999996 38.0 36.0 38.0 29.4 38.0 100-104 35.1722 38.0 36.0 38.0 28.8 38.0 105-109 35.06515 38.0 35.8 38.0 28.4 38.0 110-114 34.835800000000006 38.0 35.4 38.0 27.4 38.0 115-119 34.503750000000004 38.0 35.0 38.0 26.2 38.0 120-124 34.2423 38.0 34.8 38.0 23.8 38.0 125-129 33.921299999999995 38.0 34.2 38.0 22.2 38.0 130-134 33.482299999999995 38.0 34.0 38.0 18.6 38.0 135-139 32.89305 38.0 33.4 38.0 16.0 38.0 140-144 32.143550000000005 36.8 32.8 38.0 14.0 38.0 145-149 31.422200000000004 36.2 32.4 38.0 9.2 38.0 150-151 27.02225 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 2.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 3.0 13 3.0 14 2.0 15 5.0 16 2.0 17 5.0 18 5.0 19 7.0 20 10.0 21 9.0 22 15.0 23 19.0 24 24.0 25 16.0 26 24.0 27 44.0 28 42.0 29 53.0 30 54.0 31 84.0 32 106.0 33 148.0 34 237.0 35 424.0 36 967.0 37 1687.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.7155128852956 13.996968165740272 8.792319353208692 30.495199595755434 2 24.2 14.325 31.65 29.825000000000003 3 20.0 20.65 25.6 33.75 4 22.15 26.1 24.975 26.775 5 22.425 32.800000000000004 23.825 20.95 6 19.900000000000002 35.55 23.575 20.974999999999998 7 15.174999999999999 28.025 37.724999999999994 19.075 8 17.349999999999998 27.35 30.425 24.875 9 17.349999999999998 25.900000000000002 32.225 24.525 10-14 20.349999999999998 29.854999999999997 26.590000000000003 23.205000000000002 15-19 19.77 28.965000000000003 27.515 23.75 20-24 19.845 28.660000000000004 27.33 24.165 25-29 19.505 29.945 26.700000000000003 23.849999999999998 30-34 20.315 28.849999999999998 26.974999999999998 23.86 35-39 19.744999999999997 29.34 27.195000000000004 23.72 40-44 20.02 29.25 27.029999999999998 23.7 45-49 19.994999999999997 29.015 26.674999999999997 24.315 50-54 20.165 28.725 27.425 23.685000000000002 55-59 20.505000000000003 28.125 27.735 23.635 60-64 19.99 28.43 26.99 24.59 65-69 20.54 28.375 27.315 23.77 70-74 19.96 28.310000000000002 27.805000000000003 23.925 75-79 19.74 28.525 27.3 24.435000000000002 80-84 19.994999999999997 29.035 26.8 24.169999999999998 85-89 20.715 28.689999999999998 27.265 23.330000000000002 90-94 20.005 28.470000000000002 28.16 23.365 95-99 20.645 28.105000000000004 27.24 24.01 100-104 20.990000000000002 27.845 27.685 23.48 105-109 20.645 28.910000000000004 26.96 23.485 110-114 20.71 28.23 27.500000000000004 23.56 115-119 20.62 28.16 26.93 24.29 120-124 20.13 28.335 27.474999999999998 24.060000000000002 125-129 20.880000000000003 27.955000000000002 27.11 24.055 130-134 20.845 28.37 27.33 23.455000000000002 135-139 20.75 28.275 27.134999999999998 23.84 140-144 20.345 27.965 27.55 24.14 145-149 20.735 27.925 27.615000000000002 23.724999999999998 150-151 21.1875 27.737499999999997 27.287499999999998 23.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.0 21 1.0 22 2.5 23 2.5 24 2.0 25 2.5 26 2.5 27 4.5 28 8.5 29 11.0 30 13.5 31 20.5 32 31.0 33 45.5 34 52.0 35 61.5 36 81.5 37 103.0 38 126.5 39 160.0 40 185.5 41 197.5 42 221.0 43 258.0 44 275.0 45 266.0 46 259.5 47 251.5 48 242.5 49 231.0 50 197.5 51 154.0 52 127.0 53 103.0 54 81.5 55 58.5 56 40.5 57 33.5 58 24.5 59 16.5 60 9.0 61 6.5 62 7.0 63 3.5 64 1.0 65 1.5 66 3.0 67 2.5 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.20060180541624875 0.4 3 0.05015045135406219 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.2375 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5375000000000001 0.0 0.0 0.0 0.0 126-127 0.5874999999999999 0.0 0.0 0.0 0.0 128-129 0.6125 0.0 0.0 0.0 0.0 130-131 0.6625000000000001 0.0 0.0 0.0 0.0 132-133 0.725 0.0 0.0 0.0 0.0 134-135 0.8125 0.0 0.0 0.0 0.0 136-137 0.9 0.0 0.0 0.0 0.0 138-139 0.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTCCTG 10 0.006830828 145.0 5 >>END_MODULE SRR7169133 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169133_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.774 33.0 33.0 34.0 32.0 34.0 2 32.84175 34.0 33.0 34.0 32.0 34.0 3 32.843 34.0 33.0 34.0 32.0 34.0 4 32.74975 34.0 33.0 34.0 32.0 34.0 5 32.7755 34.0 33.0 34.0 32.0 34.0 6 36.8825 38.0 38.0 38.0 37.0 38.0 7 36.857 38.0 38.0 38.0 36.0 38.0 8 36.911 38.0 38.0 38.0 37.0 38.0 9 36.9795 38.0 38.0 38.0 37.0 38.0 10-14 36.8566 38.0 38.0 38.0 37.0 38.0 15-19 36.830799999999996 38.0 38.0 38.0 37.0 38.0 20-24 36.7599 38.0 38.0 38.0 36.4 38.0 25-29 36.80865 38.0 38.0 38.0 37.0 38.0 30-34 36.75945 38.0 38.0 38.0 36.4 38.0 35-39 36.717400000000005 38.0 38.0 38.0 36.2 38.0 40-44 36.6749 38.0 38.0 38.0 36.0 38.0 45-49 36.683550000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.63165 38.0 38.0 38.0 36.0 38.0 55-59 36.60765 38.0 38.0 38.0 36.0 38.0 60-64 36.53575 38.0 38.0 38.0 35.6 38.0 65-69 36.496050000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.43705 38.0 38.0 38.0 35.4 38.0 75-79 36.29585 38.0 38.0 38.0 35.0 38.0 80-84 36.330149999999996 38.0 38.0 38.0 34.8 38.0 85-89 36.24975 38.0 38.0 38.0 34.6 38.0 90-94 36.1793 38.0 38.0 38.0 34.0 38.0 95-99 36.0932 38.0 38.0 38.0 34.0 38.0 100-104 35.8556 38.0 38.0 38.0 33.4 38.0 105-109 35.73905 38.0 38.0 38.0 33.0 38.0 110-114 35.6377 38.0 38.0 38.0 32.4 38.0 115-119 35.476200000000006 38.0 37.4 38.0 31.8 38.0 120-124 35.2029 38.0 37.0 38.0 29.4 38.0 125-129 35.0598 38.0 36.8 38.0 29.4 38.0 130-134 34.8803 38.0 36.2 38.0 28.0 38.0 135-139 34.513999999999996 38.0 35.8 38.0 26.2 38.0 140-144 33.94085 38.0 35.0 38.0 22.2 38.0 145-149 33.25320000000001 38.0 35.0 38.0 15.6 38.0 150-151 30.0905 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 8.0 4 7.0 5 2.0 6 4.0 7 4.0 8 2.0 9 6.0 10 2.0 11 4.0 12 2.0 13 5.0 14 3.0 15 5.0 16 6.0 17 6.0 18 6.0 19 6.0 20 7.0 21 8.0 22 10.0 23 6.0 24 12.0 25 21.0 26 18.0 27 24.0 28 27.0 29 33.0 30 49.0 31 61.0 32 63.0 33 64.0 34 138.0 35 176.0 36 447.0 37 2736.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.625 23.95 13.450000000000001 21.975 2 27.025 26.775 28.349999999999998 17.849999999999998 3 21.75 27.474999999999998 31.775 19.0 4 23.575 32.95 24.45 19.025 5 25.224999999999998 35.775 22.025 16.975 6 21.3 37.5 22.900000000000002 18.3 7 21.25 23.125 36.675000000000004 18.95 8 21.95 26.0 26.5 25.55 9 22.15 25.2 29.175 23.474999999999998 10-14 23.74 28.825 26.58 20.855 15-19 23.75 27.185 28.09 20.974999999999998 20-24 23.72 28.225 27.139999999999997 20.915 25-29 23.74 27.825 27.29 21.145 30-34 23.135 28.32 27.560000000000002 20.985 35-39 23.505000000000003 28.16 27.395000000000003 20.94 40-44 23.365 28.265 27.589999999999996 20.78 45-49 23.45 28.095 27.91 20.544999999999998 50-54 23.845 27.955000000000002 27.375 20.825 55-59 23.255 28.355000000000004 27.36 21.029999999999998 60-64 23.65 28.050000000000004 27.67 20.630000000000003 65-69 23.71557336004006 27.811717576364547 27.546319479218827 20.926389584376565 70-74 23.454563670974853 28.19857729686404 27.296864041679193 21.049994990481917 75-79 24.061655489940946 27.850065058552698 27.860074066659994 20.228205384846362 80-84 23.799999999999997 27.595 27.575 21.029999999999998 85-89 24.11 27.785 27.82 20.285 90-94 23.599999999999998 27.63 27.884999999999998 20.885 95-99 23.91 27.065 28.405 20.62 100-104 24.22 27.54 27.525 20.715 105-109 24.195 27.755000000000003 27.105 20.945 110-114 24.36 27.57 27.85 20.22 115-119 23.72 27.900000000000002 27.339999999999996 21.04 120-124 24.310000000000002 27.565 27.455000000000002 20.669999999999998 125-129 24.355 27.245 27.46 20.94 130-134 23.745 27.765 27.55 20.94 135-139 23.831682177524264 27.58931251876313 27.84449114380066 20.73451415991194 140-144 24.31917347911129 27.975324740458397 27.42865740508551 20.2768443753448 145-149 24.425099381069792 27.58516580284808 27.650581190560057 20.339153625522066 150-151 24.117498739283914 26.462430660615226 28.504790721129602 20.915279878971255 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 2.0 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 1.5 25 2.5 26 4.5 27 5.0 28 3.0 29 3.5 30 5.5 31 10.5 32 21.5 33 28.5 34 35.0 35 49.0 36 72.0 37 94.0 38 124.5 39 153.0 40 186.0 41 220.5 42 248.5 43 285.5 44 312.5 45 306.5 46 278.0 47 262.5 48 259.0 49 216.5 50 174.0 51 137.5 52 106.5 53 103.0 54 78.5 55 58.5 56 44.0 57 29.0 58 19.0 59 15.0 60 15.5 61 9.0 62 4.0 63 5.0 64 3.5 65 1.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.15 70-74 0.19 75-79 0.09 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.06999999999999999 140-144 0.305 145-149 0.635 150-151 0.8500000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.5625 0.0 0.0 0.0 0.0 128-129 0.6 0.0 0.0 0.0 0.0 130-131 0.6625000000000001 0.0 0.0 0.0 0.0 132-133 0.725 0.0 0.0 0.0 0.0 134-135 0.8125 0.0 0.0 0.0 0.0 136-137 0.9125000000000001 0.0 0.0 0.0 0.0 138-139 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATAT 10 0.006830828 145.0 1 >>END_MODULE Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703392 spots for SRR7169133.sra Written 703392 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra Read 703390 spots for SRR7169133.sra Written 703390 spots for SRR7169133.sra SRR ids: ['SRR7169133.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nonzki_3 SRR7169133.sra spots: 14067802 blocks: [[1, 703390], [703391, 1406780], [1406781, 2110170], [2110171, 2813560], [2813561, 3516950], [3516951, 4220340], [4220341, 4923730], [4923731, 5627120], [5627121, 6330510], [6330511, 7033900], [7033901, 7737290], [7737291, 8440680], [8440681, 9144070], [9144071, 9847460], [9847461, 10550850], [10550851, 11254240], [11254241, 11957630], [11957631, 12661020], [12661021, 13364410], [13364411, 14067802]] SRR7169133 file size 4745416 SRR7169133 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169133 SRR7169133_1.fastq SRR7169133_2.fastq Input file: SRR7169133_1.fastq Paired file: SRR7169133_2.fastq trimmed: SRR7169133-trimmed-pair1.fastq, SRR7169133-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:21:33 2025 >> started Mon Feb 10 23:21:48 2025 >> done (15.337s) 14067802 read pairs processed; of these: 31091 ( 0.22%) short read pairs filtered out after trimming by size control 22805 ( 0.16%) empty read pairs filtered out after trimming by size control 14013906 (99.62%) read pairs available; of these: 7144996 (50.99%) trimmed read pairs available after processing 6868910 (49.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 14 0.00% 21 8 0.00% 22 7 0.00% 23 3 0.00% 24 12 0.00% 25 12 0.00% 26 10 0.00% 27 18 0.00% 28 10 0.00% 29 8 0.00% 30 20 0.00% 31 8 0.00% 32 7 0.00% 33 13 0.00% 34 18 0.00% 35 22 0.00% 36 16 0.00% 37 26 0.00% 38 21 0.00% 39 18 0.00% 40 22 0.00% 41 20 0.00% 42 31 0.00% 43 23 0.00% 44 41 0.00% 45 39 0.00% 46 36 0.00% 47 38 0.00% 48 47 0.00% 49 39 0.00% 50 38 0.00% 51 59 0.00% 52 60 0.00% 53 60 0.00% 54 62 0.00% 55 73 0.00% 56 88 0.00% 57 86 0.00% 58 89 0.00% 59 89 0.00% 60 103 0.00% 61 114 0.00% 62 130 0.00% 63 155 0.00% 64 154 0.00% 65 182 0.00% 66 216 0.00% 67 236 0.00% 68 276 0.00% 69 362 0.00% 70 407 0.00% 71 380 0.00% 72 388 0.00% 73 429 0.00% 74 500 0.00% 75 506 0.00% 76 553 0.00% 77 572 0.00% 78 679 0.00% 79 780 0.01% 80 865 0.01% 81 965 0.01% 82 1050 0.01% 83 1325 0.01% 84 2469 0.02% 85 3151 0.02% 86 3112 0.02% 87 3128 0.02% 88 3245 0.02% 89 3223 0.02% 90 3423 0.02% 91 3411 0.02% 92 3642 0.03% 93 3701 0.03% 94 3789 0.03% 95 4163 0.03% 96 4358 0.03% 97 4544 0.03% 98 4718 0.03% 99 5013 0.04% 100 5271 0.04% 101 5675 0.04% 102 5869 0.04% 103 6242 0.04% 104 6462 0.05% 105 6992 0.05% 106 7520 0.05% 107 7922 0.06% 108 8391 0.06% 109 8726 0.06% 110 9506 0.07% 111 9732 0.07% 112 10343 0.07% 113 10882 0.08% 114 11642 0.08% 115 12239 0.09% 116 13116 0.09% 117 13697 0.10% 118 14393 0.10% 119 15087 0.11% 120 16277 0.12% 121 17309 0.12% 122 18410 0.13% 123 19845 0.14% 124 20958 0.15% 125 22195 0.16% 126 23881 0.17% 127 25870 0.18% 128 27543 0.20% 129 29513 0.21% 130 31632 0.23% 131 34148 0.24% 132 36927 0.26% 133 40570 0.29% 134 43440 0.31% 135 47843 0.34% 136 52527 0.37% 137 58636 0.42% 138 65456 0.47% 139 73290 0.52% 140 81091 0.58% 141 90831 0.65% 142 103570 0.74% 143 119034 0.85% 144 141826 1.01% 145 174334 1.24% 146 222125 1.59% 147 311097 2.22% 148 480448 3.43% 149 912926 6.51% 150 3540002 25.26% 151 6868910 49.01% 14013906 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=41 prefix-density=0.19 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=243.94 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=14.4 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=41 prefix-density=0.24 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.04 sequence-density-rank=44 fanout-score=85.93 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=9.0 sequence=ATGTTGCTGCTGAAATTGCTAAGGAGTTGCAGGGAAAGCCTGATCTGATCATTGGAAATTACAGTGATGGAAACGTTGTTGCCTCCTTGCTAGCACACAAATTAGGTGTTACAGAGTGCACTATTGCACATGCTCTAGAAAAAACAAAGTACCCAGATTCAGATATTTACTGGAAGAAGTTTGATGAAAAGTACCACTTTTCATGCCAGTTTACAGCTGATCTTTTTGCCATGAACCATACAGATTTCATCATCACCAGCACATTCCAAGAGATTGCTGGAAGCAAGGATACTGTTGGACAGTACGAGAGCCACACTGCTTTCACTCTCCCTGGCCTCTACAGAGTTGTTCATGGTATCGATGTATTTGATCCCAAATTCAACATTGTATCCCCTGGTGCTGACGAGAGCATATACTTCCCTTACACTGAGAAGAAACTTAGGTTGACTTCTT SRR7169133 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:22:35 Started mapping on | Feb 10 23:22:35 Finished on | Feb 10 23:24:06 Mapping speed, Million of reads per hour | 554.40 Number of input reads | 14013906 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13160544 Uniquely mapped reads % | 93.91% Average mapped length | 295.80 Number of splices: Total | 12592312 Number of splices: Annotated (sjdb) | 12412349 Number of splices: GT/AG | 12417014 Number of splices: GC/AG | 143500 Number of splices: AT/AC | 8813 Number of splices: Non-canonical | 22985 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 233498 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 21029 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.24% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 647094 647094 647094 N_multimapping 233498 233498 233498 N_noFeature 239488 13021388 295416 N_ambiguous 138203 1130 54040 UnstrandedReadsAssigned:12782853 PositiveStrandReadsAssigned:138026 NegativeStrandReadsAssigned:12811088 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169133 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169133-trimmed-pair1.fastq SRR7169133-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,013,906 reads, 12,715,131 reads pseudoaligned [quant] estimated average fragment length: 279.715 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52401 SRR7169133.ke.tsv 34699 SRR7169133.se.tsv 87100 total ==> SRR7169133.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.29 243 10.6555 Potri.005G024800.1.v4.1 1035 756.285 48 4.84055 Potri.004G059700.1.v4.1 961 682.392 0 0 Potri.007G009000.2.v4.1 1416 1137.29 0 0 Potri.003G141000.2.v4.1 2943 2664.29 291.074 8.33224 Potri.016G087400.1.v4.1 270 59.6512 972 1242.76 Potri.015G069301.1.v4.1 564 293.414 0 0 Potri.010G195200.1.v4.1 1773 1494.29 14 0.714551 Potri.012G127500.1.v4.1 977 698.328 3762 410.864 ==> SRR7169133.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1021 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 184 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169133 completed mapping pipeline successfully