Starting /dee2/code/volunteer_pipeline.sh SRR7169134 current disk space = 3057655525376 free memory = 1416688760 SRR7169134 SRAfilesize 134010a26cdf5d83de4079748637c45c SRR7169134.sra SRR7169134.sra file validated SRR7169134 is paired end SRR7169134 is conventional basespace SRR7169134 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169134_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91225 34.0 33.0 34.0 33.0 34.0 2 33.34625 34.0 33.0 34.0 33.0 34.0 3 33.4455 34.0 34.0 34.0 33.0 34.0 4 33.42275 34.0 34.0 34.0 33.0 34.0 5 33.44575 34.0 34.0 34.0 33.0 34.0 6 37.029 38.0 37.0 38.0 36.0 38.0 7 37.322 38.0 38.0 38.0 37.0 38.0 8 37.4 38.0 38.0 38.0 37.0 38.0 9 37.40075 38.0 38.0 38.0 37.0 38.0 10-14 37.459500000000006 38.0 38.0 38.0 37.2 38.0 15-19 37.397400000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.370400000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.3257 38.0 38.0 38.0 37.0 38.0 30-34 37.2735 38.0 38.0 38.0 37.0 38.0 35-39 37.1888 38.0 38.0 38.0 36.6 38.0 40-44 36.92399999999999 38.0 38.0 38.0 35.6 38.0 45-49 36.83025 38.0 38.0 38.0 35.0 38.0 50-54 36.78285 38.0 38.0 38.0 34.8 38.0 55-59 36.704899999999995 38.0 38.0 38.0 34.4 38.0 60-64 36.5737 38.0 38.0 38.0 34.2 38.0 65-69 36.501549999999995 38.0 38.0 38.0 34.0 38.0 70-74 36.3928 38.0 38.0 38.0 34.0 38.0 75-79 36.3239 38.0 37.6 38.0 33.6 38.0 80-84 36.20165 38.0 37.2 38.0 33.2 38.0 85-89 36.03655 38.0 37.0 38.0 32.2 38.0 90-94 35.919399999999996 38.0 37.0 38.0 32.0 38.0 95-99 35.727850000000004 38.0 37.0 38.0 30.6 38.0 100-104 35.42204999999999 38.0 36.0 38.0 29.0 38.0 105-109 35.2607 38.0 36.0 38.0 28.8 38.0 110-114 35.13615 38.0 36.0 38.0 28.4 38.0 115-119 34.87675 38.0 35.4 38.0 27.8 38.0 120-124 34.6172 38.0 35.0 38.0 26.2 38.0 125-129 34.14810000000001 38.0 34.2 38.0 23.6 38.0 130-134 33.765499999999996 38.0 34.0 38.0 22.6 38.0 135-139 33.354150000000004 38.0 34.0 38.0 17.4 38.0 140-144 32.83055 38.0 33.6 38.0 14.6 38.0 145-149 31.91155 38.0 33.0 38.0 11.4 38.0 150-151 28.131625 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 3.0 13 2.0 14 3.0 15 2.0 16 1.0 17 2.0 18 4.0 19 8.0 20 7.0 21 11.0 22 7.0 23 18.0 24 18.0 25 21.0 26 23.0 27 32.0 28 39.0 29 65.0 30 70.0 31 74.0 32 105.0 33 137.0 34 210.0 35 351.0 36 878.0 37 1906.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.56769113538227 14.986029972059944 8.89001778003556 30.556261112522225 2 22.525000000000002 16.575 32.725 28.175 3 19.5 22.8 27.875 29.825000000000003 4 22.6 29.2 24.675 23.525 5 22.1 34.9 23.025000000000002 19.975 6 20.0 35.425000000000004 23.425 21.15 7 15.65 26.724999999999998 39.7 17.925 8 18.5 25.85 29.725 25.924999999999997 9 17.549999999999997 24.425 32.824999999999996 25.2 10-14 20.36 29.970000000000002 26.43 23.24 15-19 20.19 29.095 27.145000000000003 23.57 20-24 20.165 29.115000000000002 27.29 23.43 25-29 20.085 29.354999999999997 27.37 23.189999999999998 30-34 20.02 29.294999999999998 26.889999999999997 23.794999999999998 35-39 20.205000000000002 29.470000000000002 26.740000000000002 23.585 40-44 20.035 29.520000000000003 26.875 23.57 45-49 20.185 28.925 27.02 23.87 50-54 19.830000000000002 29.544999999999998 26.8 23.825 55-59 20.150000000000002 28.335 27.465 24.05 60-64 20.155 28.59 27.089999999999996 24.165 65-69 19.645000000000003 28.37 27.750000000000004 24.235 70-74 20.105 28.389999999999997 27.27 24.235 75-79 20.285 28.845 26.974999999999998 23.895 80-84 20.32 28.49 27.36 23.830000000000002 85-89 20.200000000000003 28.73 27.525 23.544999999999998 90-94 20.200000000000003 28.660000000000004 27.42 23.72 95-99 20.685000000000002 28.835 26.99 23.49 100-104 20.349999999999998 29.104999999999997 27.175 23.369999999999997 105-109 20.445 28.634999999999998 27.27 23.65 110-114 20.915 27.915 27.485 23.685000000000002 115-119 20.465 28.105000000000004 27.77 23.66 120-124 20.29 28.645 27.22 23.845 125-129 20.16 27.715 28.144999999999996 23.98 130-134 20.544999999999998 28.57 27.485 23.400000000000002 135-139 20.88604430221511 27.736386819340968 27.68638431921596 23.691184559227963 140-144 21.3 27.935 27.35 23.415 145-149 20.565 28.044999999999998 27.58 23.810000000000002 150-151 20.7375 27.575 27.0875 24.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.5 21 1.5 22 1.0 23 2.0 24 3.5 25 4.0 26 6.0 27 8.5 28 9.5 29 8.5 30 11.0 31 25.0 32 37.5 33 43.0 34 61.5 35 76.5 36 84.5 37 104.0 38 125.5 39 153.5 40 189.5 41 222.5 42 235.0 43 246.0 44 264.5 45 271.5 46 255.0 47 249.5 48 235.5 49 202.0 50 172.5 51 150.5 52 129.0 53 97.5 54 82.0 55 58.5 56 38.5 57 32.0 58 29.5 59 19.0 60 10.0 61 9.5 62 6.5 63 4.5 64 3.5 65 4.5 66 2.5 67 0.5 68 0.5 69 1.0 70 1.0 71 0.5 72 0.5 73 2.0 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0125 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.07500000000000001 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.2125 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.75 0.0 0.0 0.0 0.0 130-131 0.8374999999999999 0.0 0.0 0.0 0.0 132-133 0.95 0.0 0.0 0.0 0.0 134-135 1.0625 0.0 0.0 0.0 0.0 136-137 1.2374999999999998 0.0 0.0 0.0 0.0 138-139 1.3875000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169134 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169134_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54125 33.0 33.0 34.0 32.0 34.0 2 32.69575 33.0 33.0 34.0 32.0 34.0 3 32.73775 34.0 33.0 34.0 32.0 34.0 4 32.68075 34.0 33.0 34.0 32.0 34.0 5 32.66275 34.0 33.0 34.0 32.0 34.0 6 36.807 38.0 38.0 38.0 36.0 38.0 7 36.77375 38.0 38.0 38.0 36.0 38.0 8 36.86175 38.0 38.0 38.0 36.0 38.0 9 36.70875 38.0 38.0 38.0 36.0 38.0 10-14 36.68655 38.0 38.0 38.0 36.0 38.0 15-19 36.61385 38.0 38.0 38.0 35.6 38.0 20-24 36.57675 38.0 38.0 38.0 35.6 38.0 25-29 36.587149999999994 38.0 38.0 38.0 35.8 38.0 30-34 36.5416 38.0 38.0 38.0 35.0 38.0 35-39 36.468999999999994 38.0 38.0 38.0 35.0 38.0 40-44 36.36970000000001 38.0 38.0 38.0 34.4 38.0 45-49 36.398649999999996 38.0 38.0 38.0 34.4 38.0 50-54 36.3735 38.0 38.0 38.0 34.0 38.0 55-59 36.38705 38.0 38.0 38.0 34.6 38.0 60-64 36.3225 38.0 38.0 38.0 34.4 38.0 65-69 36.2577 38.0 38.0 38.0 34.2 38.0 70-74 36.199200000000005 38.0 38.0 38.0 34.0 38.0 75-79 36.044549999999994 38.0 38.0 38.0 33.8 38.0 80-84 36.01375 38.0 38.0 38.0 33.6 38.0 85-89 35.87585 38.0 38.0 38.0 33.0 38.0 90-94 35.821549999999995 38.0 38.0 38.0 32.6 38.0 95-99 35.57715 38.0 37.8 38.0 31.0 38.0 100-104 35.4365 38.0 37.2 38.0 30.4 38.0 105-109 35.3144 38.0 37.0 38.0 29.4 38.0 110-114 35.192099999999996 38.0 37.0 38.0 29.2 38.0 115-119 35.01535 38.0 36.8 38.0 28.4 38.0 120-124 34.8866 38.0 37.0 38.0 27.4 38.0 125-129 34.52505 38.0 36.0 38.0 25.6 38.0 130-134 34.1594 38.0 35.4 38.0 22.6 38.0 135-139 33.9404 38.0 35.0 38.0 21.8 38.0 140-144 33.55825 38.0 35.0 38.0 17.0 38.0 145-149 32.58645 38.0 34.4 38.0 11.2 38.0 150-151 28.86575 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 13.0 4 3.0 5 1.0 6 2.0 7 5.0 8 4.0 9 5.0 10 3.0 11 4.0 12 7.0 13 3.0 14 6.0 15 7.0 16 1.0 17 6.0 18 6.0 19 9.0 20 9.0 21 14.0 22 16.0 23 16.0 24 29.0 25 16.0 26 36.0 27 33.0 28 38.0 29 41.0 30 64.0 31 50.0 32 77.0 33 98.0 34 156.0 35 219.0 36 473.0 37 2516.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.800000000000004 24.525 12.225 23.45 2 27.700000000000003 25.3 29.099999999999998 17.9 3 21.7 28.000000000000004 32.225 18.075 4 23.45 34.449999999999996 22.925 19.175 5 24.075 37.05 21.25 17.625 6 21.375 37.55 21.875 19.2 7 20.549999999999997 22.75 37.15 19.55 8 20.724999999999998 26.275 26.85 26.150000000000002 9 22.0 25.974999999999998 28.325 23.7 10-14 23.365 28.92 26.005 21.709999999999997 15-19 23.025000000000002 28.544999999999998 26.97 21.46 20-24 23.205000000000002 27.74 28.244999999999997 20.810000000000002 25-29 23.315 27.750000000000004 28.04 20.895 30-34 23.835 27.71 27.42 21.035 35-39 23.235 28.155 27.235 21.375 40-44 22.775000000000002 27.810000000000002 27.91 21.505 45-49 23.200000000000003 28.084999999999997 27.575 21.14 50-54 23.244999999999997 28.005000000000003 27.85 20.9 55-59 23.225 27.355 28.189999999999998 21.23 60-64 23.385 28.4 27.41 20.805 65-69 24.02201100550275 27.678839419709856 27.55377688844422 20.74537268634317 70-74 23.871032342044657 28.276759787724043 26.965054570942225 20.88715329928908 75-79 23.900285900586848 27.396298339770276 28.47971108993329 20.223704669709587 80-84 24.060000000000002 27.67 27.765 20.505000000000003 85-89 24.2 27.145000000000003 27.700000000000003 20.955 90-94 24.34 27.105 27.615000000000002 20.94 95-99 24.035 28.175 27.889999999999997 19.900000000000002 100-104 24.275 27.744999999999997 27.42 20.560000000000002 105-109 24.195 27.155 28.125 20.525 110-114 24.12 27.6 27.83 20.45 115-119 24.07 27.76 27.894999999999996 20.275000000000002 120-124 24.555 27.685 27.42 20.34 125-129 24.16 27.24 27.395000000000003 21.205 130-134 23.715 27.860000000000003 27.825 20.599999999999998 135-139 23.84 27.529999999999998 28.060000000000002 20.57 140-144 23.89 28.155 27.089999999999996 20.865000000000002 145-149 24.09911041865608 27.642358144443886 27.421219279288334 20.837312157611702 150-151 24.738236407215844 26.83234514948909 28.14431689163618 20.285101551658887 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.5 21 1.0 22 0.0 23 0.5 24 2.0 25 3.5 26 3.5 27 3.5 28 5.0 29 6.0 30 11.0 31 16.5 32 22.5 33 31.0 34 38.5 35 55.5 36 72.0 37 84.5 38 115.5 39 148.5 40 189.0 41 231.0 42 266.5 43 273.5 44 267.5 45 281.0 46 284.5 47 268.5 48 242.5 49 220.5 50 195.5 51 157.0 52 125.0 53 96.0 54 69.0 55 47.5 56 32.5 57 30.5 58 23.0 59 16.0 60 11.5 61 12.0 62 11.0 63 7.0 64 3.0 65 3.0 66 3.5 67 2.0 68 1.0 69 0.5 70 2.0 71 1.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.05 70-74 0.13 75-79 0.315 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.515 150-151 0.9125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0125 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.45 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.6375 0.0 0.0 0.0 0.0 126-127 0.7125 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.8625 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.0625 0.0 0.0 0.0 0.0 136-137 1.2374999999999998 0.0 0.0 0.0 0.0 138-139 1.3875000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGGTG 10 0.006830828 145.0 7 >>END_MODULE Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra Read 860584 spots for SRR7169134.sra Written 860584 spots for SRR7169134.sra SRR ids: ['SRR7169134.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9y4nw_ar SRR7169134.sra spots: 17211680 blocks: [[1, 860584], [860585, 1721168], [1721169, 2581752], [2581753, 3442336], [3442337, 4302920], [4302921, 5163504], [5163505, 6024088], [6024089, 6884672], [6884673, 7745256], [7745257, 8605840], [8605841, 9466424], [9466425, 10327008], [10327009, 11187592], [11187593, 12048176], [12048177, 12908760], [12908761, 13769344], [13769345, 14629928], [14629929, 15490512], [15490513, 16351096], [16351097, 17211680]] SRR7169134 file size 5810773 SRR7169134 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169134 SRR7169134_1.fastq SRR7169134_2.fastq Input file: SRR7169134_1.fastq Paired file: SRR7169134_2.fastq trimmed: SRR7169134-trimmed-pair1.fastq, SRR7169134-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:27:24 2025 >> started Mon Feb 10 23:27:57 2025 >> done (33.024s) 17211680 read pairs processed; of these: 30211 ( 0.18%) short read pairs filtered out after trimming by size control 21743 ( 0.13%) empty read pairs filtered out after trimming by size control 17159726 (99.70%) read pairs available; of these: 7596783 (44.27%) trimmed read pairs available after processing 9562943 (55.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 2 0.00% 20 6 0.00% 21 2 0.00% 22 1 0.00% 23 5 0.00% 24 3 0.00% 25 3 0.00% 26 6 0.00% 27 9 0.00% 28 3 0.00% 29 12 0.00% 30 6 0.00% 31 12 0.00% 32 11 0.00% 33 6 0.00% 34 13 0.00% 35 14 0.00% 36 9 0.00% 37 12 0.00% 38 12 0.00% 39 15 0.00% 40 20 0.00% 41 25 0.00% 42 21 0.00% 43 25 0.00% 44 30 0.00% 45 34 0.00% 46 32 0.00% 47 28 0.00% 48 41 0.00% 49 50 0.00% 50 44 0.00% 51 36 0.00% 52 56 0.00% 53 52 0.00% 54 69 0.00% 55 71 0.00% 56 95 0.00% 57 106 0.00% 58 97 0.00% 59 98 0.00% 60 109 0.00% 61 130 0.00% 62 137 0.00% 63 148 0.00% 64 184 0.00% 65 161 0.00% 66 213 0.00% 67 230 0.00% 68 242 0.00% 69 262 0.00% 70 283 0.00% 71 349 0.00% 72 378 0.00% 73 384 0.00% 74 447 0.00% 75 508 0.00% 76 572 0.00% 77 605 0.00% 78 681 0.00% 79 718 0.00% 80 900 0.01% 81 928 0.01% 82 1091 0.01% 83 1344 0.01% 84 2599 0.02% 85 3455 0.02% 86 3247 0.02% 87 3406 0.02% 88 3437 0.02% 89 3460 0.02% 90 3526 0.02% 91 3831 0.02% 92 3799 0.02% 93 4132 0.02% 94 4301 0.03% 95 4402 0.03% 96 4784 0.03% 97 5018 0.03% 98 5153 0.03% 99 5522 0.03% 100 5946 0.03% 101 6214 0.04% 102 6682 0.04% 103 7008 0.04% 104 7368 0.04% 105 7797 0.05% 106 8273 0.05% 107 8683 0.05% 108 9276 0.05% 109 9772 0.06% 110 10140 0.06% 111 11216 0.07% 112 11803 0.07% 113 12614 0.07% 114 13347 0.08% 115 14412 0.08% 116 15206 0.09% 117 16038 0.09% 118 17041 0.10% 119 18025 0.11% 120 19189 0.11% 121 20085 0.12% 122 21405 0.12% 123 22884 0.13% 124 24711 0.14% 125 26415 0.15% 126 27802 0.16% 127 29650 0.17% 128 31623 0.18% 129 33706 0.20% 130 36335 0.21% 131 38894 0.23% 132 41867 0.24% 133 45408 0.26% 134 48905 0.28% 135 52747 0.31% 136 57804 0.34% 137 63250 0.37% 138 69928 0.41% 139 76707 0.45% 140 85103 0.50% 141 93757 0.55% 142 104317 0.61% 143 118521 0.69% 144 138952 0.81% 145 167627 0.98% 146 211363 1.23% 147 293057 1.71% 148 439551 2.56% 149 856650 4.99% 150 4005434 23.34% 151 9562943 55.73% 17159726 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=35 prefix-density=0.19 prefix-fanout=2.7 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=306.41 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=19.8 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=41 prefix-density=0.18 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=43 fanout-score=156.52 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=15.2 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169134 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:28:53 Started mapping on | Feb 10 23:28:54 Finished on | Feb 10 23:31:10 Mapping speed, Million of reads per hour | 454.23 Number of input reads | 17159726 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15843342 Uniquely mapped reads % | 92.33% Average mapped length | 296.31 Number of splices: Total | 14834301 Number of splices: Annotated (sjdb) | 14598797 Number of splices: GT/AG | 14616090 Number of splices: GC/AG | 176113 Number of splices: AT/AC | 11326 Number of splices: Non-canonical | 30772 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 292721 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 110864 % of reads mapped to too many loci | 0.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.22% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1052752 1052752 1052752 N_multimapping 292721 292721 292721 N_noFeature 331509 15669340 399727 N_ambiguous 175055 1533 68171 UnstrandedReadsAssigned:15336778 PositiveStrandReadsAssigned:172469 NegativeStrandReadsAssigned:15375444 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169134 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169134-trimmed-pair1.fastq SRR7169134-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,159,726 reads, 15,369,391 reads pseudoaligned [quant] estimated average fragment length: 282.692 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52401 SRR7169134.ke.tsv 34699 SRR7169134.se.tsv 87100 total ==> SRR7169134.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.31 264 8.94276 Potri.005G024800.1.v4.1 1035 753.308 39 3.045 Potri.004G059700.1.v4.1 961 679.357 0 0 Potri.007G009000.2.v4.1 1416 1134.31 0 0 Potri.003G141000.2.v4.1 2943 2661.31 303 6.69641 Potri.016G087400.1.v4.1 270 59.8295 1592.62 1565.64 Potri.015G069301.1.v4.1 564 290.382 0 0 Potri.010G195200.1.v4.1 1773 1491.31 38 1.49869 Potri.012G127500.1.v4.1 977 695.343 6904 583.977 ==> SRR7169134.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2882 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 245 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 37 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7169134 completed mapping pipeline successfully