Starting /dee2/code/volunteer_pipeline.sh SRR7169135 current disk space = 3057199312896 free memory = 1572984916 SRR7169135 SRAfilesize 5d82482d7cc0f9b2ccd8cc05770c7a9f SRR7169135.sra SRR7169135.sra file validated SRR7169135 is paired end SRR7169135 is conventional basespace SRR7169135 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169135_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.154 34.0 34.0 34.0 33.0 34.0 2 33.49275 34.0 34.0 34.0 33.0 34.0 3 33.547 34.0 34.0 34.0 33.0 34.0 4 33.5695 34.0 34.0 34.0 33.0 34.0 5 33.54075 34.0 34.0 34.0 33.0 34.0 6 37.32 38.0 38.0 38.0 36.0 38.0 7 37.58825 38.0 38.0 38.0 37.0 38.0 8 37.5905 38.0 38.0 38.0 38.0 38.0 9 37.64675 38.0 38.0 38.0 38.0 38.0 10-14 37.671949999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.6171 38.0 38.0 38.0 38.0 38.0 20-24 37.6292 38.0 38.0 38.0 38.0 38.0 25-29 37.54235 38.0 38.0 38.0 38.0 38.0 30-34 37.42375 38.0 38.0 38.0 37.8 38.0 35-39 37.410450000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.23945 38.0 38.0 38.0 37.0 38.0 45-49 37.14315 38.0 38.0 38.0 36.8 38.0 50-54 37.0458 38.0 38.0 38.0 36.0 38.0 55-59 36.9245 38.0 38.0 38.0 36.0 38.0 60-64 36.981449999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.796049999999994 38.0 38.0 38.0 35.4 38.0 70-74 36.76825 38.0 38.0 38.0 35.0 38.0 75-79 36.55284999999999 38.0 38.0 38.0 34.4 38.0 80-84 36.53985 38.0 38.0 38.0 34.8 38.0 85-89 36.4495 38.0 38.0 38.0 34.0 38.0 90-94 36.1706 38.0 38.0 38.0 33.6 38.0 95-99 36.2096 38.0 38.0 38.0 34.0 38.0 100-104 35.8083 38.0 37.6 38.0 32.0 38.0 105-109 35.76424999999999 38.0 37.0 38.0 32.2 38.0 110-114 35.4106 38.0 37.0 38.0 30.2 38.0 115-119 35.459199999999996 38.0 37.0 38.0 30.6 38.0 120-124 35.1406 38.0 36.2 38.0 28.8 38.0 125-129 34.774950000000004 38.0 35.8 38.0 27.0 38.0 130-134 34.43965 38.0 35.0 38.0 25.6 38.0 135-139 34.20915 38.0 35.0 38.0 24.4 38.0 140-144 33.71804999999999 38.0 35.0 38.0 21.8 38.0 145-149 33.04085 38.0 34.2 38.0 14.4 38.0 150-151 29.686249999999998 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 2.0 11 0.0 12 2.0 13 2.0 14 3.0 15 2.0 16 8.0 17 3.0 18 16.0 19 3.0 20 8.0 21 11.0 22 11.0 23 13.0 24 11.0 25 19.0 26 26.0 27 26.0 28 31.0 29 38.0 30 31.0 31 50.0 32 67.0 33 106.0 34 146.0 35 239.0 36 595.0 37 2528.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.10113780025284 15.752212389380531 9.785082174462707 34.36156763590392 2 23.3 14.35 30.275000000000002 32.074999999999996 3 19.825 17.2 25.75 37.225 4 22.6 23.7 24.05 29.65 5 22.975 27.275 24.575 25.174999999999997 6 22.025 32.4 23.474999999999998 22.1 7 15.4 31.05 38.525 15.024999999999999 8 16.575 29.925 31.474999999999998 22.025 9 15.8 27.85 34.55 21.8 10-14 18.37 31.495 28.105000000000004 22.03 15-19 19.035 29.970000000000002 27.315 23.68 20-24 19.314999999999998 30.509999999999998 27.355 22.82 25-29 18.85 30.615 27.46 23.075000000000003 30-34 19.040000000000003 30.12 27.38 23.46 35-39 19.545 29.904999999999998 27.02 23.53 40-44 19.45 29.609999999999996 27.400000000000002 23.54 45-49 19.61 29.509999999999998 27.425 23.455000000000002 50-54 19.575 30.0 26.945000000000004 23.48 55-59 19.215 30.14 27.310000000000002 23.335 60-64 19.665 29.025000000000002 27.495000000000005 23.815 65-69 19.495 29.695 27.055 23.755000000000003 70-74 19.86 29.625 27.250000000000004 23.265 75-79 19.56 29.2 26.974999999999998 24.265 80-84 20.06 28.915000000000003 27.275 23.75 85-89 19.835 28.645 26.779999999999998 24.740000000000002 90-94 20.27 29.28 26.61 23.84 95-99 19.805 29.375 26.43 24.39 100-104 20.27933520224269 29.265118141770124 27.022426912294755 23.433119743692433 105-109 20.31 27.87 27.725 24.095 110-114 19.88576581993086 28.328072548724887 27.170699934866477 24.61546169647778 115-119 19.675 28.904999999999998 27.189999999999998 24.23 120-124 20.489587505006007 28.313976772126555 26.972366840208252 24.224068882659193 125-129 20.433064959743962 28.309246386958044 27.06906035905386 24.188628294244136 130-134 20.200000000000003 28.27 27.26 24.27 135-139 20.235 27.985 27.189999999999998 24.59 140-144 20.645 27.74 27.57 24.044999999999998 145-149 20.91 27.435 27.365000000000002 24.29 150-151 20.474999999999998 27.224999999999998 27.6375 24.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.5 22 2.0 23 4.5 24 7.5 25 9.5 26 10.5 27 10.0 28 11.5 29 19.5 30 31.0 31 43.5 32 57.5 33 71.5 34 83.0 35 101.0 36 124.0 37 134.0 38 153.5 39 168.5 40 172.0 41 192.0 42 214.5 43 227.0 44 238.5 45 236.5 46 217.0 47 213.5 48 200.5 49 168.5 50 149.5 51 130.5 52 110.0 53 107.5 54 92.0 55 66.0 56 47.5 57 34.5 58 31.0 59 23.5 60 15.5 61 13.0 62 15.0 63 11.5 64 5.0 65 2.5 66 4.5 67 4.5 68 2.0 69 1.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.12 105-109 0.0 110-114 0.20500000000000002 115-119 0.0 120-124 0.12 125-129 0.015 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34409687184662 98.45 2 0.5297679112008072 1.05 3 0.050454086781029264 0.15 4 0.050454086781029264 0.2 5 0.0 0.0 6 0.025227043390514632 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 1.0625 0.0 0.0 0.0 0.0 132-133 1.1875 0.0 0.0 0.0 0.0 134-135 1.3375 0.0 0.0 0.0125 0.0 136-137 1.4875 0.0 0.0 0.025 0.0 138-139 1.675 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTTCA 10 0.006830828 145.0 4 >>END_MODULE SRR7169135 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169135_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7235 33.0 33.0 34.0 32.0 34.0 2 32.87425 34.0 33.0 34.0 32.0 34.0 3 32.95925 34.0 33.0 34.0 32.0 34.0 4 32.93675 34.0 33.0 34.0 32.0 34.0 5 33.00225 34.0 33.0 34.0 33.0 34.0 6 37.15275 38.0 38.0 38.0 37.0 38.0 7 37.1495 38.0 38.0 38.0 37.0 38.0 8 37.079 38.0 38.0 38.0 37.0 38.0 9 37.084 38.0 38.0 38.0 37.0 38.0 10-14 37.10555 38.0 38.0 38.0 37.0 38.0 15-19 37.0712 38.0 38.0 38.0 37.0 38.0 20-24 37.0535 38.0 38.0 38.0 37.0 38.0 25-29 36.9906 38.0 38.0 38.0 37.0 38.0 30-34 36.981399999999994 38.0 38.0 38.0 37.0 38.0 35-39 36.94075 38.0 38.0 38.0 37.0 38.0 40-44 36.9029 38.0 38.0 38.0 37.0 38.0 45-49 36.8606 38.0 38.0 38.0 36.8 38.0 50-54 36.7363 38.0 38.0 38.0 36.4 38.0 55-59 36.66585 38.0 38.0 38.0 36.0 38.0 60-64 36.6094 38.0 38.0 38.0 36.0 38.0 65-69 36.489250000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.363749999999996 38.0 38.0 38.0 35.6 38.0 75-79 36.31125 38.0 38.0 38.0 35.0 38.0 80-84 36.365950000000005 38.0 38.0 38.0 35.2 38.0 85-89 36.3815 38.0 38.0 38.0 35.0 38.0 90-94 36.30345000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.1399 38.0 38.0 38.0 34.2 38.0 100-104 36.0567 38.0 38.0 38.0 34.0 38.0 105-109 35.9138 38.0 38.0 38.0 33.8 38.0 110-114 35.7504 38.0 38.0 38.0 33.4 38.0 115-119 35.62265 38.0 38.0 38.0 32.2 38.0 120-124 35.5327 38.0 38.0 38.0 32.4 38.0 125-129 35.26755 38.0 37.8 38.0 31.0 38.0 130-134 35.01465 38.0 37.0 38.0 28.4 38.0 135-139 34.65385 38.0 36.0 38.0 27.6 38.0 140-144 34.29115 38.0 36.0 38.0 25.0 38.0 145-149 33.7719 38.0 35.4 38.0 20.4 38.0 150-151 30.6525 36.5 30.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 6.0 4 4.0 5 4.0 6 1.0 7 1.0 8 3.0 9 2.0 10 2.0 11 3.0 12 8.0 13 14.0 14 6.0 15 1.0 16 6.0 17 7.0 18 13.0 19 3.0 20 8.0 21 12.0 22 9.0 23 12.0 24 13.0 25 11.0 26 14.0 27 31.0 28 34.0 29 40.0 30 47.0 31 41.0 32 57.0 33 70.0 34 93.0 35 167.0 36 334.0 37 2914.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.44265593561368 22.43460764587525 13.556338028169016 23.56639839034205 2 28.14610958218664 27.34550913184889 26.54490868151113 17.96347260445334 3 21.71628721541156 28.84663497623217 29.246935201401055 20.190142606955217 4 24.575 32.300000000000004 24.3 18.825 5 27.66383191595798 35.01750875437719 21.11055527763882 16.208104052026012 6 22.5 36.8 23.474999999999998 17.224999999999998 7 21.75 22.525000000000002 36.05 19.675 8 22.875 26.700000000000003 27.150000000000002 23.275000000000002 9 22.675 25.775 29.125 22.425 10-14 24.44 28.895 25.45 21.215 15-19 24.375 27.775 27.034999999999997 20.815 20-24 24.205 28.705000000000002 26.705000000000002 20.385 25-29 24.36 28.754999999999995 26.205000000000002 20.68 30-34 24.065 28.065 26.75 21.12 35-39 24.375 27.644999999999996 26.875 21.105 40-44 24.33 28.58 25.974999999999998 21.115000000000002 45-49 24.685000000000002 27.439999999999998 26.965 20.91 50-54 24.151075889050507 28.404474093394192 26.924813161458594 20.519636856096703 55-59 24.075190993164455 27.497989545637314 27.824688379573782 20.602131081624446 60-64 23.930420793323613 28.017696445628676 27.147956362173847 20.903926398873864 65-69 24.54990165918604 28.125472792374808 27.0512885168188 20.273337031620354 70-74 24.407343891859178 27.69595480681933 27.16130333904973 20.735397962271765 75-79 23.770863799102415 27.55282134032575 28.132721496646663 20.543593363925165 80-84 24.058524812710544 27.5629745085223 27.211021167479508 21.167479511287645 85-89 24.245316188658393 27.70606258476066 27.42478276156512 20.623838465015822 90-94 24.165661439485323 27.4929634097306 28.22677925211098 20.114595898673098 95-99 24.520052266559453 27.073072670620164 27.912353000301536 20.494522062518847 100-104 24.812748202885437 27.884180364952492 27.466948172724077 19.836123259437993 105-109 24.234809267728803 27.577021661557016 27.722772277227726 20.465396793486455 110-114 24.287366145492935 28.032778643607664 27.625559298175055 20.05429591272435 115-119 24.668141592920353 28.001810136765886 27.549275945293644 19.780772325020113 120-124 23.906265714573067 27.642562606859094 28.271145529518254 20.18002614904958 125-129 24.752375685052037 27.904872039821004 27.44230479159334 19.90044748353361 130-134 24.448353857753204 27.675295300326713 27.795928625282734 20.080422216637345 135-139 24.112545381202096 27.990116982654296 27.43041549011698 20.466922146026622 140-144 24.50030284675954 28.29093478699778 27.35715727841712 19.85160508782556 145-149 23.816500783105138 27.469307330874553 28.267569342696913 20.446622543323397 150-151 24.636581974465933 27.61976994058905 28.302363797244347 19.441284287700668 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 2.5 20 3.0 21 3.5 22 4.0 23 2.0 24 0.5 25 3.0 26 5.0 27 5.0 28 6.0 29 7.5 30 11.0 31 13.5 32 18.0 33 30.0 34 33.0 35 38.0 36 63.5 37 81.0 38 96.5 39 133.5 40 184.5 41 226.0 42 244.5 43 265.5 44 275.0 45 270.5 46 280.0 47 283.0 48 246.0 49 213.0 50 190.0 51 153.0 52 134.0 53 112.0 54 91.0 55 70.5 56 53.0 57 43.5 58 24.0 59 18.5 60 21.5 61 15.0 62 7.0 63 4.0 64 3.5 65 3.0 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.075 3 0.075 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.315 55-59 0.52 60-64 0.545 65-69 0.855 70-74 0.8699999999999999 75-79 0.845 80-84 0.555 85-89 0.455 90-94 0.52 95-99 0.51 100-104 0.5349999999999999 105-109 0.515 110-114 0.545 115-119 0.5599999999999999 120-124 0.5700000000000001 125-129 0.555 130-134 0.525 135-139 0.84 140-144 0.9400000000000001 145-149 1.035 150-151 1.1125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11504424778761 98.0 2 0.7079646017699115 1.4000000000000001 3 0.12642225031605564 0.375 4 0.025284450063211124 0.1 5 0.025284450063211124 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.6375 0.0 0.0 0.0 0.0 124-125 0.6625000000000001 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.925 0.0 0.0 0.0 0.0 130-131 1.0625 0.0 0.0 0.0 0.0 132-133 1.1875 0.0 0.0 0.0 0.0 134-135 1.3375 0.0 0.0 0.0 0.0 136-137 1.4875 0.0 0.0 0.0 0.0 138-139 1.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 30 0.0014437955 24.166668 95-99 >>END_MODULE Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548883 spots for SRR7169135.sra Written 548883 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra Read 548872 spots for SRR7169135.sra Written 548872 spots for SRR7169135.sra SRR ids: ['SRR7169135.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0h5skn2t SRR7169135.sra spots: 10977451 blocks: [[1, 548872], [548873, 1097744], [1097745, 1646616], [1646617, 2195488], [2195489, 2744360], [2744361, 3293232], [3293233, 3842104], [3842105, 4390976], [4390977, 4939848], [4939849, 5488720], [5488721, 6037592], [6037593, 6586464], [6586465, 7135336], [7135337, 7684208], [7684209, 8233080], [8233081, 8781952], [8781953, 9330824], [9330825, 9879696], [9879697, 10428568], [10428569, 10977451]] SRR7169135 file size 3698197 SRR7169135 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169135 SRR7169135_1.fastq SRR7169135_2.fastq Input file: SRR7169135_1.fastq Paired file: SRR7169135_2.fastq trimmed: SRR7169135-trimmed-pair1.fastq, SRR7169135-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:40:09 2025 >> started Tue Feb 11 00:40:22 2025 >> done (12.905s) 10977451 read pairs processed; of these: 13194 ( 0.12%) short read pairs filtered out after trimming by size control 9314 ( 0.08%) empty read pairs filtered out after trimming by size control 10954943 (99.79%) read pairs available; of these: 4633533 (42.30%) trimmed read pairs available after processing 6321410 (57.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 7 0.00% 21 5 0.00% 22 8 0.00% 23 5 0.00% 24 10 0.00% 25 11 0.00% 26 6 0.00% 27 7 0.00% 28 7 0.00% 29 8 0.00% 30 14 0.00% 31 9 0.00% 32 17 0.00% 33 10 0.00% 34 13 0.00% 35 8 0.00% 36 7 0.00% 37 19 0.00% 38 10 0.00% 39 12 0.00% 40 19 0.00% 41 19 0.00% 42 14 0.00% 43 21 0.00% 44 20 0.00% 45 26 0.00% 46 31 0.00% 47 28 0.00% 48 23 0.00% 49 26 0.00% 50 37 0.00% 51 37 0.00% 52 43 0.00% 53 50 0.00% 54 54 0.00% 55 59 0.00% 56 59 0.00% 57 57 0.00% 58 67 0.00% 59 82 0.00% 60 110 0.00% 61 101 0.00% 62 108 0.00% 63 113 0.00% 64 131 0.00% 65 128 0.00% 66 164 0.00% 67 178 0.00% 68 202 0.00% 69 265 0.00% 70 391 0.00% 71 387 0.00% 72 372 0.00% 73 463 0.00% 74 498 0.00% 75 663 0.01% 76 554 0.01% 77 399 0.00% 78 606 0.01% 79 932 0.01% 80 1395 0.01% 81 613 0.01% 82 711 0.01% 83 881 0.01% 84 1590 0.01% 85 2174 0.02% 86 2581 0.02% 87 2521 0.02% 88 2447 0.02% 89 2660 0.02% 90 2848 0.03% 91 2919 0.03% 92 3021 0.03% 93 3073 0.03% 94 3363 0.03% 95 3589 0.03% 96 3814 0.03% 97 4273 0.04% 98 4785 0.04% 99 5714 0.05% 100 6537 0.06% 101 5142 0.05% 102 4786 0.04% 103 4901 0.04% 104 5291 0.05% 105 5797 0.05% 106 6187 0.06% 107 6826 0.06% 108 7066 0.06% 109 7430 0.07% 110 7830 0.07% 111 8074 0.07% 112 8477 0.08% 113 9218 0.08% 114 9493 0.09% 115 10484 0.10% 116 10818 0.10% 117 11378 0.10% 118 11823 0.11% 119 12006 0.11% 120 13076 0.12% 121 13420 0.12% 122 14023 0.13% 123 15120 0.14% 124 15591 0.14% 125 16931 0.15% 126 17673 0.16% 127 18967 0.17% 128 19964 0.18% 129 20960 0.19% 130 22289 0.20% 131 23384 0.21% 132 24846 0.23% 133 26467 0.24% 134 28688 0.26% 135 31189 0.28% 136 33263 0.30% 137 36405 0.33% 138 39412 0.36% 139 43525 0.40% 140 46727 0.43% 141 51443 0.47% 142 58254 0.53% 143 65680 0.60% 144 77185 0.70% 145 92125 0.84% 146 113402 1.04% 147 153723 1.40% 148 244864 2.24% 149 479245 4.37% 150 2553420 23.31% 151 6321410 57.70% 10954943 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=14.10 fanout-score-rank=16 prefix-density=0.27 prefix-fanout=6.9 sequence=AAGATCAAATGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=361.76 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=21.4 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=5.08 fanout-score-rank=26 prefix-density=0.61 prefix-fanout=3.3 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=131.30 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=14.3 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGAAGTTACCTGGGTACCACCCCAAGACTGAAGAAGAGAAGGAGAAAGAAAAGGAGAGTGCTTCCCAGTAGGGCAGCAGGCAGTATTCTTGTGTTCTATAGAACGGTGATGATGATGCTTGATGTGTGGCTTGTTTGGTTATGTCCATCTACTGTTTTTCTTCCTTTTTAGAAAAAAAAGCTCGGTTTACTGCAAATATTA SRR7169135 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:41:11 Started mapping on | Feb 11 00:41:11 Finished on | Feb 11 00:43:33 Mapping speed, Million of reads per hour | 277.73 Number of input reads | 10954943 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 9787110 Uniquely mapped reads % | 89.34% Average mapped length | 296.35 Number of splices: Total | 8060133 Number of splices: Annotated (sjdb) | 7904657 Number of splices: GT/AG | 7932810 Number of splices: GC/AG | 97335 Number of splices: AT/AC | 7335 Number of splices: Non-canonical | 22653 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.03% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 196495 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 28472 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.53% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 983672 983672 983672 N_multimapping 196495 196495 196495 N_noFeature 201736 9659766 254774 N_ambiguous 115688 1107 40526 UnstrandedReadsAssigned:9469686 PositiveStrandReadsAssigned:126237 NegativeStrandReadsAssigned:9491810 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169135 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169135-trimmed-pair1.fastq SRR7169135-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,954,943 reads, 9,477,311 reads pseudoaligned [quant] estimated average fragment length: 253.612 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52401 SRR7169135.ke.tsv 34699 SRR7169135.se.tsv 87100 total ==> SRR7169135.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.39 202 9.02307 Potri.005G024800.1.v4.1 1035 782.388 70 7.05536 Potri.004G059700.1.v4.1 961 708.388 9 1.00188 Potri.007G009000.2.v4.1 1416 1163.39 0 0 Potri.003G141000.2.v4.1 2943 2690.39 163 4.77766 Potri.016G087400.1.v4.1 270 63.2352 1109 1382.98 Potri.015G069301.1.v4.1 564 313.504 0 0 Potri.010G195200.1.v4.1 1773 1520.39 21 1.0892 Potri.012G127500.1.v4.1 977 724.388 6125 666.773 ==> SRR7169135.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 831 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169135 completed mapping pipeline successfully