Starting /dee2/code/volunteer_pipeline.sh SRR7169549 current disk space = 3057421062144 free memory = 1519564988 SRR7169549 SRAfilesize 0c9332a9c6b563b3d8c46bce6a2cd91f SRR7169549.sra SRR7169549.sra file validated SRR7169549 is paired end SRR7169549 is conventional basespace SRR7169549 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169549_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.659 34.0 33.0 34.0 32.0 34.0 2 33.31 34.0 33.0 34.0 33.0 34.0 3 33.38125 34.0 33.0 34.0 33.0 34.0 4 33.40725 34.0 33.0 34.0 33.0 34.0 5 33.4385 34.0 33.0 34.0 33.0 34.0 6 37.06775 38.0 37.0 38.0 36.0 38.0 7 37.33375 38.0 38.0 38.0 37.0 38.0 8 37.4135 38.0 38.0 38.0 37.0 38.0 9 37.50825 38.0 38.0 38.0 37.0 38.0 10-14 37.4783 38.0 38.0 38.0 37.4 38.0 15-19 37.46915 38.0 38.0 38.0 37.4 38.0 20-24 37.45015 38.0 38.0 38.0 37.0 38.0 25-29 37.40135 38.0 38.0 38.0 37.0 38.0 30-34 37.38334999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.26655 38.0 38.0 38.0 36.8 38.0 40-44 37.10085 38.0 38.0 38.0 36.0 38.0 45-49 36.98180000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.93985 38.0 38.0 38.0 35.6 38.0 55-59 36.948550000000004 38.0 38.0 38.0 35.6 38.0 60-64 36.850750000000005 38.0 38.0 38.0 35.0 38.0 65-69 36.823449999999994 38.0 38.0 38.0 35.0 38.0 70-74 36.759299999999996 38.0 38.0 38.0 34.8 38.0 75-79 36.5884 38.0 38.0 38.0 34.2 38.0 80-84 36.509049999999995 38.0 38.0 38.0 34.0 38.0 85-89 36.379200000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.27505 38.0 37.6 38.0 34.0 38.0 95-99 36.06665 38.0 37.0 38.0 33.2 38.0 100-104 35.8095 38.0 37.0 38.0 31.8 38.0 105-109 35.64535 38.0 37.0 38.0 31.0 38.0 110-114 35.4613 38.0 36.6 38.0 30.2 38.0 115-119 35.124 38.0 36.0 38.0 28.0 38.0 120-124 35.01885 38.0 36.0 38.0 28.0 38.0 125-129 34.75555 38.0 35.2 38.0 27.2 38.0 130-134 34.38265 38.0 35.0 38.0 25.8 38.0 135-139 34.022400000000005 38.0 35.0 38.0 23.2 38.0 140-144 33.49805 38.0 34.2 38.0 19.8 38.0 145-149 32.9039 38.0 33.8 38.0 16.6 38.0 150-151 28.921 36.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 5.0 17 7.0 18 7.0 19 7.0 20 6.0 21 5.0 22 8.0 23 20.0 24 16.0 25 23.0 26 16.0 27 25.0 28 33.0 29 38.0 30 38.0 31 69.0 32 83.0 33 141.0 34 164.0 35 318.0 36 723.0 37 2243.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.540547454591966 12.100281401893067 7.879253005883857 36.47991813763111 2 23.025000000000002 14.224999999999998 32.7 30.049999999999997 3 20.225 19.3 26.200000000000003 34.275 4 23.200000000000003 28.000000000000004 22.900000000000002 25.900000000000002 5 23.45 32.05 23.425 21.075 6 20.05 35.05 24.224999999999998 20.674999999999997 7 14.2 26.325 42.05 17.424999999999997 8 18.55 25.825 30.9 24.725 9 18.525 26.1 32.85 22.525000000000002 10-14 19.955000000000002 30.049999999999997 27.49 22.505 15-19 19.985 28.685 27.560000000000002 23.77 20-24 19.725 28.854999999999997 27.250000000000004 24.169999999999998 25-29 19.98 28.854999999999997 27.425 23.74 30-34 20.3 28.689999999999998 26.995 24.015 35-39 20.62 28.23 27.515 23.635 40-44 20.560000000000002 28.955 27.22 23.265 45-49 20.06 28.865000000000002 27.255000000000003 23.82 50-54 20.45 28.52 26.900000000000002 24.13 55-59 20.595 28.544999999999998 26.99 23.87 60-64 20.235 28.810000000000002 27.245 23.71 65-69 20.505000000000003 28.54 27.315 23.64 70-74 20.294999999999998 28.804999999999996 27.389999999999997 23.51 75-79 20.61 28.93 26.875 23.585 80-84 20.445 28.23 27.455000000000002 23.87 85-89 20.055 28.389999999999997 27.67 23.885 90-94 20.34 28.310000000000002 27.700000000000003 23.65 95-99 20.119999999999997 28.285 27.644999999999996 23.95 100-104 20.690345172586294 28.44922461230615 27.533766883441718 23.326663331665834 105-109 20.69 28.144999999999996 27.235 23.93 110-114 20.377320722614222 27.763599059200324 27.958764950207676 23.90031526797778 115-119 20.697244035412393 28.234882208773072 27.629670384634625 23.438203371179913 120-124 20.750375187593797 28.369184592296147 27.1935967983992 23.686843421710854 125-129 21.25 27.884999999999998 27.284999999999997 23.580000000000002 130-134 20.759341703766694 29.02806262818268 26.90710819868941 23.305487469361214 135-139 20.915 28.285 26.985 23.815 140-144 20.27 27.775 27.62 24.335 145-149 21.099999999999998 28.335 27.169999999999998 23.395 150-151 20.4625 27.462500000000002 27.85 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 0.5 25 1.0 26 6.0 27 9.5 28 8.5 29 9.0 30 12.0 31 20.0 32 32.5 33 37.5 34 47.5 35 70.0 36 85.0 37 100.0 38 121.5 39 146.5 40 183.0 41 201.5 42 221.5 43 262.0 44 273.0 45 272.0 46 281.0 47 267.5 48 246.5 49 217.5 50 184.5 51 162.0 52 136.0 53 107.0 54 72.5 55 51.5 56 43.5 57 34.5 58 23.5 59 11.5 60 6.0 61 7.5 62 7.0 63 4.5 64 2.0 65 1.5 66 1.0 67 1.0 68 2.5 69 2.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 0.0 110-114 0.08499999999999999 115-119 0.034999999999999996 120-124 0.05 125-129 0.0 130-134 0.045 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2125 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.7875 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.175 0.0 0.0 0.0 0.0 114-115 1.3375 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.5625 0.0 0.0 0.0 0.0 126-127 2.7125 0.0 0.0 0.0 0.0 128-129 2.925 0.0 0.0 0.0 0.0 130-131 3.1 0.0 0.0 0.0 0.0 132-133 3.2750000000000004 0.0 0.0 0.0 0.0 134-135 3.5999999999999996 0.0 0.0 0.0 0.0 136-137 3.9250000000000003 0.0 0.0 0.0 0.0 138-139 4.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCACT 10 0.0068343505 144.975 2 CCGAATC 10 0.0068343505 144.975 2 AAAAAAA 35 0.003540148 20.710714 65-69 >>END_MODULE SRR7169549 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169549_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54525 33.0 33.0 34.0 32.0 34.0 2 32.739 33.0 33.0 34.0 32.0 34.0 3 32.885 34.0 33.0 34.0 32.0 34.0 4 32.851 34.0 33.0 34.0 32.0 34.0 5 32.7855 34.0 33.0 34.0 32.0 34.0 6 37.054 38.0 38.0 38.0 36.0 38.0 7 36.98025 38.0 38.0 38.0 36.0 38.0 8 36.883 38.0 38.0 38.0 36.0 38.0 9 36.98325 38.0 38.0 38.0 36.0 38.0 10-14 36.8783 38.0 38.0 38.0 36.0 38.0 15-19 36.9306 38.0 38.0 38.0 36.0 38.0 20-24 36.939 38.0 38.0 38.0 36.2 38.0 25-29 36.921749999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.94155 38.0 38.0 38.0 36.2 38.0 35-39 36.847 38.0 38.0 38.0 36.0 38.0 40-44 36.83005 38.0 38.0 38.0 36.0 38.0 45-49 36.7557 38.0 38.0 38.0 36.0 38.0 50-54 36.5065 38.0 38.0 38.0 35.6 38.0 55-59 36.066449999999996 38.0 38.0 38.0 34.2 38.0 60-64 35.85995 38.0 38.0 38.0 34.0 38.0 65-69 35.76345 38.0 38.0 38.0 34.0 38.0 70-74 35.678149999999995 38.0 38.0 38.0 33.8 38.0 75-79 35.4535 38.0 38.0 38.0 32.2 38.0 80-84 35.5489 38.0 38.0 38.0 32.6 38.0 85-89 35.6703 38.0 38.0 38.0 33.2 38.0 90-94 35.64525 38.0 38.0 38.0 33.2 38.0 95-99 35.56535 38.0 38.0 38.0 32.2 38.0 100-104 35.43965 38.0 38.0 38.0 31.8 38.0 105-109 35.3388 38.0 38.0 38.0 31.0 38.0 110-114 35.24504999999999 38.0 37.8 38.0 30.6 38.0 115-119 34.9332 38.0 37.0 38.0 28.2 38.0 120-124 34.755700000000004 38.0 36.8 38.0 27.2 38.0 125-129 34.575100000000006 38.0 36.0 38.0 25.8 38.0 130-134 34.1589 38.0 36.0 38.0 23.4 38.0 135-139 33.722249999999995 38.0 35.2 38.0 18.6 38.0 140-144 33.2584 38.0 35.0 38.0 14.4 38.0 145-149 32.342699999999994 38.0 34.0 38.0 8.8 38.0 150-151 28.613125 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 4.0 4 1.0 5 5.0 6 2.0 7 3.0 8 2.0 9 5.0 10 1.0 11 5.0 12 9.0 13 29.0 14 26.0 15 6.0 16 2.0 17 4.0 18 4.0 19 10.0 20 10.0 21 5.0 22 11.0 23 19.0 24 24.0 25 25.0 26 24.0 27 38.0 28 36.0 29 54.0 30 33.0 31 61.0 32 85.0 33 83.0 34 136.0 35 207.0 36 447.0 37 2574.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.22345244086562 21.66582788122798 12.556618017111223 27.554101660795165 2 26.450000000000003 28.15 28.849999999999998 16.55 3 21.224999999999998 28.775000000000002 30.475 19.525000000000002 4 22.05 35.225 23.150000000000002 19.575 5 24.675 34.949999999999996 23.25 17.125 6 20.474999999999998 36.0 24.55 18.975 7 20.5 21.7 37.225 20.575 8 21.275 25.95 27.275 25.5 9 20.0 26.5 29.625 23.875 10-14 23.204364582811955 28.665098353270935 26.157465338605533 21.973071725311577 15-19 22.534788267093802 28.080888977875663 28.241065171688856 21.143257583341676 20-24 23.055 28.410000000000004 27.295 21.240000000000002 25-29 23.87 28.175 27.37 20.585 30-34 22.795 28.595 28.065 20.544999999999998 35-39 23.22 28.01 27.855 20.915 40-44 23.35 28.075 27.76 20.815 45-49 22.97 28.244999999999997 28.04 20.745 50-54 23.41195996579993 27.84791027510939 28.386058441885027 20.35407131720565 55-59 23.551573159556053 27.91467264026067 27.56847571530394 20.96527848487934 60-64 23.01709139289735 27.84771261897452 28.27755603315935 20.857639954968786 65-69 23.011349047398962 28.198017768191857 27.951522621065067 20.839110563344118 70-74 23.413656681909263 27.421260853927965 27.888814673996816 21.276267790165956 75-79 23.29952113691365 26.878121620925803 28.68544359198805 21.13691365017249 80-84 23.81684081130916 28.047531243597625 27.668510551116576 20.467117393976643 85-89 23.86705408574196 27.64439006983739 27.63929245042565 20.849263393995006 90-94 23.28230687077252 27.55937547678381 28.23577277119463 20.922544881249046 95-99 24.10537536165677 27.28795492614588 27.52144561189787 21.085224100299477 100-104 23.853024766544863 27.89788875355258 27.776086073893623 20.473000406008932 105-109 23.535973229224762 28.02819043756021 27.673274856766213 20.762561476448816 110-114 23.93088771787596 28.192136197811106 27.09262261856506 20.78435346574787 115-119 24.42960489705064 27.36378813173471 27.63697070875702 20.56963626245763 120-124 24.50311030192687 27.77019167551712 27.69938805441764 20.027309968138372 125-129 24.2342662670798 28.145476710519635 27.535937420632905 20.084319601767664 130-134 23.997551270278546 28.104275073972047 27.32884399551066 20.56932966023875 135-139 24.092189500640202 27.928297055057616 27.682458386683738 20.297055057618437 140-144 24.72803776683087 27.986453201970445 27.339901477832512 19.945607553366173 145-149 25.321025217884586 27.72420194935795 27.244598009385797 19.710174823371666 150-151 24.721718871343516 27.931659332125292 27.090344292001035 20.256277504530157 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 2.0 18 4.5 19 5.0 20 5.0 21 8.0 22 9.0 23 7.0 24 9.5 25 9.5 26 7.0 27 8.5 28 8.0 29 8.5 30 13.5 31 19.0 32 20.5 33 33.0 34 44.0 35 47.5 36 74.5 37 110.5 38 129.5 39 151.5 40 193.5 41 224.5 42 250.0 43 270.0 44 274.5 45 280.0 46 284.5 47 279.0 48 247.0 49 201.0 50 165.5 51 148.5 52 126.0 53 89.5 54 64.5 55 49.0 56 34.5 57 22.5 58 15.0 59 13.0 60 8.5 61 5.0 62 3.5 63 4.0 64 4.5 65 1.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.105 15-19 0.11 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.585 55-59 1.79 60-64 2.29 65-69 2.635 70-74 2.685 75-79 2.895 80-84 2.3800000000000003 85-89 1.915 90-94 1.685 95-99 1.4949999999999999 100-104 1.48 105-109 1.385 110-114 1.32 115-119 1.165 120-124 1.135 125-129 1.5650000000000002 130-134 1.9900000000000002 135-139 2.375 140-144 2.56 145-149 3.045 150-151 3.4250000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2125 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.3875000000000002 0.0 0.0 0.0 0.0 116-117 1.65 0.0 0.0 0.0 0.0 118-119 1.9375 0.0 0.0 0.0 0.0 120-121 2.1625 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.7 0.0 0.0 0.0 0.0 128-129 2.925 0.0 0.0 0.0 0.0 130-131 3.1 0.0 0.0 0.0 0.0 132-133 3.3 0.0 0.0 0.0 0.0 134-135 3.6625 0.0 0.0 0.0 0.0 136-137 4.0 0.0 0.0 0.0 0.0 138-139 4.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCCATG 10 0.0070428792 143.525 1 >>END_MODULE Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra Read 799574 spots for SRR7169549.sra Written 799574 spots for SRR7169549.sra Read 799571 spots for SRR7169549.sra Written 799571 spots for SRR7169549.sra SRR ids: ['SRR7169549.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rtkfbzr1 SRR7169549.sra spots: 15991423 blocks: [[1, 799571], [799572, 1599142], [1599143, 2398713], [2398714, 3198284], [3198285, 3997855], [3997856, 4797426], [4797427, 5596997], [5596998, 6396568], [6396569, 7196139], [7196140, 7995710], [7995711, 8795281], [8795282, 9594852], [9594853, 10394423], [10394424, 11193994], [11193995, 11993565], [11993566, 12793136], [12793137, 13592707], [13592708, 14392278], [14392279, 15191849], [15191850, 15991423]] SRR7169549 file size 5397268 SRR7169549 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169549 SRR7169549_1.fastq SRR7169549_2.fastq Input file: SRR7169549_1.fastq Paired file: SRR7169549_2.fastq trimmed: SRR7169549-trimmed-pair1.fastq, SRR7169549-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:10:15 2025 >> started Tue Feb 11 00:10:32 2025 >> done (16.728s) 15991423 read pairs processed; of these: 18986 ( 0.12%) short read pairs filtered out after trimming by size control 14193 ( 0.09%) empty read pairs filtered out after trimming by size control 15958244 (99.79%) read pairs available; of these: 8748475 (54.82%) trimmed read pairs available after processing 7209769 (45.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 1 0.00% 21 1 0.00% 22 5 0.00% 23 2 0.00% 24 4 0.00% 25 6 0.00% 26 7 0.00% 27 9 0.00% 28 6 0.00% 29 18 0.00% 30 13 0.00% 31 9 0.00% 32 11 0.00% 33 21 0.00% 34 9 0.00% 35 20 0.00% 36 28 0.00% 37 16 0.00% 38 17 0.00% 39 29 0.00% 40 29 0.00% 41 27 0.00% 42 35 0.00% 43 34 0.00% 44 33 0.00% 45 38 0.00% 46 38 0.00% 47 42 0.00% 48 66 0.00% 49 67 0.00% 50 86 0.00% 51 73 0.00% 52 115 0.00% 53 109 0.00% 54 121 0.00% 55 153 0.00% 56 157 0.00% 57 189 0.00% 58 192 0.00% 59 239 0.00% 60 235 0.00% 61 290 0.00% 62 343 0.00% 63 359 0.00% 64 426 0.00% 65 440 0.00% 66 502 0.00% 67 549 0.00% 68 724 0.00% 69 978 0.01% 70 1146 0.01% 71 1075 0.01% 72 1180 0.01% 73 1428 0.01% 74 1573 0.01% 75 1985 0.01% 76 1834 0.01% 77 1572 0.01% 78 2008 0.01% 79 3030 0.02% 80 4571 0.03% 81 2443 0.02% 82 2990 0.02% 83 3352 0.02% 84 4313 0.03% 85 5198 0.03% 86 5825 0.04% 87 6038 0.04% 88 6000 0.04% 89 6273 0.04% 90 7003 0.04% 91 7380 0.05% 92 8060 0.05% 93 8530 0.05% 94 9435 0.06% 95 10218 0.06% 96 10878 0.07% 97 11767 0.07% 98 12860 0.08% 99 15553 0.10% 100 19194 0.12% 101 16814 0.11% 102 14680 0.09% 103 15222 0.10% 104 16127 0.10% 105 17043 0.11% 106 17846 0.11% 107 18049 0.11% 108 18879 0.12% 109 19788 0.12% 110 20590 0.13% 111 21727 0.14% 112 22996 0.14% 113 24025 0.15% 114 25458 0.16% 115 26436 0.17% 116 27806 0.17% 117 28979 0.18% 118 30214 0.19% 119 30975 0.19% 120 32328 0.20% 121 34021 0.21% 122 35606 0.22% 123 37603 0.24% 124 39651 0.25% 125 41251 0.26% 126 43473 0.27% 127 45522 0.29% 128 47793 0.30% 129 49273 0.31% 130 52050 0.33% 131 54456 0.34% 132 57837 0.36% 133 62155 0.39% 134 66191 0.41% 135 70299 0.44% 136 76178 0.48% 137 81483 0.51% 138 88166 0.55% 139 97309 0.61% 140 105865 0.66% 141 114398 0.72% 142 127266 0.80% 143 143803 0.90% 144 168778 1.06% 145 203814 1.28% 146 257532 1.61% 147 349361 2.19% 148 530695 3.33% 149 1054668 6.61% 150 3974359 24.90% 151 7209769 45.18% 15958244 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=37 prefix-density=0.23 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.16 sequence-density-rank=6 fanout-score=50.93 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=12.2 sequence=CCACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=5.13 fanout-score-rank=17 prefix-density=0.34 prefix-fanout=3.8 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGAT criterion=fanout-score sequence-density=0.16 sequence-density-rank=11 fanout-score=38.19 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=11.1 sequence=TGTTGGTGGTGGTACTGGA SRR7169549 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:11:14 Started mapping on | Feb 11 00:11:14 Finished on | Feb 11 00:12:38 Mapping speed, Million of reads per hour | 683.92 Number of input reads | 15958244 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15211685 Uniquely mapped reads % | 95.32% Average mapped length | 293.17 Number of splices: Total | 13976419 Number of splices: Annotated (sjdb) | 13747760 Number of splices: GT/AG | 13788335 Number of splices: GC/AG | 148932 Number of splices: AT/AC | 10796 Number of splices: Non-canonical | 28356 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 258158 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 48355 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.68% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 507392 507392 507392 N_multimapping 258158 258158 258158 N_noFeature 337661 15006595 417099 N_ambiguous 188553 844 62227 UnstrandedReadsAssigned:14685471 PositiveStrandReadsAssigned:204246 NegativeStrandReadsAssigned:14732359 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169549 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169549-trimmed-pair1.fastq SRR7169549-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,958,244 reads, 14,636,326 reads pseudoaligned [quant] estimated average fragment length: 251.726 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52401 SRR7169549.ke.tsv 34699 SRR7169549.se.tsv 87100 total ==> SRR7169549.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.27 271 10.901 Potri.005G024800.1.v4.1 1035 784.274 16 1.45028 Potri.004G059700.1.v4.1 961 710.292 5 0.500418 Potri.007G009000.2.v4.1 1416 1165.27 0 0 Potri.003G141000.2.v4.1 2943 2692.27 243.086 6.41861 Potri.016G087400.1.v4.1 270 75.9419 1168.35 1093.68 Potri.015G069301.1.v4.1 564 319.431 0 0 Potri.010G195200.1.v4.1 1773 1522.27 13 0.607086 Potri.012G127500.1.v4.1 977 726.28 2370 231.977 ==> SRR7169549.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1306 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 233 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7169549 completed mapping pipeline successfully