Starting /dee2/code/volunteer_pipeline.sh SRR7169550 current disk space = 3057389989888 free memory = 1048999656 SRR7169550 SRAfilesize 285bc4c371ef42b56d03d7516729191c SRR7169550.sra SRR7169550.sra file validated SRR7169550 is paired end SRR7169550 is conventional basespace SRR7169550 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169550_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02825 34.0 33.0 34.0 33.0 34.0 2 33.30275 34.0 33.0 34.0 33.0 34.0 3 33.47525 34.0 34.0 34.0 33.0 34.0 4 33.497 34.0 34.0 34.0 33.0 34.0 5 33.48225 34.0 34.0 34.0 33.0 34.0 6 37.20725 38.0 38.0 38.0 36.0 38.0 7 37.36925 38.0 38.0 38.0 37.0 38.0 8 37.5145 38.0 38.0 38.0 37.0 38.0 9 37.443 38.0 38.0 38.0 37.0 38.0 10-14 37.5132 38.0 38.0 38.0 37.2 38.0 15-19 37.5218 38.0 38.0 38.0 37.6 38.0 20-24 37.49345 38.0 38.0 38.0 37.4 38.0 25-29 37.475300000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.46215 38.0 38.0 38.0 37.2 38.0 35-39 37.407500000000006 38.0 38.0 38.0 37.2 38.0 40-44 37.329750000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.23145 38.0 38.0 38.0 36.8 38.0 50-54 37.21470000000001 38.0 38.0 38.0 36.6 38.0 55-59 37.1918 38.0 38.0 38.0 36.4 38.0 60-64 37.12615 38.0 38.0 38.0 36.0 38.0 65-69 37.07684999999999 38.0 38.0 38.0 36.0 38.0 70-74 37.10655 38.0 38.0 38.0 36.0 38.0 75-79 37.0511 38.0 38.0 38.0 36.0 38.0 80-84 36.98845 38.0 38.0 38.0 35.8 38.0 85-89 36.8603 38.0 38.0 38.0 35.4 38.0 90-94 36.80459999999999 38.0 38.0 38.0 35.0 38.0 95-99 36.750750000000004 38.0 38.0 38.0 34.8 38.0 100-104 36.582100000000004 38.0 38.0 38.0 34.2 38.0 105-109 36.5184 38.0 38.0 38.0 34.0 38.0 110-114 36.34695000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.152649999999994 38.0 37.2 38.0 33.2 38.0 120-124 35.98825 38.0 37.2 38.0 32.4 38.0 125-129 35.82285 38.0 37.0 38.0 32.0 38.0 130-134 35.597500000000004 38.0 36.4 38.0 31.2 38.0 135-139 35.24045 38.0 36.0 38.0 29.2 38.0 140-144 35.014250000000004 38.0 35.8 38.0 29.2 38.0 145-149 34.54485 38.0 35.0 38.0 27.8 38.0 150-151 31.597749999999998 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 3.0 19 0.0 20 6.0 21 4.0 22 4.0 23 6.0 24 14.0 25 12.0 26 19.0 27 11.0 28 21.0 29 26.0 30 36.0 31 56.0 32 53.0 33 98.0 34 128.0 35 220.0 36 538.0 37 2739.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.29395395901847 13.458133063496078 9.612952188211485 30.63496078927397 2 23.575 14.825 31.674999999999997 29.925 3 19.375 21.099999999999998 27.0 32.525 4 22.475 28.7 24.05 24.775 5 22.55 32.125 24.325 21.0 6 19.325 35.699999999999996 24.775 20.200000000000003 7 14.575 27.175 40.8 17.45 8 18.375 25.25 30.725 25.650000000000002 9 17.175 25.474999999999998 32.725 24.625 10-14 19.75 30.28 26.58 23.39 15-19 19.689999999999998 30.009999999999998 26.875 23.425 20-24 19.96 28.645 27.495000000000005 23.9 25-29 19.465 29.345 27.800000000000004 23.39 30-34 19.645000000000003 29.020000000000003 27.71 23.625 35-39 19.735 29.4 27.205000000000002 23.66 40-44 19.96 29.165000000000003 27.33 23.544999999999998 45-49 19.81 29.035 27.365000000000002 23.79 50-54 20.345 28.435 27.57 23.65 55-59 19.939999999999998 28.799999999999997 27.224999999999998 24.035 60-64 20.080000000000002 28.725 26.779999999999998 24.415 65-69 19.59 29.04 27.200000000000003 24.169999999999998 70-74 20.369999999999997 28.84 26.915 23.875 75-79 20.285 28.994999999999997 26.669999999999998 24.05 80-84 19.725 28.64 27.389999999999997 24.245 85-89 20.535 27.905 27.32 24.240000000000002 90-94 20.330000000000002 28.52 27.715 23.435 95-99 20.385 28.139999999999997 27.525 23.95 100-104 20.57 29.160000000000004 26.91 23.36 105-109 20.39 28.465 26.919999999999998 24.224999999999998 110-114 20.165 28.43 26.985 24.42 115-119 20.580000000000002 28.610000000000003 27.029999999999998 23.78 120-124 20.515 28.82 26.615 24.05 125-129 20.75 28.144999999999996 27.139999999999997 23.965 130-134 20.89 28.03 27.36 23.72 135-139 20.77 27.905 27.235 24.09 140-144 20.87 28.139999999999997 27.0 23.990000000000002 145-149 20.830000000000002 28.439999999999998 26.064999999999998 24.665 150-151 20.9125 27.5625 26.85 24.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 2.0 24 3.5 25 4.0 26 2.5 27 5.0 28 9.5 29 15.5 30 18.0 31 24.0 32 37.5 33 48.0 34 57.0 35 64.5 36 84.5 37 106.5 38 127.5 39 162.5 40 186.0 41 213.0 42 249.0 43 254.5 44 256.5 45 263.0 46 255.5 47 237.0 48 228.0 49 216.0 50 177.0 51 166.5 52 141.5 53 93.0 54 76.0 55 58.5 56 42.0 57 29.5 58 17.5 59 14.5 60 13.0 61 9.0 62 8.0 63 6.5 64 4.5 65 4.0 66 1.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.5125000000000002 0.0 0.0 0.0 0.0 116-117 1.8 0.0 0.0 0.0 0.0 118-119 2.1 0.0 0.0 0.0 0.0 120-121 2.3 0.0 0.0 0.0 0.0 122-123 2.4749999999999996 0.0 0.0 0.0 0.0 124-125 2.6375 0.0 0.0 0.0 0.0 126-127 2.9125 0.0 0.0 0.0 0.0 128-129 3.1125 0.0 0.0 0.0 0.0 130-131 3.6624999999999996 0.0 0.0 0.0 0.0 132-133 4.1125 0.0 0.0 0.0 0.0 134-135 4.5625 0.0 0.0 0.0 0.0 136-137 4.9625 0.0 0.0 0.0 0.0 138-139 5.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169550 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169550_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84225 33.0 33.0 34.0 32.0 34.0 2 32.936 34.0 33.0 34.0 32.0 34.0 3 32.9135 34.0 33.0 34.0 32.0 34.0 4 32.90825 34.0 33.0 34.0 32.0 34.0 5 32.972 34.0 33.0 34.0 33.0 34.0 6 37.0685 38.0 38.0 38.0 37.0 38.0 7 37.115 38.0 38.0 38.0 37.0 38.0 8 37.09525 38.0 38.0 38.0 37.0 38.0 9 37.09425 38.0 38.0 38.0 37.0 38.0 10-14 37.044349999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.0269 38.0 38.0 38.0 37.0 38.0 20-24 36.94995 38.0 38.0 38.0 37.0 38.0 25-29 36.94465 38.0 38.0 38.0 37.0 38.0 30-34 36.90105 38.0 38.0 38.0 36.6 38.0 35-39 36.88305 38.0 38.0 38.0 36.6 38.0 40-44 36.82115 38.0 38.0 38.0 36.2 38.0 45-49 36.88719999999999 38.0 38.0 38.0 36.6 38.0 50-54 36.83165 38.0 38.0 38.0 36.4 38.0 55-59 36.782849999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.71310000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.67479999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.56235 38.0 38.0 38.0 35.6 38.0 75-79 36.52354999999999 38.0 38.0 38.0 35.6 38.0 80-84 36.404999999999994 38.0 38.0 38.0 35.0 38.0 85-89 36.3295 38.0 38.0 38.0 34.4 38.0 90-94 36.30995 38.0 38.0 38.0 34.0 38.0 95-99 36.2169 38.0 38.0 38.0 34.0 38.0 100-104 36.20205 38.0 38.0 38.0 34.0 38.0 105-109 36.04545 38.0 38.0 38.0 33.8 38.0 110-114 35.8983 38.0 38.0 38.0 33.6 38.0 115-119 35.7174 38.0 37.8 38.0 33.0 38.0 120-124 35.4473 38.0 37.2 38.0 31.6 38.0 125-129 35.25975 38.0 36.6 38.0 30.2 38.0 130-134 35.115249999999996 38.0 36.6 38.0 30.0 38.0 135-139 34.78235 38.0 36.0 38.0 28.2 38.0 140-144 34.40815 38.0 35.8 38.0 26.4 38.0 145-149 33.8235 38.0 34.8 38.0 21.8 38.0 150-151 30.398375 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 2.0 4 9.0 5 2.0 6 2.0 7 5.0 8 1.0 9 2.0 10 6.0 11 4.0 12 1.0 13 2.0 14 3.0 15 3.0 16 1.0 17 7.0 18 8.0 19 7.0 20 9.0 21 4.0 22 6.0 23 7.0 24 10.0 25 13.0 26 15.0 27 22.0 28 26.0 29 40.0 30 39.0 31 49.0 32 55.0 33 81.0 34 104.0 35 176.0 36 473.0 37 2789.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.57947434292866 22.92866082603254 11.689612015018772 21.802252816020026 2 28.743114672008012 26.69003505257887 26.940410615923888 17.626439659489236 3 20.210368144252442 29.301277235161532 30.954169797145003 19.534184823441024 4 24.812218327491237 34.3264897346019 22.533800701051575 18.327491236855284 5 24.361542313470206 36.17926890335503 22.358537806710068 17.100650976464696 6 21.512647132481845 36.58903080390684 23.791635361883294 18.106686701728027 7 21.398145828113254 22.02455524931095 37.25883237283888 19.318466549736907 8 22.61457550713749 26.3961933383421 25.77009767092412 25.219133483596295 9 21.707561342013022 25.237856785177765 29.56935403104657 23.485227841762644 10-14 23.989582811639202 28.256623428657285 25.882706465668353 21.871087294035156 15-19 24.020835420214365 27.90243413803466 27.15616548131824 20.920564960432735 20-24 23.713870660722336 28.24725742623854 27.210339127385662 20.828532785653458 25-29 24.12963983369233 28.046886740469866 26.60922707007965 21.214246355758153 30-34 23.601582452801843 27.732986128499178 27.677900746156542 20.98753067254244 35-39 23.631354871024293 28.119208615076385 27.01728024042074 21.232156273478587 40-44 23.626621262957585 27.998397516150032 27.31233411788272 21.062647103009667 45-49 24.066099148723087 27.556334501752627 27.361041562343512 21.01652478718077 50-54 23.621613500926436 27.748009414592616 27.783063748810655 20.84731333567029 55-59 24.231347020530798 27.781672508763144 27.090635953930896 20.896344516775162 60-64 24.13620430645969 27.651477215823732 27.456184276414625 20.756134201301954 65-69 24.142248935637365 27.513148009015776 27.853744052091162 20.4908590032557 70-74 24.035667768760646 28.258691513876364 27.392044885282036 20.313595832080956 75-79 23.79044375438245 28.017629970950615 27.541821095862968 20.65010517880397 80-84 24.1121963436013 27.628349611820685 28.06912096168295 20.190333082895066 85-89 24.038268883991183 27.534562211981566 27.48447204968944 20.942696854337807 90-94 24.209946411579107 27.65563179245755 27.755797065157513 20.378624730805832 95-99 24.257599278882267 27.57273774350243 27.948319895838548 20.221343081776755 100-104 24.897346019028543 27.1407110665999 27.626439659489233 20.335503254882322 105-109 24.01862607650711 27.62367314239936 28.0242339274985 20.333466853595034 110-114 24.630640556918916 27.079681474432814 27.996193719637404 20.293484249010866 115-119 23.998196754157483 28.461230214385896 27.13384091364456 20.406732117812062 120-124 24.073331997595673 28.08555399719495 27.669805650170304 20.17130835503907 125-129 24.82592796673847 27.581024896057706 27.445774683163854 20.147272454039975 130-134 24.82962517538585 27.93646021246743 26.844056925235517 20.389857686911206 135-139 25.27923866766842 27.893814174805907 27.347858752817427 19.47908840470824 140-144 24.675714929633898 27.65062352882256 27.485350828867634 20.188310712675918 145-149 25.033802393710253 27.7980870349041 27.28729530772698 19.880815263658672 150-151 26.303939962476548 27.292057535959973 27.392120075046904 19.011882426516575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 5.0 1 2.5 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 1.5 26 2.0 27 2.0 28 2.5 29 4.5 30 8.0 31 9.5 32 11.0 33 18.0 34 33.5 35 45.0 36 57.5 37 79.0 38 110.5 39 141.0 40 190.0 41 233.5 42 269.5 43 296.0 44 299.5 45 285.5 46 288.5 47 283.5 48 241.5 49 222.5 50 181.5 51 140.5 52 126.5 53 108.5 54 83.0 55 57.0 56 40.0 57 32.5 58 25.5 59 19.0 60 12.0 61 5.5 62 5.0 63 6.0 64 4.5 65 3.0 66 2.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.15 3 0.17500000000000002 4 0.15 5 0.15 6 0.17500000000000002 7 0.22499999999999998 8 0.17500000000000002 9 0.15 10-14 0.165 15-19 0.16999999999999998 20-24 0.185 25-29 0.185 30-34 0.155 35-39 0.17500000000000002 40-44 0.155 45-49 0.15 50-54 0.155 55-59 0.15 60-64 0.15 65-69 0.17500000000000002 70-74 0.19 75-79 0.16999999999999998 80-84 0.17500000000000002 85-89 0.18 90-94 0.165 95-99 0.155 100-104 0.15 105-109 0.13999999999999999 110-114 0.165 115-119 0.18 120-124 0.18 125-129 0.185 130-134 0.22 135-139 0.17500000000000002 140-144 0.165 145-149 0.155 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.4020100502512563 0.8 3 0.0 0.0 4 0.0 0.0 5 0.02512562814070352 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.7125 0.0 0.0 0.0 0.0 106-107 0.7875000000000001 0.0 0.0 0.0 0.0 108-109 0.8999999999999999 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.175 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.7 0.0 0.0 0.0 0.0 118-119 1.975 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.375 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.8375 0.0 0.0 0.0 0.0 128-129 3.0375 0.0 0.0 0.0 0.0 130-131 3.575 0.0 0.0 0.0 0.0 132-133 4.05 0.0 0.0 0.0 0.0 134-135 4.487500000000001 0.0 0.0 0.0 0.0 136-137 4.925 0.0 0.0 0.0 0.0 138-139 5.387499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 30 0.0014431519 24.166666 115-119 >>END_MODULE Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774884 spots for SRR7169550.sra Written 774884 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra Read 774881 spots for SRR7169550.sra Written 774881 spots for SRR7169550.sra SRR ids: ['SRR7169550.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e0xrd0ug SRR7169550.sra spots: 15497623 blocks: [[1, 774881], [774882, 1549762], [1549763, 2324643], [2324644, 3099524], [3099525, 3874405], [3874406, 4649286], [4649287, 5424167], [5424168, 6199048], [6199049, 6973929], [6973930, 7748810], [7748811, 8523691], [8523692, 9298572], [9298573, 10073453], [10073454, 10848334], [10848335, 11623215], [11623216, 12398096], [12398097, 13172977], [13172978, 13947858], [13947859, 14722739], [14722740, 15497623]] SRR7169550 file size 5229935 SRR7169550 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169550 SRR7169550_1.fastq SRR7169550_2.fastq Input file: SRR7169550_1.fastq Paired file: SRR7169550_2.fastq trimmed: SRR7169550-trimmed-pair1.fastq, SRR7169550-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:55:29 2025 >> started Mon Feb 10 23:55:47 2025 >> done (18.634s) 15497623 read pairs processed; of these: 31247 ( 0.20%) short read pairs filtered out after trimming by size control 66249 ( 0.43%) empty read pairs filtered out after trimming by size control 15400127 (99.37%) read pairs available; of these: 6534728 (42.43%) trimmed read pairs available after processing 8865399 (57.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 3 0.00% 21 6 0.00% 22 9 0.00% 23 8 0.00% 24 6 0.00% 25 13 0.00% 26 12 0.00% 27 14 0.00% 28 8 0.00% 29 17 0.00% 30 15 0.00% 31 14 0.00% 32 8 0.00% 33 17 0.00% 34 13 0.00% 35 13 0.00% 36 10 0.00% 37 20 0.00% 38 12 0.00% 39 22 0.00% 40 33 0.00% 41 22 0.00% 42 30 0.00% 43 38 0.00% 44 29 0.00% 45 43 0.00% 46 32 0.00% 47 41 0.00% 48 62 0.00% 49 46 0.00% 50 60 0.00% 51 59 0.00% 52 83 0.00% 53 89 0.00% 54 92 0.00% 55 117 0.00% 56 129 0.00% 57 103 0.00% 58 138 0.00% 59 147 0.00% 60 180 0.00% 61 202 0.00% 62 212 0.00% 63 246 0.00% 64 284 0.00% 65 346 0.00% 66 424 0.00% 67 526 0.00% 68 587 0.00% 69 1039 0.01% 70 1447 0.01% 71 1009 0.01% 72 856 0.01% 73 948 0.01% 74 1005 0.01% 75 1083 0.01% 76 1101 0.01% 77 1304 0.01% 78 1367 0.01% 79 1568 0.01% 80 1851 0.01% 81 2035 0.01% 82 2377 0.02% 83 2791 0.02% 84 3969 0.03% 85 4985 0.03% 86 5292 0.03% 87 5441 0.04% 88 5763 0.04% 89 6127 0.04% 90 6333 0.04% 91 6822 0.04% 92 7472 0.05% 93 7832 0.05% 94 8384 0.05% 95 8856 0.06% 96 9267 0.06% 97 9597 0.06% 98 9700 0.06% 99 10506 0.07% 100 11249 0.07% 101 12070 0.08% 102 12790 0.08% 103 13872 0.09% 104 14523 0.09% 105 15489 0.10% 106 15627 0.10% 107 16238 0.11% 108 17242 0.11% 109 17701 0.11% 110 18401 0.12% 111 19695 0.13% 112 20856 0.14% 113 22120 0.14% 114 23426 0.15% 115 24240 0.16% 116 24975 0.16% 117 26240 0.17% 118 26840 0.17% 119 27509 0.18% 120 28579 0.19% 121 29813 0.19% 122 31275 0.20% 123 32991 0.21% 124 35235 0.23% 125 36645 0.24% 126 38315 0.25% 127 39351 0.26% 128 40307 0.26% 129 41757 0.27% 130 44018 0.29% 131 45725 0.30% 132 48717 0.32% 133 51305 0.33% 134 54336 0.35% 135 57885 0.38% 136 60556 0.39% 137 64093 0.42% 138 67728 0.44% 139 70875 0.46% 140 75156 0.49% 141 81563 0.53% 142 89159 0.58% 143 99177 0.64% 144 113251 0.74% 145 131534 0.85% 146 158831 1.03% 147 208989 1.36% 148 307987 2.00% 149 603760 3.92% 150 3221937 20.92% 151 8865399 57.57% 15400127 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=35 prefix-density=0.24 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=12 fanout-score=94.25 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=16.3 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=5.77 fanout-score-rank=26 prefix-density=0.34 prefix-fanout=4.1 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=58.15 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=13.4 sequence=TGTTGGTGGTGG SRR7169550 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:56:35 Started mapping on | Feb 10 23:56:35 Finished on | Feb 10 23:58:04 Mapping speed, Million of reads per hour | 622.93 Number of input reads | 15400127 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14517460 Uniquely mapped reads % | 94.27% Average mapped length | 294.36 Number of splices: Total | 13203136 Number of splices: Annotated (sjdb) | 12978926 Number of splices: GT/AG | 13013923 Number of splices: GC/AG | 152853 Number of splices: AT/AC | 11162 Number of splices: Non-canonical | 25198 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 266145 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 20931 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.83% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 642105 642105 642105 N_multimapping 266145 266145 266145 N_noFeature 308456 14337412 381253 N_ambiguous 165967 1398 57624 UnstrandedReadsAssigned:14043037 PositiveStrandReadsAssigned:178650 NegativeStrandReadsAssigned:14078583 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169550 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169550-trimmed-pair1.fastq SRR7169550-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,400,127 reads, 14,013,911 reads pseudoaligned [quant] estimated average fragment length: 239.597 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52401 SRR7169550.ke.tsv 34699 SRR7169550.se.tsv 87100 total ==> SRR7169550.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.4 245 8.54317 Potri.005G024800.1.v4.1 1035 796.403 42 3.27223 Potri.004G059700.1.v4.1 961 722.413 1 0.0858898 Potri.007G009000.2.v4.1 1416 1177.4 0 0 Potri.003G141000.2.v4.1 2943 2704.4 241.037 5.5302 Potri.016G087400.1.v4.1 270 78.4151 1518 1201.16 Potri.015G069301.1.v4.1 564 329.155 0 0 Potri.010G195200.1.v4.1 1773 1534.4 11 0.444816 Potri.012G127500.1.v4.1 977 738.403 7812 656.442 ==> SRR7169550.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 939 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 216 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169550 completed mapping pipeline successfully