Starting /dee2/code/volunteer_pipeline.sh SRR7169551 current disk space = 3057574383616 free memory = 1214702556 SRR7169551 SRAfilesize 1ea942deb023b1b1029250b3fc1b0eec SRR7169551.sra SRR7169551.sra file validated SRR7169551 is paired end SRR7169551 is conventional basespace SRR7169551 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169551_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.65875 34.0 33.0 34.0 33.0 34.0 2 33.2955 34.0 33.0 34.0 33.0 34.0 3 33.365 34.0 34.0 34.0 33.0 34.0 4 33.4285 34.0 34.0 34.0 33.0 34.0 5 33.3725 34.0 33.0 34.0 33.0 34.0 6 36.9255 38.0 37.0 38.0 35.0 38.0 7 37.29225 38.0 38.0 38.0 37.0 38.0 8 37.419 38.0 38.0 38.0 37.0 38.0 9 37.339 38.0 38.0 38.0 37.0 38.0 10-14 37.427800000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.3754 38.0 38.0 38.0 37.0 38.0 20-24 37.35905 38.0 38.0 38.0 37.0 38.0 25-29 37.3274 38.0 38.0 38.0 37.0 38.0 30-34 37.27425000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.181349999999995 38.0 38.0 38.0 36.4 38.0 40-44 36.91340000000001 38.0 38.0 38.0 35.4 38.0 45-49 36.77524999999999 38.0 38.0 38.0 34.8 38.0 50-54 36.651250000000005 38.0 38.0 38.0 34.4 38.0 55-59 36.58535 38.0 38.0 38.0 34.0 38.0 60-64 36.5227 38.0 38.0 38.0 34.0 38.0 65-69 36.3953 38.0 37.8 38.0 33.8 38.0 70-74 36.32260000000001 38.0 37.2 38.0 33.8 38.0 75-79 36.211349999999996 38.0 37.0 38.0 33.2 38.0 80-84 36.04600000000001 38.0 37.0 38.0 33.0 38.0 85-89 35.9861 38.0 37.0 38.0 32.6 38.0 90-94 35.632250000000006 38.0 36.8 38.0 30.4 38.0 95-99 35.502300000000005 38.0 36.2 38.0 29.8 38.0 100-104 35.22635 38.0 36.0 38.0 28.8 38.0 105-109 35.0738 38.0 36.0 38.0 28.6 38.0 110-114 34.67885 38.0 35.4 38.0 26.8 38.0 115-119 34.45485 38.0 35.0 38.0 25.6 38.0 120-124 34.2181 38.0 34.8 38.0 24.2 38.0 125-129 33.8447 38.0 34.0 38.0 22.6 38.0 130-134 33.596349999999994 38.0 34.0 38.0 20.6 38.0 135-139 32.8387 38.0 33.4 38.0 16.0 38.0 140-144 32.324200000000005 38.0 32.8 38.0 14.0 38.0 145-149 31.3534 36.2 31.8 38.0 8.8 38.0 150-151 27.369625 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 2.0 13 0.0 14 5.0 15 0.0 16 7.0 17 7.0 18 8.0 19 10.0 20 15.0 21 9.0 22 12.0 23 22.0 24 18.0 25 24.0 26 32.0 27 26.0 28 39.0 29 51.0 30 63.0 31 69.0 32 104.0 33 161.0 34 217.0 35 424.0 36 993.0 37 1680.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.94009216589861 11.648745519713263 11.187916026625704 38.22324628776242 2 23.799999999999997 13.725000000000001 30.925000000000004 31.55 3 19.725 19.3 25.074999999999996 35.9 4 23.724999999999998 27.125 22.3 26.85 5 23.799999999999997 29.799999999999997 23.95 22.45 6 18.325 34.525 25.4 21.75 7 15.4 26.525 40.075 18.0 8 18.35 26.75 29.575000000000003 25.324999999999996 9 17.5 25.05 33.324999999999996 24.125 10-14 20.080000000000002 29.299999999999997 27.11 23.51 15-19 19.85 28.299999999999997 27.805000000000003 24.044999999999998 20-24 20.03 28.675 27.529999999999998 23.765 25-29 20.455000000000002 28.79 27.185 23.57 30-34 20.080000000000002 28.055000000000003 27.665 24.2 35-39 19.950000000000003 28.77 26.86 24.42 40-44 19.785 28.835 27.860000000000003 23.52 45-49 19.875 28.845 27.08 24.2 50-54 20.349999999999998 27.685 27.534999999999997 24.43 55-59 20.115 28.84 27.534999999999997 23.51 60-64 19.994999999999997 28.705000000000002 26.825 24.474999999999998 65-69 19.62 28.765 27.295 24.32 70-74 20.205000000000002 28.43 27.68 23.685000000000002 75-79 20.25 28.110000000000003 27.55 24.09 80-84 20.095 28.28 27.265 24.36 85-89 20.244999999999997 27.694999999999997 27.47 24.59 90-94 20.369999999999997 28.299999999999997 27.495000000000005 23.835 95-99 19.975 27.98 27.615000000000002 24.43 100-104 20.8172667634834 28.023436326305774 27.257248735540085 23.90204817467074 105-109 20.435 27.985 27.27 24.310000000000002 110-114 20.721804511278197 28.280701754385966 27.137844611528823 23.859649122807017 115-119 20.866910255768556 28.46989338805746 27.17353220881926 23.489664147354723 120-124 20.570713391739677 28.846057571964955 26.403003754693366 24.180225281602002 125-129 20.572773243879237 28.10794572673109 27.106593901767383 24.21268712762229 130-134 21.09 28.134999999999998 26.705000000000002 24.07 135-139 20.485 28.625 26.845000000000002 24.044999999999998 140-144 20.61 28.050000000000004 27.02 24.32 145-149 20.925 28.23 26.540000000000003 24.305 150-151 20.3875 27.700000000000003 27.425 24.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 3.0 25 4.5 26 5.0 27 5.5 28 7.0 29 11.0 30 17.5 31 23.0 32 26.0 33 32.0 34 45.0 35 56.0 36 72.5 37 101.5 38 133.0 39 164.0 40 185.0 41 205.5 42 227.0 43 245.0 44 254.5 45 259.0 46 273.5 47 274.5 48 246.0 49 210.0 50 183.5 51 142.0 52 115.0 53 108.0 54 95.5 55 82.0 56 54.5 57 32.5 58 26.0 59 19.0 60 10.0 61 9.0 62 10.0 63 7.5 64 5.0 65 2.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.155 105-109 0.0 110-114 0.25 115-119 0.105 120-124 0.125 125-129 0.135 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.3 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.7374999999999998 0.0 0.0 0.0 0.0 108-109 1.9625 0.0 0.0 0.0 0.0 110-111 2.325 0.0 0.0 0.0 0.0 112-113 2.5625 0.0 0.0 0.0 0.0 114-115 2.85 0.0 0.0 0.0 0.0 116-117 3.25 0.0 0.0 0.0 0.0 118-119 3.5875 0.0 0.0 0.0 0.0 120-121 3.8875 0.0 0.0 0.0 0.0 122-123 4.125 0.0 0.0 0.0 0.0 124-125 4.512499999999999 0.0 0.0 0.0 0.0 126-127 4.975 0.0 0.0 0.0 0.0 128-129 5.2625 0.0 0.0 0.0 0.0 130-131 5.6 0.0 0.0 0.0 0.0 132-133 5.875 0.0 0.0 0.0 0.0 134-135 6.1625 0.0 0.0 0.0 0.0 136-137 6.449999999999999 0.0 0.0 0.0 0.0 138-139 7.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTTA 10 0.006832588 144.9875 145 >>END_MODULE SRR7169551 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169551_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5665 33.0 33.0 34.0 32.0 34.0 2 32.8895 34.0 33.0 34.0 32.0 34.0 3 32.87225 34.0 33.0 34.0 32.0 34.0 4 32.815 34.0 33.0 34.0 32.0 34.0 5 32.753 34.0 33.0 34.0 32.0 34.0 6 36.86725 38.0 38.0 38.0 36.0 38.0 7 36.8765 38.0 38.0 38.0 36.0 38.0 8 36.95575 38.0 38.0 38.0 37.0 38.0 9 36.89675 38.0 38.0 38.0 36.0 38.0 10-14 36.946600000000004 38.0 38.0 38.0 36.4 38.0 15-19 36.9072 38.0 38.0 38.0 36.2 38.0 20-24 36.8721 38.0 38.0 38.0 36.6 38.0 25-29 36.85845 38.0 38.0 38.0 36.4 38.0 30-34 36.8583 38.0 38.0 38.0 36.2 38.0 35-39 36.8134 38.0 38.0 38.0 36.2 38.0 40-44 36.7547 38.0 38.0 38.0 36.0 38.0 45-49 36.6915 38.0 38.0 38.0 36.0 38.0 50-54 36.47755 38.0 38.0 38.0 35.4 38.0 55-59 36.05944999999999 38.0 38.0 38.0 34.2 38.0 60-64 35.96575 38.0 38.0 38.0 34.2 38.0 65-69 35.78445 38.0 38.0 38.0 34.0 38.0 70-74 35.765750000000004 38.0 38.0 38.0 33.8 38.0 75-79 35.6914 38.0 38.0 38.0 33.4 38.0 80-84 35.6631 38.0 38.0 38.0 33.4 38.0 85-89 35.605549999999994 38.0 38.0 38.0 33.0 38.0 90-94 35.580650000000006 38.0 38.0 38.0 33.0 38.0 95-99 35.4254 38.0 38.0 38.0 31.2 38.0 100-104 35.2993 38.0 38.0 38.0 30.2 38.0 105-109 35.24544999999999 38.0 38.0 38.0 30.6 38.0 110-114 35.052550000000004 38.0 37.2 38.0 29.0 38.0 115-119 34.85615 38.0 37.0 38.0 27.8 38.0 120-124 34.63885 38.0 36.4 38.0 27.0 38.0 125-129 34.41775 38.0 36.0 38.0 25.4 38.0 130-134 34.04755 38.0 35.8 38.0 23.0 38.0 135-139 33.54780000000001 38.0 35.0 38.0 17.2 38.0 140-144 33.11675 38.0 35.0 38.0 14.0 38.0 145-149 32.21485 38.0 34.2 38.0 6.6 38.0 150-151 28.26925 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 7.0 4 5.0 5 3.0 6 7.0 7 2.0 8 3.0 9 3.0 10 3.0 11 4.0 12 14.0 13 20.0 14 22.0 15 6.0 16 6.0 17 10.0 18 8.0 19 6.0 20 11.0 21 21.0 22 10.0 23 21.0 24 12.0 25 19.0 26 26.0 27 27.0 28 31.0 29 37.0 30 48.0 31 70.0 32 65.0 33 102.0 34 116.0 35 208.0 36 466.0 37 2571.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.33333333333333 22.867924528301884 17.459119496855347 26.339622641509436 2 30.207551887971995 26.331582895723933 25.756439109777446 17.704426106526633 3 22.525000000000002 27.175 30.375000000000004 19.925 4 23.025000000000002 33.900000000000006 24.275 18.8 5 25.624999999999996 35.125 21.224999999999998 18.025 6 21.65 36.725 23.674999999999997 17.95 7 20.075000000000003 21.775 37.675 20.474999999999998 8 22.975 25.474999999999998 26.8 24.75 9 21.375 25.85 28.999999999999996 23.775 10-14 23.630000000000003 28.53 26.0 21.84 15-19 23.849999999999998 27.57 27.3 21.279999999999998 20-24 23.275000000000002 28.13 27.224999999999998 21.37 25-29 23.43 28.16 27.38 21.029999999999998 30-34 23.35 27.435 27.83 21.385 35-39 23.355 28.035 27.584999999999997 21.025 40-44 23.605 27.334999999999997 27.625 21.435000000000002 45-49 23.75 27.33 27.834999999999997 21.085 50-54 23.68949588270737 28.444466760393656 26.551516368748747 21.31452098815023 55-59 24.451999188146946 27.466003653338745 27.415262837426425 20.666734321087883 60-64 24.303011803011803 26.948514448514448 28.093203093203094 20.655270655270655 65-69 23.943087357845886 27.77296139527768 28.058544545871793 20.22540670100464 70-74 24.094110441972035 28.034092069000714 26.81943452077166 21.05236296825559 75-79 23.80928071877074 27.224462708663026 27.66348460870897 21.302771963857268 80-84 23.717687767148384 27.936087929981678 27.41705678811317 20.92916751475677 85-89 24.597572741583303 26.842025085055603 27.84238054130909 20.718021632051997 90-94 24.28085840393689 27.502409821926843 27.542996296484194 20.673735477652073 95-99 24.300344757655647 28.30561752180085 26.982356519975664 20.411681200567834 100-104 24.544030717930582 27.81791542464508 27.085333198605564 20.552720658818775 105-109 23.89679894981319 27.375542764818743 27.552256891850956 21.175401393517117 110-114 24.73519620700091 28.346615555331383 26.808231615050943 20.109956622616764 115-119 24.764685156289325 27.71933356822872 27.71933356822872 19.796647707253236 120-124 24.77987421383648 27.617610062893082 27.05408805031447 20.548427672955974 125-129 25.155326564631004 27.393039349396375 27.403141890185385 20.04849219578724 130-134 25.666412795125666 27.636455953287637 27.01193196242701 19.685199289159687 135-139 25.291452425800536 27.969251132719037 26.523443465865704 20.215852975614723 140-144 24.42553625108269 28.302848117389313 27.350078972843534 19.921536658684467 145-149 25.322918262112626 28.171746566600298 26.614591310563128 19.89074386072395 150-151 25.076804915514593 28.622631848438303 26.74091141833077 19.559651817716333 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 1.0 19 3.5 20 4.0 21 4.5 22 7.0 23 8.5 24 7.5 25 5.5 26 5.0 27 5.5 28 10.0 29 11.5 30 8.5 31 11.0 32 17.0 33 27.0 34 34.5 35 36.5 36 54.0 37 86.0 38 117.5 39 153.0 40 196.0 41 213.5 42 240.0 43 270.0 44 277.0 45 283.0 46 284.5 47 290.0 48 248.5 49 204.0 50 182.0 51 151.0 52 117.0 53 90.5 54 82.5 55 66.5 56 49.5 57 40.5 58 30.5 59 17.0 60 10.5 61 9.0 62 7.5 63 5.0 64 2.0 65 1.5 66 1.0 67 1.0 68 2.0 69 2.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.42 55-59 1.46 60-64 1.72 65-69 1.955 70-74 2.03 75-79 2.0549999999999997 80-84 1.7399999999999998 85-89 1.5350000000000001 90-94 1.4449999999999998 95-99 1.38 100-104 1.035 105-109 0.97 110-114 0.8699999999999999 115-119 0.6649999999999999 120-124 0.625 125-129 1.015 130-134 1.525 135-139 1.7850000000000001 140-144 1.865 145-149 2.0650000000000004 150-151 2.35 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.3 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.7374999999999998 0.0 0.0 0.0 0.0 108-109 1.9875 0.0 0.0 0.0 0.0 110-111 2.3499999999999996 0.0 0.0 0.0 0.0 112-113 2.5999999999999996 0.0 0.0 0.0 0.0 114-115 2.875 0.0 0.0 0.0 0.0 116-117 3.275 0.0 0.0 0.0 0.0 118-119 3.675 0.0 0.0 0.0 0.0 120-121 3.9749999999999996 0.0 0.0 0.0 0.0 122-123 4.175 0.0 0.0 0.0 0.0 124-125 4.5875 0.0 0.0 0.0 0.0 126-127 5.0125 0.0 0.0 0.0 0.0 128-129 5.2875 0.0 0.0 0.0 0.0 130-131 5.6 0.0 0.0 0.0 0.0 132-133 5.8375 0.0 0.0 0.0 0.0 134-135 6.1 0.0 0.0 0.0 0.0 136-137 6.425 0.0 0.0 0.0 0.0 138-139 7.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686521 spots for SRR7169551.sra Written 686521 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra Read 686516 spots for SRR7169551.sra Written 686516 spots for SRR7169551.sra SRR ids: ['SRR7169551.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hnrt_g4q SRR7169551.sra spots: 13730325 blocks: [[1, 686516], [686517, 1373032], [1373033, 2059548], [2059549, 2746064], [2746065, 3432580], [3432581, 4119096], [4119097, 4805612], [4805613, 5492128], [5492129, 6178644], [6178645, 6865160], [6865161, 7551676], [7551677, 8238192], [8238193, 8924708], [8924709, 9611224], [9611225, 10297740], [10297741, 10984256], [10984257, 11670772], [11670773, 12357288], [12357289, 13043804], [13043805, 13730325]] SRR7169551 file size 4631056 SRR7169551 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169551 SRR7169551_1.fastq SRR7169551_2.fastq Input file: SRR7169551_1.fastq Paired file: SRR7169551_2.fastq trimmed: SRR7169551-trimmed-pair1.fastq, SRR7169551-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:37:39 2025 >> started Mon Feb 10 23:37:53 2025 >> done (14.350s) 13730325 read pairs processed; of these: 19131 ( 0.14%) short read pairs filtered out after trimming by size control 41688 ( 0.30%) empty read pairs filtered out after trimming by size control 13669506 (99.56%) read pairs available; of these: 7078620 (51.78%) trimmed read pairs available after processing 6590886 (48.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 4 0.00% 21 5 0.00% 22 3 0.00% 23 6 0.00% 24 10 0.00% 25 5 0.00% 26 6 0.00% 27 5 0.00% 28 9 0.00% 29 18 0.00% 30 23 0.00% 31 14 0.00% 32 11 0.00% 33 14 0.00% 34 14 0.00% 35 15 0.00% 36 19 0.00% 37 26 0.00% 38 24 0.00% 39 35 0.00% 40 36 0.00% 41 51 0.00% 42 45 0.00% 43 47 0.00% 44 58 0.00% 45 61 0.00% 46 78 0.00% 47 74 0.00% 48 103 0.00% 49 93 0.00% 50 139 0.00% 51 141 0.00% 52 198 0.00% 53 172 0.00% 54 200 0.00% 55 216 0.00% 56 224 0.00% 57 285 0.00% 58 327 0.00% 59 343 0.00% 60 403 0.00% 61 498 0.00% 62 499 0.00% 63 595 0.00% 64 690 0.01% 65 802 0.01% 66 890 0.01% 67 1182 0.01% 68 1516 0.01% 69 2077 0.02% 70 2169 0.02% 71 1850 0.01% 72 1978 0.01% 73 2300 0.02% 74 2517 0.02% 75 3288 0.02% 76 2977 0.02% 77 2479 0.02% 78 2951 0.02% 79 3993 0.03% 80 5483 0.04% 81 3999 0.03% 82 4421 0.03% 83 5055 0.04% 84 6284 0.05% 85 7251 0.05% 86 7901 0.06% 87 8194 0.06% 88 8392 0.06% 89 8959 0.07% 90 9453 0.07% 91 10167 0.07% 92 10823 0.08% 93 11653 0.09% 94 12794 0.09% 95 13420 0.10% 96 14528 0.11% 97 15661 0.11% 98 17240 0.13% 99 21936 0.16% 100 25675 0.19% 101 19039 0.14% 102 17520 0.13% 103 18412 0.13% 104 19124 0.14% 105 20022 0.15% 106 20772 0.15% 107 21477 0.16% 108 21735 0.16% 109 22851 0.17% 110 23210 0.17% 111 24247 0.18% 112 25619 0.19% 113 26797 0.20% 114 27537 0.20% 115 28806 0.21% 116 29790 0.22% 117 30659 0.22% 118 31894 0.23% 119 32245 0.24% 120 33219 0.24% 121 34539 0.25% 122 35485 0.26% 123 36975 0.27% 124 38901 0.28% 125 40483 0.30% 126 41831 0.31% 127 43316 0.32% 128 45401 0.33% 129 46440 0.34% 130 48706 0.36% 131 50579 0.37% 132 52970 0.39% 133 55776 0.41% 134 58849 0.43% 135 62412 0.46% 136 66361 0.49% 137 70611 0.52% 138 75382 0.55% 139 81576 0.60% 140 87432 0.64% 141 95210 0.70% 142 104650 0.77% 143 114638 0.84% 144 132816 0.97% 145 157049 1.15% 146 197746 1.45% 147 266505 1.95% 148 396295 2.90% 149 744005 5.44% 150 3032598 22.19% 151 6590886 48.22% 13669506 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.50 fanout-score-rank=25 prefix-density=0.20 prefix-fanout=3.6 sequence=CTTGGTGGCAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=362.51 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=21.4 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=39 prefix-density=0.26 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=55.73 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.0 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7169551 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:38:39 Started mapping on | Feb 10 23:38:39 Finished on | Feb 10 23:40:09 Mapping speed, Million of reads per hour | 546.78 Number of input reads | 13669506 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12924440 Uniquely mapped reads % | 94.55% Average mapped length | 291.63 Number of splices: Total | 11651662 Number of splices: Annotated (sjdb) | 11442110 Number of splices: GT/AG | 11474430 Number of splices: GC/AG | 137031 Number of splices: AT/AC | 10009 Number of splices: Non-canonical | 30192 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234519 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 31791 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.45% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 527552 527552 527552 N_multimapping 234519 234519 234519 N_noFeature 313595 12748511 395475 N_ambiguous 149827 1356 54662 UnstrandedReadsAssigned:12461018 PositiveStrandReadsAssigned:174573 NegativeStrandReadsAssigned:12474303 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169551 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169551-trimmed-pair1.fastq SRR7169551-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,669,506 reads, 12,442,916 reads pseudoaligned [quant] estimated average fragment length: 238.731 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,258 rounds 52401 SRR7169551.ke.tsv 34699 SRR7169551.se.tsv 87100 total ==> SRR7169551.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.27 236 10.8013 Potri.005G024800.1.v4.1 1035 797.269 52 5.31431 Potri.004G059700.1.v4.1 961 723.305 2 0.225298 Potri.007G009000.2.v4.1 1416 1178.27 0 0 Potri.003G141000.2.v4.1 2943 2705.27 215.034 6.47657 Potri.016G087400.1.v4.1 270 82.9408 1302.42 1279.48 Potri.015G069301.1.v4.1 564 330.886 0 0 Potri.010G195200.1.v4.1 1773 1535.27 82 4.35189 Potri.012G127500.1.v4.1 977 739.279 4448 490.235 ==> SRR7169551.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1749 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 229 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169551 completed mapping pipeline successfully